The authors wish to thank the Imaging Facility at Center for Life Nano Science, Istituto Italiano di Tecnologia, for support and technical advice. We are grateful to members of the Center for Life Nano Science for helpful discussion. This work was partially supported by a grant from AriSLA (pilot grant 2016 &#34;StressFUS&#34;) to AR.

1. Maintenance of Human iPSCs
<ol>
	<li>Preparation of matrix-coated plates
	<ol>
		<li>Thaw one 5 mL vial of matrix (see Table of Materials) at 4 &#176;C overnight. The original matrix stocks come at different stock concentrations and aliquots are made according to the dilution factor indicated on the datasheet, specific for the individual lot. It is important to keep the vial and tubes ice cold to prevent premature gelling of the matrix. Dispense matrix into aliquots in pre-chilled cryotubes on ice. Freeze unused aliquots at -20 &#176;C.</li>
		<li>Place one aliquot on ice for about 2 h to thaw.</li>
		<li>Dilute the aliquot of matrix with 20 mL of cold DMEM/F12 in a 50 mL conical tube.</li>
		<li>Mix well and dispense 1 mL of diluted matrix into 35 mm dishes (equivalent amounts per surface area of other dishes).</li>
		<li>Keep the dishes containing diluted matrix for 1 h at room temperature to allow coating. 
		NOTE: Dishes, sealed with parafilm, can be stored at 4 &#176;C for up to 2 weeks.</li>
	</ol>
	</li>
	<li>Preparation of the stock solution (20 mL) and 1x working aliquots of the gentle cell dissociation reagent (see Table of Materials).
	<ol>
		<li>Dissolve powder to 10 mg/mL in PBS (Ca2+/Mg2+ free).</li>
		<li>Filter sterilize through a 0.22 &#956;m filter membrane.</li>
		<li>Prepare 20 aliquots (1 mL each) and store at -20 &#176;C.</li>
		<li>Before use, dilute one aliquot in PBS (Ca2+/Mg2+ free) to 1 mg/mL (1x working aliquots). 
		NOTE: 1x working aliquots can be stored at 4 &#176;C for up to 2 weeks.</li>
	</ol>
	</li>
	<li>Passaging human iPSCs.
	<ol>
		<li>Before starting: If stored at 4 &#176;C, pre-warm matrix-coated plates in the incubator at 37 &#176;C for 20-30 min. Pre-warm at room temperature the amount of human iPSC medium (see Table of Materials) needed. Pre-warm the DMEM/F12.</li>
		<li>Aspirate culture medium.</li>
		<li>Rinse iPSCs with PBS (Ca2+/Mg2+ free).</li>
		<li>Add 1x gentle dissociation solution (0.5 mL for a 35 mm dish). Incubate at 37 &#176;C until the edges of the colonies begin to detach from the plate, usually 3-5 min.</li>
		<li>Aspirate the gentle dissociation solution, being careful not to detach iPSC colonies.</li>
		<li>Wash the cells with DMEM/F12 (2 mL for a 35 mm dish) and aspirate being careful not to detach the cells. Repeat this step one more time.</li>
		<li>Add human iPSC medium (1 mL for a 35 mm dish).</li>
		<li>Gently detach the colonies off with a cell lifter and transfer to a 15 mL tube.</li>
		<li>Gently break cell clumps by pipetting up and down with a P1000 pipettor 3-4 times.</li>
		<li>Aspirate the supernatant from the matrix-coated plate(s).</li>
		<li>Seed the cells in the appropriate culture volume of human iPSC medium. The split ratio can vary from line to line and is about 1:4-1:8. Change the medium daily.</li>
	</ol>
	</li>
</ol>
2. Generation of NIL and NIP Inducible iPSC Lines
<ol>
	<li>Cell transfection.
	<ol>
		<li>Rinse the cells with PBS (Ca2+/Mg2+ free).</li>
		<li>Add cell dissociation reagent (see Table of Materials) (0.35 mL for a 35 mm dish) and incubate at 37 &#176;C until single cells are separated (5-10 min).</li>
		<li>Gently complete cell separation by pipetting up and down with a P1000 pipettor 3-4 times.</li>
		<li>Collect in a 15 mL tube and add PBS (Ca2+/Mg2+ free) to 10 mL. Count the cells.</li>
		<li>Pellet 106 cells and resuspend in 100 &#956;l of Buffer R (included in the cell electroporation kit, see Table of Materials).</li>
		<li>Add plasmid DNA for transfection: 4.5&#8239;&#956;g of transposable vector (epB-Bsd-TT-NIL or epB-Bsd-TT-NIP12) and 0.5&#8239;&#956;g of the piggyBac transposase plasmid13.</li>
		<li>Transfect with the cell electroporation system (see Table of Materials) according to manufacturer&#8217;s instructions and as previously described3 with the following parameters: 1,200 V voltage, 30 ms width, 1 pulse. Seed the cells in human iPSC medium supplemented with 10&#8239;&#956;M Y-27632 (ROCK inhibitor, see Table of Materials) in a 6 mm matrix-coated dish.</li>
	</ol>
	</li>
	<li>Selection with antibiotics.
	<ol>
		<li>Two days after transfection, add 5&#8239;&#956;g/mL blasticidin to the culture medium.</li>
		<li>Most of the non-transfected cells will die within 48 h of blasticidin selection. Keep the cells in blasticidin for at least 7-10 days to counter-select the cells that have not integrated the transgenes in the genome.</li>
		<li>Maintain stably transfected cells as a mixed population, composed of cells with different number of transgenes and different integration sites, or isolate single clones.</li>
		<li>Prepare an additional dish to check for effective expression of the transgenes, upon 1 &#956;g/mL doxycycline induction, by RT-PCR with transgene-specific primers for Ngn2 (Forward: TATGCACCTCACCTCCCCATAG; Reverse: GAAGGGAGGAGGGCTCGACT), as previously described12.</li>
		<li>At this stage, freeze stocks of the novel NIL- and NIP-iPSC lines in freezing medium for human iPSCs (see Table of Materials).</li>
	</ol>
	</li>
</ol>
3. Motor Neuron Differentiation
<ol>
	<li>Dissociate the cells with cell dissociation reagent as described (steps 2.1.1.-2.1.3.). Collect dissociated cells in a 15 mL tube and dilute with 5 volumes of DMEM/F12. Pellet the cells and resuspend in human iPSC medium supplemented with 10&#8239;&#956;M ROCK inhibitor. Count the cells and seed on matrix-coated dishes at a density of 62,500 cells/cm2.</li>
	<li>The day after, replace the medium with DMEM/F12, supplemented with 1x stable L-glutamine analogue, 1x non-essential amino acid (NEAA) cell culture supplement and 0.5x penicillin/streptomycin, and containing 1&#8239;&#956;g/mL doxycycline. This is considered as day 0 of differentiation. On day 1, refresh the medium and doxycycline.</li>
	<li>On day 2, change the medium to Neurobasal/B27 medium (Neurobasal Medium supplemented with 1x B27, 1x stable L-glutamine analogue, 1x NEAA and 0.5x penicillin/streptomycin), containing 5&#8239;&#956;M DAPT, 4&#8239;&#956;M SU5402 and 1&#8239;&#956;g/mL doxycycline (see Table of Materials). Refresh the medium and doxycycline every day until day 5.</li>
	<li>Day 5: Cells dissociation with cell dissociation reagent (see Table of Materials).
	<ol>
		<li>Rinse the cells with PBS (Ca2+/Mg2+ free).</li>
		<li>Add cell dissociation reagent (0.35 mL for a 35 mm dish) and incubate at 37 &#176;C until the entire cell monolayer separates from the dish. Note that single cells will not be separated during incubation.</li>
		<li>Add 1 mL of DMEM/F12 and collect the cells in a 15 mL tube.</li>
		<li>Gently complete cell separation by pipetting up and down with a P1000 pipettor 10-15 times.</li>
		<li>Add 4 mL of DMEM/F12 and count the cells.</li>
		<li>At this stage, freeze motor neuron progenitors in cell freezing medium (see Table of Materials), according to manufacturer instructions.</li>
		<li>Pellet the cells and resuspend in Neuronal Medium (Neurobasal/B27 medium supplemented with 20&#8239;ng/mL BDNF, 10&#8239;ng/mL GDNF and 200&#8239;ng/mL L-ascorbic acid, see Table of Materials) supplemented with 10&#8239;&#956;M ROCK inhibitor.</li>
		<li>Seed the cells on poly-ornithine/laminin- or alternatively on matrix-coated supports at the density of 100,000 cells/cm2. Use &#181;-Slide plastic supports with polymer coverslip (see Table of Materials) for immunostaining analysis.</li>
	</ol>
	</li>
	<li>On day 6, change the medium with fresh Neuronal Medium devoid of ROCK inhibitor. On the next days, refresh half of the medium every 3 days. Culture medium must be changed very carefully in order to prevent detachment from the surface.</li>
</ol>
4. Immunostaining Analysis
<ol>
	<li>Cell fixation. Rinse the cells with PBS (with Ca2+/Mg2+) and incubate for 15 min in 4% paraformaldehyde in PBS (with Ca2+/Mg2+) at room temperature. 
	CAUTION: Paraformaldehyde is toxic and suspected to cause cancer. Avoid contact with skin and eyes and handle under a chemical fume hood.</li>
	<li>Permeabilize with PBS (with Ca2+/Mg2+) containing 0.1% Triton X-100 for 5 min at room temperature.</li>
	<li>Incubate for 30 min at room temperature in antibody blocking solution (ABS: 3% BSA in PBS with Ca2+/Mg2+).</li>
	<li>Incubate for 1 h at room temperature with primary antibodies in ABS: anti-TUJ1 (1:1000; rabbit) and anti-Oct4 (1:200; mouse) or anti-CHAT (Anti-Choline Acetyltransferase; 1:150; goat). See Table of Materials.</li>
	<li>Incubate for 45 min at room temperature with appropriate donkey secondary antibody pair in ABS: anti-mouse Alexa Fluor 647 (1:250), anti-rabbit Alexa Fluor 594 (1:250) and anti-goat Alexa Fluor 488 (1:250). See Table of Materials.</li>
	<li>Incubate in 0.4 &#956;g/mL DAPI for 5 min at room temperature to label nuclei.</li>
	<li>Mount the cells with Mounting Medium (see Table of Materials) for imaging at a fluorescence microscope.</li>
</ol>
5. Functional Characterization via Patch-clamp Recordings
<ol>
	<li>Prepare the HEPES-equilibrated external solution (NES) as following: 140 mM NaCl, 2.8 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 10 mM HEPES, and 10 mM glucose. Set the osmolarity between 290-300 m&#937;. Adjust the pH to 7.3 using 1N NaOH and store the solution at 4 &#176;C.</li>
	<li>Prepare the internal solution: 140 mM K-gluconate, 2 mM NaCl, 5 mM BAPTA, 2 mM MgCl2, 10 mM HEPES, 2 mM Mg-ATP, 0.3 mM Na-GTP. Adjust the pH to 7.3 with 1M KOH and check that the osmolarity is set at around 290 m&#937;. Freeze the solution at -20 &#176;C in small aliquots.</li>
	<li>Before running the experiments, pre-warm the NES solution in a water bath to about 28-30 &#176;C.</li>
	<li>Pull some borosilicate micropipettes (ID 0.86 mm; OD 1.5 mm) bearing a tip resistance: 5-6 M&#937; and fill with the intracellular solution before mounting into the pipette holder. 
	NOTE: Remember to chloride silver wires of the recording electrode and reference electrode in bleach for at least 30 min in order to form a uniform layer of AgCl on the wire surface.</li>
	<li>Transfer the Petri dish in the recording chamber and let the chamber with the NES solution at 1-2 mL/min. Let the flow passing through an inline heater set at temperature of 30 &#176;C in order to keep the solution warm.</li>
	<li>Place electrophysiological recording chamber under an upright microscope. Record membrane currents with the patch-clamp amplifier and acquire data with an appropriate software.</li>
	<li>Open the amplifier control software, and set the signal gain at value 1 and the Bessel filter at 10 kHz. Ensure that the Bessel filter is 2.5 times lower than the sampling frequency.</li>
	<li>Set the experimental protocols for voltage-clamp and current-clamp experiments in the recording software.</li>
	<li>In the protocol setting, tick episodic stimulation mode and set the sampling frequency at 25 kHz. Then, move to the waveform tab and type the voltage or current step amplitude and length as follow.</li>
	<li>For the voltage-gated sodium currents, use 15 voltage steps (50 ms duration each) from -100 mV to +40 mV (10 mV increment). Run the protocol after imposing to the patched cell a holding potential of -60 mV through the amplifier. Similarly, the voltage-gated potassium currents are evoked by voltage steps (250 ms duration each) from -30 mV to +50 mV (10 mV increment) holding the recorded cell to -40 mV.</li>
	<li>For investigating the firing properties of iPSC-derived cranial and spinal MNs, clamp cells, in current-clamp mode, at a membrane potential of -70 mV and use 4 current pulses (1 s duration each) of increasing amplitude (from +20 pA to +80 pA; 20 pA increment).</li>
	<li>Acquire for each cell voltage-activated currents, evoked firing activity and three passive properties as whole-cell capacitance (Cm), cell membrane resistance (Rm) and Resting Membrane Potential (RMP).</li>
</ol>

<ol>
	<li>Dimos, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+Pluripotent+Stem+Cells+Generated+from+Patients+with+ALS+Can+Be+Differentiated+into+Motor+Neurons.">Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons.</a> Science (New York, NY). 321 (5893), 1218 (2008).</li><li>Ebert, A. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cells+from+a+spinal+muscular+atrophy+patient.">Induced pluripotent stem cells from a spinal muscular atrophy patient.</a> Nature. 457 (7227), 277-280 (2009).</li><li>Lenzi, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ALS+mutant+FUS+proteins+are+recruited+into+stress+granules+in+induced+Pluripotent+Stem+Cells+(iPSCs)+derived+motoneurons.">ALS mutant FUS proteins are recruited into stress granules in induced Pluripotent Stem Cells (iPSCs) derived motoneurons.</a> Disease models &amp; mechanisms. 8 (7), 755-766 (2015).</li><li>Wijesekera, L. C., Leigh, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amyotrophic+lateral+sclerosis.">Amyotrophic lateral sclerosis.</a> Orphanet journal of rare diseases. 4 (3), 1-22 (2009).</li><li>Yan, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Frameshift+and+novel+mutations+in+FUS+in+familial+amyotrophic+lateral+sclerosis+and+ALS/dementia.">Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia.</a> Neurology. 75 (9), 807-814 (2010).</li><li>Boulting, G. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+functionally+characterized+test+set+of+human+induced+pluripotent+stem+cells.">A functionally characterized test set of human induced pluripotent stem cells.</a> Nature biotechnology. 29 (3), 279-286 (2011).</li><li>Amoroso, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accelerated+high-yield+generation+of+limb-innervating+motor+neurons+from+human+stem+cells.">Accelerated high-yield generation of limb-innervating motor neurons from human stem cells.</a> The Journal of neuroscience: the official journal of the Society for Neuroscience. 33 (2), 574-586 (2013).</li><li>Maury, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+analysis+of+developmental+cues+efficiently+converts+human+pluripotent+stem+cells+into+multiple+neuronal+subtypes.">Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes.</a> Nature biotechnology. 33 (1), 89-96 (2015).</li><li>Allodi, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+neuronal+vulnerability+identifies+IGF-2+as+a+protective+factor+in+ALS.">Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS.</a> Scientific reports. 6, 25960 (2016).</li><li>Kaplan, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuronal+matrix+metalloproteinase-9+is+a+determinant+of+selective+neurodegeneration.">Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration.</a> Neuron. 81 (2), 333-348 (2014).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synergistic+binding+of+transcription+factors+to+cell-specific+enhancers+programs+motor+neuron+identity.">Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity.</a> Nature neuroscience. 16 (9), 1219-1227 (2013).</li><li>De Santis, R., Garone, M. G., Pagani, F., de Turris, V., Di Angelantonio, S., Rosa, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+conversion+of+human+pluripotent+stem+cells+into+cranial+motor+neurons+using+a+piggyBac+vector.">Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector.</a> Stem Cell Research. 29, 189-196 (2018).</li><li>Yusa, K., Zhou, L., Li, M. A., Bradley, A., Craig, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hyperactive+piggyBac+transposase+for+mammalian+applications.">A hyperactive piggyBac transposase for mammalian applications.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (4), 1531-1536 (2011).</li><li>Sances, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+ALS+with+motor+neurons+derived+from+human+induced+pluripotent+stem+cells.">Modeling ALS with motor neurons derived from human induced pluripotent stem cells.</a> Nature Neuroscience. 16 (4), 542-553 (2016).</li><li>Miller, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+iPSC-based+modeling+of+late-onset+disease+via+progerin-induced+aging.">Human iPSC-based modeling of late-onset disease via progerin-induced aging.</a> Cell stem cell. 13 (6), 691-705 (2013).</li><li>Lenzi, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+control+and+ALS+mutant+human+iPSCs+into+functional+skeletal+muscle+cells,+a+tool+for+the+study+of+neuromuscolar+diseases.">Differentiation of control and ALS mutant human iPSCs into functional skeletal muscle cells, a tool for the study of neuromuscolar diseases.</a> Stem Cell Research. 17 (1), 140-147 (2016).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+Single-Step+Induction+of+Functional+Neurons+from+Human+Pluripotent+Stem+Cells.">Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells.</a> Neuron. 78 (5), 785-798 (2013).</li><li>Theka, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+functional+dopaminergic+neurons+from+human+induced+pluripotent+stem+cells+through+a+single-step+procedure+using+cell+lineage+transcription+factors.">Rapid generation of functional dopaminergic neurons from human induced pluripotent stem cells through a single-step procedure using cell lineage transcription factors.</a> Stem cells translational medicine. 2 (6), 473-479 (2013).</li><li>Pawlowski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+and+Deterministic+Forward+Programming+of+Human+Pluripotent+Stem+Cells+into+Neurons,+Skeletal+Myocytes,+and+Oligodendrocytes.">Inducible and Deterministic Forward Programming of Human Pluripotent Stem Cells into Neurons, Skeletal Myocytes, and Oligodendrocytes.</a> Stem Cell Reports. 8 (4), 803-812 (2017).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+Generation+of+Functional+Subtype+Astrocytes+from+Human+Pluripotent+Stem+Cells.">Fast Generation of Functional Subtype Astrocytes from Human Pluripotent Stem Cells.</a> Stem Cell Reports. 11 (4), 998-1008 (2018).</li><li>Nehme, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combining+NGN2+Programming+with+Developmental+Patterning+Generates+Human+Excitatory+Neurons+with+NMDAR-Mediated+Synaptic+Transmission.">Combining NGN2 Programming with Developmental Patterning Generates Human Excitatory Neurons with NMDAR-Mediated Synaptic Transmission.</a> Cell reports. 23 (8), 2509-2523 (2018).</li></ol>

The authors have nothing to disclose

This protocol allows to efficiently convert human iPSCs into spinal and cranial motor neurons thanks to the ectopic expression of lineage-specific transcription factors. These transgenes are inducible by doxycycline and stably integrated in the genome thanks to a piggyBac transposon-based vector. In a mixed population, one or several copies of the piggyBac vector will be randomly integrated into the genome of individual cells, increasing the risk of genome integrity alterations. Moreover, a progressive selection of iPSC ...

Motor neuron (MN) degeneration plays a causative role in human diseases such as Amyotrophic Lateral Sclerosis (ALS) and Spinal Muscular Atrophy (SMA). Establishing suitable in vitro cell model systems that recapitulate the complexity of the human MN is an important step towards the development of new therapeutic approaches. Induced pluripotent stem cells (iPSCs), which are endowed with remarkable plurilineage differentiation properties, have now been derived from a number of patients affected by motor neuron diseases1,2. Additional iPSC lines carrying pathogenic mutations associated to MN diseases have been generated by gene editing, starting from control &#34;healthy&#34;&#160;pluripotent stem cells3. These lines represent useful tools for in vitro disease modeling and drug screening, provided that appropriate methods for iPSC differentiation into MNs are available. The rationale behind the development of this method is to provide the scientific community interested in MN diseases with a fast and efficient differentiation protocol giving rise to mature functional MNs. The first advantage of this method is its timeframe of execution. Another relevant point of strength comes from the elimination of any purification step. Finally, the protocol can be used to generate two distinct populations of motor neurons.
The possibility of generating different subtypes of MNs is particularly relevant for modeling of MN diseases. Not all MN subtypes are equally vulnerable in ALS and SMA and the onset of symptoms in different motor units greatly influences the prognosis. In ALS, spinal onset with symptoms starting in upper and lower limbs leads to death in about 3-5&#8239;years4. Conversely, bulbar onset, starting with degeneration of cranial MNs, has a worst prognosis. Moreover, the percentage of bulbar onset is significantly higher in patients with mutations in the RNA-binding proteins FUS and TDP-43 than in individuals with SOD1 mutations5. Almost the totality of alternative MN differentiation protocols relies on the activity of retinoic acid (RA), which confer a spinal character to differentiating iPSCs6,7,8. This limits the possibility of studying intrinsic factors, which could be protective in specific MN subtypes9,10.
Consistent with a previous work in mouse embryonic stem cells11, we have recently shown that in human iPSCs ectopic expression of Ngn2, Isl1 and Lhx3 (NIL) induces a spinal MN identity, while Ngn2 and Isl1 plus Phox2a (NIP) specify cranial MNs12. We have hence developed an efficient protocol, leading to the production of human MNs endowed with functional properties in a 12 days turnaround. The purpose of this method is to obtain, in a short time frame and without the need for purification (e.g., by FACS), cell populations highly enriched for MNs with spinal or cranial identity.

<table border="0" cellpadding="0" cellspacing="0" style="width:2004px;" width="2004">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:364px;">5-Bapta</td>
			<td style="width:208px;">Sigma-Aldrich</td>
			<td style="width:143px;">A4926-1G</td>
			<td style="width:1289px;">chemicals for electrophysiological solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase</td>
			<td>Sigma-Aldrich</td>
			<td>A6964-100ML&#160;</td>
			<td>Cell dissociation reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-CHAT</td>
			<td>EMD Millipore&#160;</td>
			<td>AB144P</td>
			<td>Anti-Choline Acetyltransferase. Primary antibody used in immunostaining assays. RRID: AB_2079751; Lot number: 2971003</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-goat Alexa Fluor 488&#160;</td>
			<td>Thermo Fisher Scientific&#160;</td>
			<td>A11055</td>
			<td>Secondary antibody used for immonofluorescence assays. RRID: AB_2534102; Lot number: 1915848</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-mouse Alexa Fluor 647</td>
			<td>Thermo Fisher Scientific&#160;</td>
			<td>A31571</td>
			<td>Secondary antibody used for immonofluorescence assays. RRID: AB_162542; Lot number: 1757130</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-Oct4&#160;</td>
			<td>BD Biosciences</td>
			<td>611202</td>
			<td>Primary antibody used in immunostaining assays. RRID: AB_398736; Lot number: 5233722</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-Phox2b</td>
			<td>Santa Cruz Biotechnology, Inc.</td>
			<td>sc-376997</td>
			<td>Primary antibody used in immunostaining assays. Lot number: E0117</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-rabbit Alexa Fluor 594&#160;</td>
			<td>Immunological Sciences</td>
			<td>IS-20152-1</td>
			<td>Secondary antibody used for immonofluorescence assays</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-TUJ1&#160;</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>T2200</td>
			<td>Primary antibody used in immunostaining assays. RRID: AB_262133</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">B27</td>
			<td>Miltenyi Biotec</td>
			<td>130-093-566</td>
			<td>Serum free supplement for neuronal cell maintenance</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bambanker</td>
			<td>Nippon Genetics</td>
			<td>NGE-BB02</td>
			<td>Cell freezing medium, used here for motor neuron progenitors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BDNF</td>
			<td>PreproTech</td>
			<td>450-02</td>
			<td>Brain-Derived Neurotrophic Factor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Blasticidin</td>
			<td>Sigma-Aldrich</td>
			<td>203350</td>
			<td>Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BSA</td>
			<td>Sigma-Aldrich</td>
			<td>A2153</td>
			<td>Bovine Serum Albumin. Blocking agent to prevent non-specific binding of antibodies in immunostaining assays</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CaCl2</td>
			<td>Sigma-Aldrich</td>
			<td>C3881</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Clampex 10 software</td>
			<td>Molecular Devices</td>
			<td>Clampex 10</td>
			<td>Membrane currents recording system</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Corning Matrigel hESC-qualified Matrix</td>
			<td>Corning</td>
			<td>354277</td>
			<td style="width:1289px;">Reconstituted basement membrane preparation from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. Used for adhesion of iPSC to plastic and glass supports</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CRYOSTEM ACF FREEZING MEDIA</td>
			<td>Biological Industries</td>
			<td>05-710-1E</td>
			<td>Freezing medium for human iPSCs</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Glucose</td>
			<td>Sigma-Aldrich</td>
			<td>G5146</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPI powder</td>
			<td>Roche</td>
			<td>10236276001</td>
			<td>4&#8242;,6-diamidino-2-phenylindole. Fluorescent stain that binds to adenine&#8211;thymine rich regions in DNA used for nuclei staining in immonofluorescence assays</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPT</td>
			<td>AdipoGen</td>
			<td>AG-CR1-0016-M005</td>
			<td>Gamma secretase inhibitor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dispase</td>
			<td>Gibco</td>
			<td>17105-041</td>
			<td>Reagent for gentle dissociation of human iPSCs</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DMEM/F12</td>
			<td>Sigma-Aldrich</td>
			<td>D6421-500ML</td>
			<td>Basal medium for cell culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Doxycycline</td>
			<td>Sigma-Aldrich</td>
			<td>D9891-1G&#160;</td>
			<td>Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DS2U&#160;</td>
			<td>WiCell</td>
			<td>UWWC1-DS2U</td>
			<td>Commercial human iPSC line</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">E.Z.N.A Total RNA Kit&#160;</td>
			<td>Omega bio-tek</td>
			<td>R6834-02</td>
			<td>Kit for total extraction of RNA from cultured eukaryotic cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GDNF</td>
			<td>PreproTech</td>
			<td>450-10</td>
			<td>Glial-Derived Neurotrophic Factor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gibco Episomal hiPSC Line</td>
			<td>Thermo Fisher Scientific</td>
			<td>A18945</td>
			<td>Commercial human iPSC line</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glutamax</td>
			<td>Thermo Fisher Scientific</td>
			<td>35050038</td>
			<td>An alternative to L-glutamine with increased stability. Improves cell health.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hepes</td>
			<td>Sigma-Aldrich</td>
			<td>H4034</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iScript Reverse Transcription Supermix for RT-qPCR&#160;</td>
			<td>Bio-Rad</td>
			<td>1708841</td>
			<td>Kit for gene expression analysis using real-time qPCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iTaqTM Universal SYBR Green Supermix&#160;</td>
			<td>Bio-Rad</td>
			<td>172-5121&#160;</td>
			<td>Ready-to-use reaction master mix optimized for dye-based quantitative PCR (qPCR) on any real-time PCR instrument</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">K-Gluconate</td>
			<td>Sigma-Aldrich</td>
			<td>G4500</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">KCl</td>
			<td>Sigma-Aldrich</td>
			<td>P9333</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-ascorbic acid</td>
			<td>LKT Laboratories</td>
			<td>A7210</td>
			<td>Used in cell culture as an antioxidant</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Laminin</td>
			<td>Sigma-Aldrich</td>
			<td>11243217001</td>
			<td>Promotes attachment and growth of neural cells in vitro</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Laser scanning confocal microscope&#160;</td>
			<td>Olympus</td>
			<td>&#160;iX83 FluoView1200</td>
			<td>Confocal microscope for acquisition of immunostaining images</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mg-ATP</td>
			<td>Sigma-Aldrich</td>
			<td>A9187</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MgCl2</td>
			<td>Sigma-Aldrich</td>
			<td>M8266</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mounting Medium&#160;</td>
			<td>Ibidi</td>
			<td>50001</td>
			<td>Mounting solution used for confocal microscopy and immunofluorescence assays</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Multiclamp patch-clamp amplifier</td>
			<td>Molecular Devices</td>
			<td>700B</td>
			<td>Membrane currents recording system</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Na-GTP</td>
			<td>Sigma-Aldrich</td>
			<td>G8877</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NaCl</td>
			<td>Sigma-Aldrich</td>
			<td>71376</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NEAA</td>
			<td>Thermo Fisher Scientific</td>
			<td>11140035</td>
			<td>Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Neon 100 &#956;L Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>MPK10096</td>
			<td>Cell electroporation kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Neon Transfection System</td>
			<td>Thermo Fisher Scientific</td>
			<td>MPK5000</td>
			<td>Cell electroporation system</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Neurobasal Medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>21103049</td>
			<td>Basal medium designed for long-term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NutriStem-XF/FF&#160;</td>
			<td>Biological Industries</td>
			<td>05-100-1A</td>
			<td>Human iPSC culture medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Paraformaldehyde</td>
			<td>Electron Microscopy Sciences</td>
			<td>157-8</td>
			<td>Used for cell fixation in immunostaining assays</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS</td>
			<td>Sigma-Aldrich</td>
			<td>D8662-500ML</td>
			<td>Dulbecco s Phosphate Buffer Saline w Calcium w Magnesium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS Ca2+/Mg2+ free</td>
			<td>Sigma-Aldrich</td>
			<td>D8537-500ML</td>
			<td>Dulbecco s Phosphate Buffer Saline w/o Calcium w/o Magnesium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/Streptomycin&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P4333-100ML</td>
			<td>Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">poly-ornithine</td>
			<td>Sigma-Aldrich</td>
			<td>P4957</td>
			<td>Promotes attachment and growth of neural cells in vitro</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SU5402</td>
			<td>Sigma-Aldrich</td>
			<td>SML0443-5MG</td>
			<td>Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Triton X-100&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td>4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol,&#160;t-Octylphenoxypolyethoxyethanol, Polyethylene glycol&#160;tert-octylphenyl ether. Used for cell permeabilization in immunostaining assays</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Upright microscope</td>
			<td>Olympus</td>
			<td>BX51VI</td>
			<td>Microscope for electrophysiological recording equipped with CoolSnap Myo camera&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y-27632&#160; (ROCK inhibitor)</td>
			<td>Enzo Life Sciences</td>
			<td>ALX-270-333-M005&#160;</td>
			<td>Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">&#956;-Slide 8 Well&#160;</td>
			<td>Ibidi</td>
			<td>80826</td>
			<td>Support for high&#8211;end microscopic analysis of fixed cells</td>
		</tr>
	</tbody>
</table>

conversion of human induced pluripotent stem cells (ipscs) into functional spinal and cranial motor neurons using piggybac vectors

We describe here a method to obtain functional spinal and cranial motor neurons from human induced pluripotent stem cells (iPSCs). Direct conversion into motor neuron is obtained by ectopic expression of alternative modules of transcription factors, namely Ngn2, Isl1 and Lhx3 (NIL) or Ngn2, Isl1 and Phox2a (NIP). NIL and NIP specify, respectively, spinal and cranial motor neuron identity. Our protocol starts with the generation of modified iPSC lines in which NIL or NIP are stably integrated in the genome via a piggyBac transposon vector. Expression of the transgenes is then induced by doxycycline and leads, in 5 days, to the conversion of iPSCs into MN progenitors. Subsequent maturation, for 7 days, leads to homogeneous populations of spinal or cranial MNs. Our method holds several advantages over previous protocols: it is extremely rapid and simplified; it does not require viral infection or further MN isolation; it allows generating different MN subpopulations (spinal and cranial) with a remarkable degree of maturation, as demonstrated by the ability to fire trains of action potentials. Moreover, a large number of motor neurons can be obtained without purification from mixed populations. iPSC-derived spinal and cranial motor neurons can be used for in vitro modeling of Amyotrophic Lateral Sclerosis and other neurodegenerative diseases of the motor neuron. Homogeneous motor neuron populations might represent an important resource for cell type specific drug screenings.

A schematic description of the differentiation method is shown in Figure 1. Human iPSCs (WT I line3) were transfected with epB-Bsd-TT-NIL or epB-Bsd-TT-NIP, generating, upon blasticidin selection, stable and inducible cell lines12, hereafter referred to as iPSC-NIL and iPSC-NIP, respectively. Differentiating cells were characterized for the expression of the pluripotency marker OCT4 and the pan-neuronal marker TUJ1. Immunostaining analysis show...

Watch this Scientific Journal Video about Conversion of Human Induced Pluripotent Stem Cells iPSCs into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors at JoVE.com

Conversion of Human Induced Pluripotent Stem Cells iPSCs into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors

This protocol allows rapid and efficient conversion of induced pluripotent stem cells into motor neurons with a spinal or cranial identity, by ectopic expression of transcription factors from inducible piggyBac vectors.

Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors

We describe here a method to obtain functional spinal and cranial motor neurons from human induced pluripotent stem cells (iPSCs). Direct conversion into ...

conversion-human-induced-pluripotent-stem-cells-ipscs-into-functional

Research

JoVE Journal

Neuroscience

11.1K Views.  Sapienza University of Rome, Italy. This protocol allows rapid and efficient conversion of induced pluripotent stem cells into motor neurons with a spinal or cranial identity, by ectopic expression of transcription factors from inducible piggyBac vectors.

Video: Conversion of Human Induced Pluripotent Stem Cells iPSCs into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

The Specification of Telencephalic Glutamatergic Neurons from Human Pluripotent Stem Cells

Here, a stepwise procedure for efficiently generating telencephalic glutamatergic neurons from human pluripotent stem cells (PSCs) has been described. The differentiation process is initiated by breaking the human PSCs into clumps which round up to form aggregates when the cells are placed in a suspension culture. The aggregates are then grown in hESC medium from days 1-4 to allow for spontaneous differentiation. During this time, the cells have the capacity to become any of the three germ layers. From days 5-8, the cells are placed in a neural induction medium to push them into the neural lineage. Around day 8, the cells are allowed to attach onto 6 well plates and differentiate during which time the neuroepithelial cells form. These neuroepithelial cells can be isolated at day 17. The cells can then be kept as neurospheres until they are ready to be plated onto coverslips. Using a basic medium without any caudalizing factors, neuroepithelial cells are specified into telencephalic precursors, which can then be further differentiated into dorsal telencephalic progenitors and glutamatergic neurons efficiently. Overall, our system provides a tool to generate human glutamatergic neurons for researchers to study the development of these neurons and the diseases which affect them.

This procedure yields telencephalic neurons by going through checkpoints which are similar to those observed during human development. The cells are allowed to spontaneously differentiate, are exposed to factors which push them towards the neural lineage, are isolated, and are plated onto coverslips to allow for terminal differentiation and maturation.

Here, a stepwise procedure for efficiently generating telencephalic glutamatergic neurons from human pluripotent stem cells (PSCs) has been described. The ...

Lineage-reprogramming of Pericyte-derived Cells of the Adult Human Brain into Induced Neurons

Direct lineage-reprogramming of non-neuronal cells into induced neurons (iNs) may provide insights into the molecular mechanisms underlying neurogenesis and enable new strategies for in vitro modeling or repairing the diseased brain. Identifying brain-resident non-neuronal cell types amenable to direct conversion into iNs might allow for launching such an approach in situ, i.e. within the damaged brain tissue. Here we describe a protocol developed in the attempt of identifying cells derived from the adult human brain that fulfill this premise. This protocol involves: (1) the culturing of human cells from the cerebral cortex obtained from adult human brain biopsies; (2) the in vitro expansion (approximately requiring 2-4 weeks) and characterization of the culture by immunocytochemistry and flow cytometry; (3) the enrichment by fluorescence-activated cell sorting (FACS) using anti-PDGF receptor-&#946; and anti-CD146 antibodies; (4) the retrovirus-mediated transduction with the neurogenic transcription factors sox2 and ascl1; (5) and finally the characterization of the resultant pericyte-derived induced neurons (PdiNs) by immunocytochemistry (14 days to 8 weeks following retroviral transduction). At this stage, iNs can be probed for their electrical properties by patch-clamp recording. This protocol provides a highly reproducible procedure for the in vitro lineage conversion of brain-resident pericytes into functional human iNs.

Targeting brain-resident cells for direct lineage-reprogramming offers new perspectives for brain repair. Here we describe a protocol of how to prepare cultures enriched for brain-resident pericytes from the adult human cerebral cortex and convert these into induced neurons by retrovirus-mediated expression of the transcription factors Sox2 and Ascl1.

Direct lineage-reprogramming of non-neuronal cells into induced neurons (iNs) may provide insights into the molecular mechanisms underlying neurogenesis ...

Feeder-free Derivation of Neural Crest Progenitor Cells from Human Pluripotent Stem Cells

Human pluripotent stem cells (hPSCs) have great potential for studying human embryonic development, for modeling human diseases in the dish and as a source of transplantable cells for regenerative applications after disease or accidents. Neural crest (NC) cells are the precursors for a large variety of adult somatic cells, such as cells from the peripheral nervous system and glia, melanocytes and mesenchymal cells. They are a valuable source of cells to study aspects of human embryonic development, including cell fate specification and migration. Further differentiation of NC progenitor cells into terminally differentiated cell types offers the possibility to model human diseases in vitro, investigate disease mechanisms and generate cells for regenerative medicine. This article presents the adaptation of a currently available in vitro differentiation protocol for the derivation of NC cells from hPSCs. This new protocol requires 18 days of differentiation, is feeder-free, easily scalable and highly reproducible among human embryonic stem cell (hESC) lines as well as human induced pluripotent stem cell (hiPSC) lines. Both old and new protocols yield NC cells of equal identity.

Neural crest (NC) cells derived from human pluripotent stem cells (hPSC) have great potential for modeling human development and disease and for cell replacement therapies. Here, a feeder-free adaptation of the currently widely used in vitro differentiation protocol for the derivation of NC cells from hPSCs is presented.

Human pluripotent stem cells (hPSCs) have great potential for studying human embryonic development, for modeling human diseases in the dish and as a ...

Directed Dopaminergic Neuron Differentiation from Human Pluripotent Stem Cells

Dopaminergic (DA) neurons in the substantia nigra pars compacta (also known as A9 DA neurons) are the specific cell type that is lost in Parkinson&#8217;s disease (PD). There is great interest in deriving A9 DA neurons from human pluripotent stem cells (hPSCs) for regenerative cell replacement therapy for PD. During neural development, A9 DA neurons originate from the floor plate (FP) precursors located at the ventral midline of the central nervous system. Here, we optimized the culture conditions for the stepwise differentiation of hPSCs to A9 DA neurons, which mimics embryonic DA neuron development. In our protocol, we first describe the efficient generation of FP precursor cells from hPSCs using a small molecule method, and then convert the FP cells to A9 DA neurons, which could be maintained in vitro for several months. This efficient, repeatable and controllable protocol works well in human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) from normal persons and PD patients, in which one could derive A9 DA neurons to perform in vitro disease modeling and drug screening and in vivo cell transplantation therapy for PD.

We, based on knowledge from developmental biology and published research, developed an optimized protocol to efficiently generate A9 midbrain dopaminergic neurons from both human embryonic stem cells and human induced pluripotent stem cells, which would be useful for disease modeling and cell replacement therapy for Parkinson&#8217;s disease.

Dopaminergic (DA) neurons in the substantia nigra pars compacta  (also known as A9 DA neurons) are the specific cell type that is lost in ...

Derivation of Adult Human Fibroblasts and their Direct Conversion into Expandable Neural Progenitor Cells

Generation of&#160;induced pluripotent stem cell (iPSCs) from adult skin fibroblasts and subsequent differentiation into somatic cells provides fascinating prospects for the derivation of autologous transplants that circumvent histocompatibility barriers. However, progression through a pluripotent state and subsequent complete differentiation into desired lineages remains a roadblock for the clinical translation of iPSC technology because of the associated neoplastic potential and genomic instability. Recently, we and others showed that somatic cells cannot only be converted into iPSCs but also into different types of multipotent somatic stem cells by using defined factors, thereby circumventing progression through the pluripotent state. In particular, the direct conversion of human fibroblasts into induced neural progenitor cells (iNPCs) heralds the possibility of a novel autologous cell source for various applications such as cell replacement, disease modeling and drug screening. Here, we describe the isolation of adult human primary fibroblasts by skin biopsy and their efficient direct conversion into iNPCs by timely restricted expression of Oct4, Sox2, Klf4, as well as c-Myc. Sox2-positive neuroepithelial colonies appear after 17 days of induction and iNPC lines can be established efficiently by monoclonal isolation and expansion. Precise adjustment of viral multiplicity of infection and supplementation of leukemia inhibitory factor during the induction phase represent critical factors to achieve conversion efficiencies of up to 0.2%. Thus far, patient-specific iNPC lines could be expanded for more than 12 passages and uniformly display morphological and molecular features of neural stem/progenitor cells, such as the expression of Nestin and Sox2. The iNPC lines can be differentiated into neurons and astrocytes as judged by staining against TUJ1 and GFAP, respectively. In conclusion, we report a robust protocol for the derivation and direct conversion of human fibroblasts into stably expandable neural progenitor cells that might provide a cellular source for biomedical applications such as autologous neural cell replacement and disease modeling.

Generation of induced pluripotent stem cells provides fascinating prospects for the derivation of autologous transplants. However, progression through a pluripotent state and laborious re-differentiation still hinders clinical translation. Here we describe the derivation of adult human fibroblasts and their direct conversion into induced neural progenitor cells and the subsequent differentiation into neural lineages.

Generation of&#160;induced pluripotent stem cell (iPSCs) from adult skin fibroblasts and subsequent differentiation into somatic cells provides ...

Identifying Cell Surface Markers of Primary Neural Stem and Progenitor Cells by Metabolic Labeling of Sialoglycan

Neural stem and progenitor cells (NSPCs) are the cellular basis for the complex structures and functions of the brain. They are located in specialized niches in vivo and can be isolated and expanded in vitro, serving as an important resource for cell transplantation to repair brain damage. However, NSPCs are heterogeneous and not clearly defined at the molecular level or purified due to a lack of specific cell surface markers. The protocol presented, which has been previously reported, combines a neural-endothelial co-culture system with a metabolic glycan labeling method to identify the surface sialoglycoproteome of primary NSPCs. The NSPC-endothelial co-culture system allows self-renewal and expansion of primary NSPCs in vitro, generating a sufficient number of NSPCs. Sialoglycans in cultured NSPCs are labeled using an unnatural sialic acid metabolic reporter with bioorthogonal functional groups. By comparing the sialoglycoproteome from self-renewing NSPCs expanded in an endothelial co-culture with differentiating neural culture, we identify a list of membrane proteins that are enriched in NSPCs. In detail, the protocol involves: 1) set-up of an NSPC-endothelial co-culture and NSPC differentiating culture; 2) labeling with azidosugar per-O-acetylated N-azidoacetylmannosamine (Ac4ManNAz); and 3) biotin conjugation to modified sialoglycan for imaging after fixation of neural culture or protein extraction from neural culture for mass spectrometry analysis. Then, the NSPC-enriched surface marker candidates are selected by comparative analysis of mass spectrometry data from both the expanded NSPC and differentiated neural cultures. This protocol is highly sensitive for identifying membrane proteins of low abundance in the starting materials, and it can be applied to marker discovery in other systems with appropriate modifications

Presented here is a protocol that combines an in vitro neural-endothelial co-culture system and metabolic incorporation of sialoglycan with bioorthogonal functional groups to expand primary neural stem and progenitor cells and label their surface sialoglycoproteins for imaging or mass-spectrometry analysis of cell surface markers.

Neural stem and progenitor cells (NSPCs) are the cellular basis for the complex structures and functions of the brain. They are located in specialized ...

In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors

Converting resident glia in the brain into functional and subtype-specific neurons in vivo provides a step forward towards the development of alternative cell replacement therapies while also creating tools to study cell fate in situ. To date, it has been possible to obtain neurons via in vivo reprogramming, but the precise phenotype of these neurons or how they mature has not been analyzed in detail. In this protocol, we describe a more efficient conversion and cell-specific identification of the in vivo reprogrammed neurons, using an AAV-based viral vector system. We also provide a protocol for functional assessment of the reprogrammed cells&#8217; neuronal maturation. By injecting flip-excision (FLEX) vectors, containing the reprogramming and synapsin-driven reporter genes&#160;to specific cell types in the brain that serve as the target for cell reprogramming. This technique allows for the easy identification of newly reprogrammed neurons. Results show that the obtained reprogrammed neurons functionally mature over time, receive synaptic contacts and show electrophysiological properties of different types of interneurons. Using the transcription factors Ascl1, Lmx1a and Nurr1, the majority of the reprogrammed cells have properties of fast-spiking, parvalbumin-containing interneurons.

This protocol aims at generating directly reprogrammed interneurons in vivo, using an AAV-based viral system in the brain and a FLEX synapsin-driven GFP reporter, which allows for cell identification and further analysis in vivo.

Converting resident glia in the brain into functional and subtype-specific neurons in vivo provides a step forward towards the development of alternative ...

3D Kinematic Analysis for the Functional Evaluation in the Rat Model of Sciatic Nerve Crush Injury

Compared to the Sciatic Functional Index (SFI), kinematic analysis is a more reliable and sensitive method for performing functional evaluations of sciatic nerve injury rodent models. In this protocol, we describe a novel kinematic analysis method that uses a three-dimensional (3D) motion capture apparatus for functional evaluations using a rat sciatic nerve crush injury model. First, the rat is familiarized with treadmill walking. Markers are then attached to the designated bone landmarks and the rat is made to walk on the treadmill at the desired speed. Meanwhile, the posterior limb movements of the rat are recorded using four cameras. Depending on the software used, marker tracings are created using both automatic and manual modes and the desired data are produced after subtle adjustments. This method of kinematic analysis, which uses a 3D motion capture apparatus, offers numerous advantages, including superior precision and accuracy. Many more parameters can be investigated during the comprehensive functional evaluations. This method has several shortcomings that require consideration: The system is expensive, can be complicated to operate, and may produce data deviations due to skin shifting. Nevertheless, kinematic analysis using a 3D motion capture apparatus is useful for performing functional anterior and posterior limb evaluations. In the future, this method may become increasingly useful for generating accurate assessments of various traumas and diseases.

We introduce a kinematic analysis method that uses a three-dimensional motion capture apparatus containing four cameras and data processing software for performing functional evaluations during fundamental research involving rodent models.

Compared to the Sciatic Functional Index (SFI), kinematic analysis is a more reliable and sensitive method for performing functional evaluations of ...

Analyzing Mitochondrial Transport and Morphology in Human Induced Pluripotent Stem Cell-Derived Neurons in Hereditary Spastic Paraplegia

Neurons have intense demands for high energy in order to support their functions. Impaired mitochondrial transport along axons has been observed in human neurons, which may contribute to neurodegeneration in various disease states. Although it is challenging to examine mitochondrial dynamics in live human nerves, such paradigms are critical for studying the role of mitochondria in neurodegeneration. Described here is a protocol for analyzing mitochondrial transport and mitochondrial morphology in forebrain neuron axons derived from human induced pluripotent stem cells (iPSCs). The iPSCs are differentiated into telencephalic glutamatergic neurons using well-established methods. Mitochondria of the neurons are stained with MitoTracker CMXRos, and mitochondrial movement within the axons are captured using a live-cell imaging microscope equipped with an incubator for cell culture. Time-lapse images are analyzed using software with &#34;MultiKymograph&#34;, &#34;Bioformat importer&#34;, and &#34;Macros&#34; plugins. Kymographs of mitochondrial transport are generated, and average mitochondrial velocity in the anterograde and retrograde directions is read from the kymograph. Regarding mitochondrial morphology analysis, mitochondrial length, area, and aspect ratio are obtained using the ImageJ. In summary, this protocol allows characterization of mitochondrial trafficking along axons and analysis of their morphology to facilitate studies of neurodegenerative diseases.

Impaired mitochondrial transport and morphology are involved in various neurodegenerative diseases. The presented protocol uses induced pluripotent stem cell-derived forebrain neurons to assess mitochondrial transport and morphology in hereditary spastic paraplegia. This protocol allows characterization of mitochondrial trafficking along axons and analysis of their morphology, which will facilitate the study of neurodegenerative disease.

Neurons have intense demands for high energy in order to support their functions. Impaired mitochondrial transport along axons has been observed in human ...