Name: droplet digital trap (ddtrap): adaptation of the telomere repeat amplification protocol to droplet digital polymerase chain reaction
Uploaded: 2019-05-03T15:00:00
Description: Watch this Scientific Journal Video about Droplet Digital TRAP ddTRAP: Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction at JoVE.com

The authors would like to acknowledge funding sources from the National Institutes of Health (NIH) (NCI-R00-CA197672-01A1). Small cell lung cancer lines (SHP77 and H82) were a generous gift from Drs. John Minna and Adi Gazdar from the UT Southwestern Medical Center.

1. Buffer preparation and storage
<ol>
	<li>Prepare 50 mL of 1x stock RNase-/DNase-free NP-40 lysis buffer (10 mM Tris-HCl [pH 8.0], 1 mM MgCl2, 1 mM ethylenediaminetetraacetic acid (EDTA), 1% [vol/vol] NP-40, 10% [vol/vol] glycerol, 150 mM NaCl, 5 mM &#946;-mercaptoethanol, and 0.1 mM 4-benzenesulfonyl fluoride hydrochloride (AEBSF)). This buffer can be aliquoted and stored at -20 &#176;C for future use. Avoid freeze/thaw cycles in order to obtain an optimal lysis of cells.</li>
	<li>Prepare 50 mL of 10x st...

<ol>
	<li>Frenck, R. W., Blackburn, E. H., Shannon, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+rate+of+telomere+sequence+loss+in+human+leukocytes+varies+with+age.">The rate of telomere sequence loss in human leukocytes varies with age.</a> Proceedings of the National Academy of Sciences of the United States of America. 95 (10), 5607-5610 (1998).</li><li>Morin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+telomere+terminal+transferase+enzyme+is+a+ribonucleoprotein+that+synthesizes+TTAGGG+repeats.">The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats.</a> Cell. 59 (3), 521-529 (1989).</li><li>de Lange, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+telomeres+solve+the+end-protection+problem.">How telomeres solve the end-protection problem.</a> Science. 326 (5955), 948-952 (2009).</li><li>Shay, J. W., Wright, W. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+telomeres+and+telomerase+in+cancer.">Role of telomeres and telomerase in cancer.</a> Seminars in Cancer Biology. 21 (6), 349-353 (2011).</li><li>Kim, W., Shay, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-range+telomere+regulation+of+gene+expression:+Telomere+looping+and+telomere+position+effect+over+long+distances+(TPE-OLD).">Long-range telomere regulation of gene expression: Telomere looping and telomere position effect over long distances (TPE-OLD).</a> Differentiation. 99, 1-9 (2018).</li><li>Robin, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Telomere+position+effect:+regulation+of+gene+expression+with+progressive+telomere+shortening+over+long+distances.">Telomere position effect: regulation of gene expression with progressive telomere shortening over long distances.</a> Genes Development. 28 (22), 2464-2476 (2014).</li><li>Shay, J. W., Wright, W. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Senescence+and+immortalization:+role+of+telomeres+and+telomerase.">Senescence and immortalization: role of telomeres and telomerase.</a> Carcinogenesis. 26 (5), 867-874 (2005).</li><li>Norton, J. C., Holt, S. E., Wright, W. E., Shay, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+detection+of+human+telomerase+activity.">Enhanced detection of human telomerase activity.</a> DNA Cell Biology. 17 (3), 217-219 (1998).</li><li>Herbert, B. S., Hochreiter, A. E., Wright, W. E., Shay, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonradioactive+detection+of+telomerase+activity+using+the+telomeric+repeat+amplification+protocol.">Nonradioactive detection of telomerase activity using the telomeric repeat amplification protocol.</a> Nature Protocols. 1 (3), 1583-1590 (2006).</li><li>Vogelstein, B., Kinzler, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR.">Digital PCR.</a> Proceedings of the National Academy of Sciences of the United States of America. 96 (16), 9236-9241 (1999).</li><li>Ludlow, A. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+telomerase+enzyme+activity+determination+using+droplet+digital+PCR+with+single+cell+resolution.">Quantitative telomerase enzyme activity determination using droplet digital PCR with single cell resolution.</a> Nucleic Acids Research. 42 (13), e104 (2014).</li><li>Huang, E. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Maintenance+of+Telomere+Length+in+CD28++T+Cells+During+T+Lymphocyte+Stimulation.">The Maintenance of Telomere Length in CD28+ T Cells During T Lymphocyte Stimulation.</a> Scientific Reports. 7 (1), 6785 (2017).</li><li>Ludlow, A. T., Shelton, D., Wright, W. E., Shay, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ddTRAP:+A+Method+for+Sensitive+and+Precise+Quantification+of+Telomerase+Activity.">ddTRAP: A Method for Sensitive and Precise Quantification of Telomerase Activity.</a> Methods Molecular Biology. 1768, 513-529 (2018).</li></ol>

The measurement of telomerase activity is critical to a plethora of research topics including, but not limited to, cancer, telomere biology, aging, regenerative medicine, and structure-based drug design. Telomerase RNPs are low abundant, even in cancer cells, making the detection and study of this enzyme challenging. In this paper, we described the step-by-step procedures for the newly developed ddTRAP assay to robustly quantify telomerase activity in cells. By combining the traditional telomerase extension reaction with...

Telomeres are dynamic DNA-protein complexes at the ends of linear chromosomes. Human telomeres are composed of an array of 5&#39;-TTAGGGn hexameric repeats which vary in length between 12&#8211;15 kilobases (kb) at birth1. Human telomerase, the ribonucleoprotein enzyme that maintains the telomeres, was first identified in HeLa cell lysates (cancer cell line)2. Together, telomeres and telomerase play a major role in a spectrum of biological processes such as genome protection, gene regulation, and cancer cell immortality3,4,5,6.
Human telomerase is comprised primarily of two key components, namely telomerase reverse transcriptase and telomerase RNA (hTERT and hTERC, respectively). The protein subunit, hTERT, is the catalytically active reverse transcriptase component of the telomerase enzyme. The RNA template, hTERC, provides telomerase with the template to extend and/or maintain telomeres. Most human somatic tissues have no detectable telomerase activity. The inability of DNA polymerase to extend the end of the lagging strand of DNA along with the lack of telomerase leads to the progressive shortening of telomeres after every round of cellular division. These phenomena lead to telomere shortening in most somatic cells until they reach a critically shortened length, whereby cells enter a state of replicative senescence. The maximal number of times a cell can divide is dictated by its telomere length and this block to continued cell division is thought to prevent progression to oncogenesis7. Cancer cells are able to overcome telomere-induced replicative senescence and continue to proliferate by utilizing telomerase to maintain their telomeres. Approximately 90% of cancers activate telomerase, making telomerase activity critically important in both cancer detection and treatment.
The development of the TRAP assay in the 1990s was instrumental in the identification of the necessary components of the telomerase enzyme, as well as for the measurement of telomerase in a wide range of cells and tissues, both normal and cancerous. The original gel-based PCR assay used radioactively labeled DNA substrates to detect telomerase activity. In 2006, the assay was adapted into a nonradioactive form using fluorescently labeled substrates8,9. By using fluorescently labeled substrates, users were able to visualize the telomerase extension products as bands on a gel by exposing it to the correct excitation wavelength. The sensitivity of the TRAP assay and its ability to detect telomerase activity in crude cell lysates has made this assay the most widely used method for telomerase activity detection. However, the TRAP assay has limitations. The assay is gel-based, making it difficult to perform the necessary replicates in moderate to high-throughput studies, and thus, proper statistical analysis is rarely achieved. Furthermore, the gel-based assay is difficult to quantify reliably due to the inability of detecting less than twofold differences in telomerase activity between samples. Overcoming these two limitations is critical for enzymatic activity assays such as the TRAP to move to clinical or industry settings for the detection of telomerase activity in patient samples or drug design studies.
Digital PCR was initially developed in 1999 as a means to convert the exponential and analog nature of PCR into a linear and digital assay10. Droplet digital PCR (ddPCR) is the most recent innovation of the original digital PCR methodology. Droplet digital PCR came about with the advent of advanced microfluidics and oil-in-water emulsion chemistry to reliably generate stable and equally sized droplets. Unlike gel-based and even quantitative PCR (qPCR), ddPCR generates absolute quantification of the input material. The key to ddPCR is the generation of ~20,000 individual reactions by partitioning samples into droplets. Following end-point PCR, the droplet reader scans each droplet in a flow-cytometer-like fashion, counting, sizing, and recording the presence or absence of fluorescence in each individual droplet (i.e., absence or presence of PCR amplicons in each droplet). Then, using Poisson&#8217;s distribution, input molecules are estimated based on the ratio of positive droplets to the total number of droplets. This number represents an estimate of the number of input molecules in each PCR. Furthermore, ddPCR is performed and analyzed on a 96-well plate which allows the user to run many samples, as well as perform biological and technical replicates for proper statistical analysis. As a result, we have combined the powerful quantification and moderate-throughput nature of ddPCR with the TRAP assay to develop the ddTRAP assay11. This assay is designed for users to study and robustly quantify absolute telomerase activity from biological samples11,12. The sensitivity of the ddTRAP allows the quantification of telomerase activity from limited and precious samples, including single-cell measurements. Furthermore, users can also study the effects of telomerase manipulations and/or drugs with absolute quantification of less than twofold changes (~50% differences). The ddTRAP is the natural evolution of the TRAP assay into the digital and higher-throughput nature of modern laboratory experiments and clinical settings.

<table>
	<tbody>
		<tr>
			<td>1 M Tris-HCl pH 8.0</td>
			<td>Ambion</td>
			<td>AM9855G</td>
			<td>RNAse/DNAse free</td>
		</tr>
		<tr>
			<td>1 M MgCl2</td>
			<td>Ambion</td>
			<td>AM9530G</td>
			<td>RnAse/DNAse free</td>
		</tr>
		<tr>
			<td>0.5 M EDTA pH 8.0</td>
			<td>Ambion</td>
			<td>AM9261</td>
			<td>RNAse/DNAse free</td>
		</tr>
		<tr>
			<td>Surfact- Amps NP-40</td>
			<td>Thermo Scientific</td>
			<td>28324</td>
			<td></td>
		</tr>
		<tr>
			<td>100% Ultrapure Glycerol</td>
			<td>Invitrogen</td>
			<td>15514011</td>
			<td>RNAse/DNAse free</td>
		</tr>
		<tr>
			<td>phenylmethylsulfonyl fluoride</td>
			<td>Thermo Scientific</td>
			<td>36978</td>
			<td>Powder</td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>SIGMA-ALDRICH</td>
			<td>516732</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease Free H20</td>
			<td>Ambion</td>
			<td>AM9932</td>
			<td>RNAse/DNAse free</td>
		</tr>
		<tr>
			<td>2.5 mM dNTP mix</td>
			<td>Thermo Scientific</td>
			<td>R72501</td>
			<td>2.5 mM of each dATP, dCTP, dGTP and dTTP</td>
		</tr>
		<tr>
			<td>2 M KCl</td>
			<td>Ambion</td>
			<td>AM9640G</td>
			<td>RNAse/DNAse free</td>
		</tr>
		<tr>
			<td>100% Tween-20</td>
			<td>Fisher</td>
			<td>9005-64-5</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5 M EGTA pH 8.0</td>
			<td>Fisher</td>
			<td>50-255-956</td>
			<td>RNAse/DNAse free</td>
		</tr>
		<tr>
			<td>Telomerase Substrate (TS) Primer</td>
			<td>Integrated DNA Technology (IDT)</td>
			<td>Custom Primer (HPLC Purified)</td>
			<td>5&#39;- AATCCGTCGAGCAGAGTT-3&#39;</td>
		</tr>
		<tr>
			<td>ACX (Revers) Primer</td>
			<td>Integrated DNA Technology (IDT)</td>
			<td>Custom Primer (HPLC Purified)</td>
			<td>5&#39;- GCGCGGCTTACCCTTACCCTTACCCTAACC -3&#39;</td>
		</tr>
		<tr>
			<td>Thin walled (250 ul) PCR grade tubes</td>
			<td>USA Scientific</td>
			<td>1402-2900</td>
			<td>strips, plates, tubes etc.</td>
		</tr>
		<tr>
			<td>QX200 ddPCR EvaGreen Supermix</td>
			<td>Bio Rad</td>
			<td>1864034</td>
			<td></td>
		</tr>
		<tr>
			<td>Twin-Tec 96 Well Plate</td>
			<td>Fisher</td>
			<td>Eppendorf 951020362</td>
			<td></td>
		</tr>
		<tr>
			<td>Piercable foil heat seal</td>
			<td>Bio Rad</td>
			<td>1814040</td>
			<td></td>
		</tr>
		<tr>
			<td>Droplet generator cartidges (DG8)</td>
			<td>Bio Rad</td>
			<td>1863008</td>
			<td></td>
		</tr>
		<tr>
			<td>Droplet generator oil</td>
			<td>Bio Rad</td>
			<td>1863005</td>
			<td></td>
		</tr>
		<tr>
			<td>Droplet generator gasket</td>
			<td>Bio Rad</td>
			<td>1863009</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well Thermocycler T100</td>
			<td>Bio Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>PX1 PCR Plate Sealer</td>
			<td>Bio Rad</td>
			<td>1814000</td>
			<td></td>
		</tr>
		<tr>
			<td>QX200 Droplet Reader and Quantasoft Software</td>
			<td>Bio Rad</td>
			<td>1864001 and 1864003</td>
			<td></td>
		</tr>
		<tr>
			<td>ddPCR Droplet Reader Oil</td>
			<td>Bio Rad</td>
			<td>1863004</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease Free Filtered Pipette Tips</td>
			<td>Thermo Scientific</td>
			<td></td>
			<td>10 ul, 20 ul , 200 ul and 1000 ul</td>
		</tr>
	</tbody>
</table>

droplet digital trap (ddtrap): adaptation of the telomere repeat amplification protocol to droplet digital polymerase chain reaction

The telomere repeat amplification protocol (TRAP) is the most widely used assay to detect telomerase activity within a given a sample. The polymerase chain reaction (PCR)-based method allows for robust measurements of enzyme activity from most cell lysates. The gel-based TRAP with fluorescently labeled primers limits sample throughput, and the ability to detect differences in samples is restricted to two fold or greater changes in enzyme activity. The droplet digital TRAP, ddTRAP, is a highly sensitive approach that has been modified from the traditional TRAP assay, enabling the user to perform a robust analysis on 96 samples per run and obtain absolute quantification of the DNA (telomerase extension products) input within each PCR. Therefore, the newly developed ddTRAP assay overcomes the limitations of the traditional gel-based TRAP assay and provides a more efficient, accurate, and quantitative approach to measuring telomerase activity within laboratory and clinical settings.

Using the ddTRAP, telomerase activity was measured in a cell panel consisting of the following cell lines (Figure 1): nonsmall cell lung cancer (H2882, H1299, Calu6, H920, A549, and H2887), small cell lung cancer (H82 and SHP77), and telomerase-negative fibroblasts (BJ). One million cell pellets were lysed in NP-40 buffer, and telomerase extension reactions were performed in biological triplicates. A common and highly recommended negative control is the &#822...

Watch this Scientific Journal Video about Droplet Digital TRAP ddTRAP: Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction at JoVE.com

Droplet Digital TRAP ddTRAP: Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction

We successfully converted the standard telomere repeat amplification protocol (TRAP) assay to be employed in droplet digital polymerase chain reactions. This new assay, called ddTRAP, is more sensitive and quantitative, allowing for better detection and statistical analysis of telomerase activity within various human cells.

Droplet Digital TRAP (ddTRAP): Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction

The telomere repeat amplification protocol (TRAP) is the most widely used assay to detect telomerase activity within a given a sample. The polymerase ...

Research

JoVE Journal

Cancer Research

Modified Terminal Restriction Fragment Analysis for Quantifying Telomere Length Using In-gel Hybridization

There are several different techniques for measuring telomere length, each with their own advantages and disadvantages. The traditional approach, Telomere ...

Counting Proteins in Single Cells with Addressable Droplet Microarrays

Often cellular behavior and cellular responses are analyzed at the population level where the responses of many cells are pooled together as an average ...

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Important Endpoints and Proliferative Markers to Assess Small Intestinal Injury and Adaptation using a Mouse Model of Chemotherapy-Induced Mucositis

Intestinal adaptation is the natural compensatory mechanism that occurs when the bowel is lost due to trauma. The adaptive responses, such as crypt cell ...

Oncogenic Gene Fusion Detection Using Anchored Multiplex Polymerase Chain Reaction Followed by Next Generation Sequencing

Gene fusions frequently contribute to the oncogenic phenotype of many different types of cancer. Additionally, the presence of certain fusions in samples ...

Pathological Analysis of Lung Metastasis Following Lateral Tail-Vein Injection of Tumor Cells

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous ...

Digital Spatial Profiling for Characterization of the Microenvironment in Adult-Type Diffusely Infiltrating Glioma

Diffusely infiltrating gliomas are associated with high morbidity and mortality due to the infiltrative nature of tumor spread. They are morphologically ...