Name: a purification and in vitro activity assay for a (p)ppgpp synthetase from clostridium difficile
Uploaded: 2018-11-03T15:00:00
Description: Watch this Scientific Journal Video about A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile at JoVE.com

This work was funded by NIAID 1K22AI118929-01. EBP was supported by a Summer Research Fellowship Program Grant from the Office of Research at Old Dominion University, Norfolk, Virginia, USA.

1. Inducible Overexpression of a Histidine-tagged Protein
<ol>
	<li>Amplify rsh from C. difficile R20291 genomic DNA.
	<ol>
		<li>Use a high-fidelity polymerase and follow the manufacturer&#8217;s instructions.</li>
		<li>Amplify C. difficile rsh using primers 
		rsh_F(CAGGTACCGGTTATATGCATGATAAAGAATTACAAG) and 
		rsh_R(CCCTGCAGCTAATGGTGATGGTGATGGTGATTTGTCATTCTATAAATAC), which introduces a C-terminal hexahistidine tag. 
		NOTE: The KpnI and PstI...

<ol>
	<li>Cheek, S., Ginalski, K., Zhang, H., Grishin, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+update+of+the+sequence+and+structure+classification+of+kinases.">A comprehensive update of the sequence and structure classification of kinases.</a> BMC Structural Biology. 5 (1), 6 (2005).</li><li>Porath, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilized+metal+ion+affinity+chromatography.">Immobilized metal ion affinity chromatography.</a> Protein Expression and Purification. 3 (4), 263-281 (1992).</li><li>Arnau, J., Lauritzen, C., Pedersen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+strategy,+production+and+purification+of+proteins+with+exopeptidase-cleavable+His-tags.">Cloning strategy, production and purification of proteins with exopeptidase-cleavable His-tags.</a> Nature Protocols. 1 (5), 2326-2333 (2006).</li><li>Porath, J., Carlsson, J., Olsson, I., Belfrage, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metal+chelate+affinity+chromatography,+a+new+approach+to+protein+fractionation.">Metal chelate affinity chromatography, a new approach to protein fractionation.</a> Nature. 258 (5536), 598-599 (1975).</li><li>Smith, M. C., Furman, T. C., Ingolia, T. D., Pidgeon, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chelating+peptide-immobilized+metal+ion+affinity+chromatography.+A+new+concept+in+affinity+chromatography+for+recombinant+proteins.">Chelating peptide-immobilized metal ion affinity chromatography. A new concept in affinity chromatography for recombinant proteins.</a> Journal of Biological Chemistry. 263 (15), 7211-7215 (1988).</li><li>Graslund, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+purification.">Protein production and purification.</a> Nature Methods. 5 (2), 135-146 (2008).</li><li>Booth, W. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+an+N-terminal+Polyhistidine+Tag+on+Protein+Thermal+Stability.">Impact of an N-terminal Polyhistidine Tag on Protein Thermal Stability.</a> ACS Omega. 3 (1), 760-768 (2018).</li><li>Thielges, M. C., Chung, J. K., Axup, J. Y., Fayer, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+histidine+tag+attachment+on+picosecond+protein+dynamics.">Influence of histidine tag attachment on picosecond protein dynamics.</a> Biochemistry. 50 (25), 5799-5805 (2011).</li><li>Chaga, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty-five+years+of+immobilized+metal+ion+affinity+chromatography:+past,+present+and+future.">Twenty-five years of immobilized metal ion affinity chromatography: past, present and future.</a> Journal of Biochemical and Biophysical Methods. 49 (1-3), 313-334 (2001).</li><li>Ma, H., Deacon, S., Horiuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+challenge+of+selecting+protein+kinase+assays+for+lead+discovery+optimization.">The challenge of selecting protein kinase assays for lead discovery optimization.</a> Expert opinion on drug discovery. 3 (6), 607-621 (2008).</li><li>Tamayo, R., Tischler, A. D., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+EAL+domain+protein+VieA+is+a+cyclic+diguanylate+phosphodiesterase.">The EAL domain protein VieA is a cyclic diguanylate phosphodiesterase.</a> Journal of Biological Chemistry. 280 (39), 33324-33330 (2005).</li><li>Purcell, E. B., McKee, R. W., McBride, S. M., Waters, C. M., Tamayo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+Diguanylate+Inversely+Regulates+Motility+and+Aggregation+in+Clostridium+difficile.">Cyclic Diguanylate Inversely Regulates Motility and Aggregation in Clostridium difficile.</a> Journal of Bacteriology. 194 (13), 3307-3316 (2012).</li><li>Purcell, E. B., Tamayo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+cyclic+nucleotide+phosphodiesterases.">Identification and characterization of cyclic nucleotide phosphodiesterases.</a> Methods in Molecular Biology. 1016, 235-243 (2013).</li><li>Ross, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+cellulose+synthesis+Acetobacter+xylinum.+A+unique+guanyl+oligonucleotide+is+the+immediate+activator+of+the+cellulose+synthase.">Control of cellulose synthesis Acetobacter xylinum. A unique guanyl oligonucleotide is the immediate activator of the cellulose synthase.</a> Carbohydrate Research. 149 (1), 101-117 (1986).</li><li>Potrykus, K., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=(p)ppGpp:+still+magical?.">(p)ppGpp: still magical?.</a> Annual Review of Microbiology. 62, 35-51 (2008).</li><li>Boutte, C. C., Crosson, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+lifestyle+shapes+stringent+response+activation.">Bacterial lifestyle shapes stringent response activation.</a> Trends in Microbiology. 21 (4), 174-180 (2013).</li><li>Nanamiya, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+functional+analysis+of+novel+(p)ppGpp+synthetase+genes+in+Bacillus+subtilis.">Identification and functional analysis of novel (p)ppGpp synthetase genes in Bacillus subtilis.</a> Molecular Microbiology. 67 (2), 291-304 (2008).</li><li>Gaca, A. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basal+Levels+of+(p)ppGpp+in+Enterococcus+faecalis:+the+Magic+beyond+the+Stringent+Response.">Basal Levels of (p)ppGpp in Enterococcus faecalis: the Magic beyond the Stringent Response.</a> mBio. 4 (5), (2013).</li><li>Sebaihia, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multidrug-resistant+human+pathogen+Clostridium+difficile+has+a+highly+mobile,+mosaic+genome.">The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome.</a> Nature Genetics. 38 (7), 779-786 (2006).</li><li>Gasteiger, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ExPASy:+The+proteomics+server+for+in-depth+protein+knowledge+and+analysis.">ExPASy: The proteomics server for in-depth protein knowledge and analysis.</a> Nucleic Acids Research. 31 (13), 3784-3788 (2003).</li><li>Purcell, E. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nutrient-regulated+cyclic+diguanylate+phosphodiesterase+controls+Clostridium+difficile+biofilm+and+toxin+production+during+stationary+phase.">A nutrient-regulated cyclic diguanylate phosphodiesterase controls Clostridium difficile biofilm and toxin production during stationary phase.</a> Infection and Immunity. , (2017).</li><li>Mechold, U., Murphy, H., Brown, L., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intramolecular+Regulation+of+the+Opposing+(p)ppGpp+Catalytic+Activities+of+RelSeq,+the+Rel/Spo+Enzyme+from+Streptococcus+equisimilis.">Intramolecular Regulation of the Opposing (p)ppGpp Catalytic Activities of RelSeq, the Rel/Spo Enzyme from Streptococcus equisimilis.</a> Journal of Bacteriology. 184 (11), 2878-2888 (2002).</li><li>Dalebroux, Z. D., Svensson, S. L., Gaynor, E. C., Swanson, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ppGpp+Conjures+Bacterial+Virulence.">ppGpp Conjures Bacterial Virulence.</a> Microbiology and Molecular Biology Reviews. 74 (2), 171-199 (2010).</li><li>Bartlett, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clostridium+difficile:+progress+and+challenges.">Clostridium difficile: progress and challenges.</a> Annals of the New York Academy of Sciences. 1213, 62-69 (2010).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> US Department of Health and Human Services. , (2013).</li></ol>

Here we report the purification of His-tagged RSH from C. difficile and present a method for activity quantification using radiolabeled thin layer chromatography. This method has previously been used to assess the activity of diguanylate cyclase enzymes from C. difficile, as well as (p)ppGpp synthetase, nucleotide cyclase, kinase and phosphodiesterase enzymes from other organisms11,12,13,<sup class="...

Kinase and pyrophosphokinase (or diphospho-kinase) enzymes transfer phosphates from nucleotide triphosphate (NTP) precursors to substrate molecules. The substrates can include other nucleotides, amino acids or proteins, carbohydrates, and lipids1. Bioinformatic analyses can sometimes predict an enzyme&#39;s cognate substrate or substrates based on the similarity to characterized enzymes, but experimental validation is still necessary. Similarly, the affinity of an enzyme for its substrate(s) and the rate at which it catalyzes the phosphor-transfer reaction, and the effects of co-factors, inhibitors, or other enzyme effectors must be determined experimentally. To avoid depletion of the ATP precursor by other ATP-consuming enzymes present in bacterial cytoplasm, quantitative activity assays require purified protein.
Protein purification by metal affinity chromatography has been covered thoroughly in the literature2,3. Histidine tags consisting of six consecutive histidine residues appended to the N- or C-terminus of a recombinant protein allow rapid purification by metal affinity chromatography4,5,6. These sequences are small compared to the proteins they modify and typically have a minimal effect on protein function, although they can sometimes alter protein stability and/or enzyme kinetics7,8. Histidine tags at the N- and C-termini of the same protein can have different effects, which are difficult to predict without knowing the structure of the protein in question. Histidine tags are typically incorporated during the cloning of a recombinant protein by designing primers that encode six histidine residues, either immediately 3&#39; to the ATG start codon or immediately 5&#39; to the stop codon of the open reading frame. After amplification, the hexahistidine-containing gene is ligated into a vector under the control of an inducible promoter and expressed, typically in a laboratory strain of E. coli. The recombination protein can then be isolated on an affinity resin containing immobilized divalent cations (typically nickel or cobalt)9. Contaminating native metal-binding proteins can be removed by titration with imidazole, which competitively displaces bound protein2. Finally, the target protein is eluted from the column with higher concentrations of imidazole. There are several commercial sources for immobilized metal cation resins, and the manufacturers provide recommendations for the buffer conditions and imidazole concentrations. After elution, protein may be analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), dialyzed, or used immediately in functional assays.
There are several methods to indirectly monitor kinase activity by coupling ATP phosphate bond hydrolysis to a second reaction that releases or excites a fluorophore or generates chemiluminescence, but these reactions have multiple moving parts and can be logistically challenging10. The most straightforward way to specifically measure phosphor-transfer activity is to directly monitor the transfer of a radiolabeled phosphate group from a commercially available &#947;-32-P NTP precursor to a non-radiolabeled substrate11,12,13. Mixtures of radiolabeled substrates and products can be separated and quantified by thin layer chromatography (TLC). TLC utilizes the differential mobility of solutes in a given solvent by allowing the solvent (liquid phase) to migrate by capillary action across a surface (solid phase) upon which a mixture of solutes has been adsorbed14. Solutes that are small and/or lack favorable interactions with the solid phase will migrate longer distances from their initial location than solutes with higher molecular weights or great affinities for the solid. For examination of phosphor-transfer, phosphate moieties increase the molecular weight of molecules they are added to, and add negative ionic charge at neutral or acidic pH11,12,14. This decreases their mobility on a basic surface such as PEI-cellulose. When developed in acidic potassium phosphate buffer, mixtures of mono-, di-, tri-, tetra-, and pentaphosphate species can be readily separated on PEI-cellulose, allowing quantification of each species (Figure 2, Figure 3). Such assays can be performed using cell lysates containing the enzyme of interest, but this includes the potential for the activity of other kinases, phosphatases, and general ATPases to deplete the substrate and/or product. For a quantitative in vitro assessment of enzyme activity, it is necessary to purify the enzyme of interest.
Guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) are ribonucleotide signaling molecules formed by the transfer of a pyrophosphate group from an adenosine triphosphate (ATP) precursor to, respectively, a guanosine diphosphate (GDP) or guanosine tetraphosphate (GTP) substrate15. These single ribonucleotide signals, collectively known as (p)ppGpp, mediate a cell-wide response to environmental stress known as the stringent response in diverse bacterial species15,16. Two conserved classes of enzymes catalyze the formation of (p)ppGpp15,17 Rel/Spo homolog (RSH) enzymes are &#39;long&#39; bifunctional (p)ppGpp synthetase/hydrolases named for their similarity to the RelA and SpoT (p)ppGpp metabolic enzymes from Escherichia coli which contain synthetase, hydrolase, and regulatory domains, while small alarmone synthetase (SAS) enzymes are short monofunctional synthetases found exclusively in Gram positive bacteria15,17,18. The spore-forming Gram-positive bacterium Clostridium difficile encodes putative RSH and SAS genes19. Here, we present initial activity assays that confirm that the C. difficile RSH enzyme is a catalytically active (p)ppGpp synthetase.

<table>
	<tbody>
		<tr>
			<td>Inducible overexpression of a histidine-tagged protein</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Phusion polymerase</td>
			<td>New England Biolabs (NEB)</td>
			<td>M0530L</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAEX II DNA Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>20021</td>
			<td></td>
		</tr>
		<tr>
			<td>KpnI restriction enzyme</td>
			<td>NEB</td>
			<td>R0142S</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI restriction enzyme</td>
			<td>NEB</td>
			<td>R0140S</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>NEB</td>
			<td>M0202</td>
			<td></td>
		</tr>
		<tr>
			<td>NEB&#174; 5-alpha Competent&#160;E. coli&#160;(High Efficiency)</td>
			<td>NEB</td>
			<td>C2987I</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 (DE3) Competent E. coli</td>
			<td>NEB</td>
			<td>C2527I</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Sigma-Aldrich</td>
			<td>10724815001</td>
			<td></td>
		</tr>
		<tr>
			<td>JXN-26 centrifuge with JLA 10.500 rotor</td>
			<td>Beckman Coulter Avanti</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge with D3024/D3024R rotor</td>
			<td>Scilogex</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>MaxQ SHKE6000 Incubator</td>
			<td>Thermo Scientific</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultrasonic processor</td>
			<td>Sonics</td>
			<td>VC-750</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein purification by nickel affinity chromatography</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA resin</td>
			<td>G Biosciences</td>
			<td>786-940/941</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce Disposable Gravity columns, 10 mL</td>
			<td>Thermo Scientific</td>
			<td>29924</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mL Spectra/ Por float-A-lyzer G2 dialysis device (MWCO: 20-kD)</td>
			<td>Spectrum</td>
			<td>G235033</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Electrophoresis Cell</td>
			<td>BioRad</td>
			<td>1658004</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein activity assay by thin layer chromatography</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Thin layer chromatograph (TLC) development tank</td>
			<td>General Glass Blowing Company</td>
			<td>80-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine (PEI)-cellulose plates (20 cm x 20 cm, 100 um thickness) with polyester support</td>
			<td>Sigma-Aldrich</td>
			<td>Z122882-25EA</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP, [&#947;-32P]- 3000 Ci/mmol 10mCi/ml lead, 100 &#956;Ci</td>
			<td>Perkin Elmer</td>
			<td>NEG002A</td>
			<td></td>
		</tr>
		<tr>
			<td>Adenosine 5&#8217;-triphosphate (ATP) 100 mM</td>
			<td>Bio Basic Canada</td>
			<td>AB0311</td>
			<td></td>
		</tr>
		<tr>
			<td>Guanosine-5&#8217;-diphosphate disodium salt (GDP)</td>
			<td>Alfa Aesar</td>
			<td>AAJ61646MC/E</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage phosphor screen</td>
			<td>GE Healthcare Life Sciences</td>
			<td>BAS-IP TR 2040 E Tritium Screen</td>
			<td></td>
		</tr>
		<tr>
			<td>Storm 860 phosphorimager</td>
			<td>GE Healthcare Life Sciences</td>
			<td>-</td>
			<td></td>
		</tr>
	</tbody>
</table>

a purification and in vitro activity assay for a (p)ppgpp synthetase from clostridium difficile

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to substrates to create phosphorylated products. The use of &#947;-32-P labeled NTP precursors allows simultaneous monitoring of substrate utilization and product formation by radiography. Thin layer chromatography (TLC) on cellulose plates allows rapid separation and sensitive quantification of substrate and product. We present a method for utilizing the thin-layer chromatography to assay the pyrophosphokinase activity of a purified (p)ppGpp synthetase. This method has previously been used to characterize the activity of cyclic nucleotide and dinucleotide synthetases and is broadly suitable for characterizing the activity of any enzyme that hydrolyzes a nucleotide triphosphate bond or transfers a terminal phosphate from a phosphate donor to another molecule.

We present a method for the affinity purification of a (p)ppGpp synthetase from Clostridium difficile and the assessment of its enzymatic activity. Figure 1 demonstrates the protein purification achieved by metal affinity chromatography. The second elution (E2) fraction from this purification was dialyzed and used for the enzymatic activity assay. Figure 2 details the necessary steps to prepare for and carry out pyrophos...

Watch this Scientific Journal Video about A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile at JoVE.com

A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile

Here, we describe a method for purifying histidine-tagged pyrophosphokinase enzymes and utilizing thin layer chromatography of radiolabelled substrates and products to assay for the enzymatic activity in vitro. The enzyme activity assay is broadly applicable to any kinase, nucleotide cyclase, or phosphor-transfer reaction whose mechanism includes nucleotide triphosphate hydrolysis.

A Purification and In Vitro Activity Assay for a (p)ppGpp Synthetase from Clostridium difficile

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to ...

Research

JoVE Journal

Immunology and Infection

In vitro Biofilm Formation in an 8-well Chamber Slide

In vitro Biofilm Formation in an 8-well Chamber Slide

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. ...

Measurement of Factor V Activity in Human Plasma Using a Microplate Coagulation Assay

 In response to injury, blood coagulation is activated and results in generation of the clotting protease, thrombin. Thrombin cleaves fibrinogen to fibrin ...

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne ...

Culturing and Maintaining Clostridium difficile in an Anaerobic Environment

Culturing and Maintaining Clostridium difficile in an Anaerobic Environment

Clostridium  difficile is a Gram-positive, anaerobic, sporogenic bacterium  that is primarily responsible for antibiotic associated diarrhea (AAD) and is ...

In vitro Coculture Assay to Assess Pathogen Induced Neutrophil Trans-epithelial Migration

In vitro Coculture Assay to Assess Pathogen Induced Neutrophil Trans-epithelial Migration

Mucosal surfaces serve as protective barriers against pathogenic organisms.&#160;Innate immune responses are activated upon sensing pathogen leading to ...

Isolation, Identification, and Purification of Murine Thymic Epithelial Cells

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple ...

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

Analysis of the transcriptome of bacterial pathogens during mammalian infection is a valuable tool for studying genes and factors that mediate infection. ...

Flow Cytometric Analysis of Natural Killer Cell Lytic Activity in Human Whole Blood

NK cell cytotoxicity is a widely used measure to determine the effect of outside intervention on NK cell function. However, the accuracy and ...

Cefoperazone-treated Mouse Model of Clinically-relevant Clostridium difficile Strain R20291

Cefoperazone-treated Mouse Model of Clinically-relevant Clostridium difficile Strain R20291

Clostridium difficile is an anaerobic, gram-positive, spore-forming enteric pathogen that is associated with increasing morbidity and mortality and ...

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

Assessment of antibiotic action with new drug development directed towards anaerobic bacteria is difficult and technically demanding. To gain insight into ...