Name: droplet digital trap (ddtrap): adaptation of the telomere repeat amplification protocol to droplet digital polymerase chain reaction
Uploaded: 2019-05-03T15:00:00.000+00:00
Duration: 6 min 38 s
Description: Watch this Scientific Journal Video about Droplet Digital TRAP ddTRAP: Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction at JoVE.com

The authors would like to acknowledge funding sources from the National Institutes of Health (NIH) (NCI-R00-CA197672-01A1). Small cell lung cancer lines (SHP77 and H82) were a generous gift from Drs. John Minna and Adi Gazdar from the UT Southwestern Medical Center.

1. Buffer preparation and storage
<ol>
	<li>Prepare 50 mL of 1x stock RNase-/DNase-free NP-40 lysis buffer (10 mM Tris-HCl [pH 8.0], 1 mM MgCl2, 1 mM ethylenediaminetetraacetic acid (EDTA), 1% [vol/vol] NP-40, 10% [vol/vol] glycerol, 150 mM NaCl, 5 mM &#946;-mercaptoethanol, and 0.1 mM 4-benzenesulfonyl fluoride hydrochloride (AEBSF)). This buffer can be aliquoted and stored at -20 &#176;C for future use. Avoid freeze/thaw cycles in order to obtain an optimal lysis of cells.</li>
	<li>Prepare 50 mL of 10x stock RNase-/DNase-free TRAP extension buffer (200 mM Tris-HCl [pH 8.0], 15 mM MgCl2, 630 mM KCl, 0.5% [vol/vol] Tween 20, and 10 mM ethylene glycol-bis(&#946;-aminoethyl ether)-N,N,N&#8242;,N&#8242;-tetraacetic acid (EGTA)). This buffer can be aliquoted into 1 mL aliquots and stored at -20 &#176;C for future use.</li>
</ol>
2. Cell lysis
<ol>
	<li>Preparation of the cells
	<ol>
		<li>Thaw a frozen aliquot of NP-40 lysis buffer. Once thawed, place the lysis buffer on ice. Add phenylmethylsulfonyl fluoride (PMSF protease inhibitor) to the NP-40 lysis buffer to reach a final concentration of 0.2 mM. 
		NOTE: This should be done immediately prior to lysing the cells.</li>
		<li>Remove any excess liquid from the collected cell pellets to ensure a dry cell pellet. Note that cell pellets, whether freshly collected or previously frozen (-80 &#176;C or flash frozen in liquid N2), must not contain any leftover solutions from previous centrifugations as these solutions may interfere with downstream procedures.</li>
		<li>Grow, collect, and freeze both telomerase-positive and telomerase-negative cell lines (BJ fibroblasts, IMR-90 or U2OS) in order to use them as positive and negative controls. Use new control lysates every time the assay is performed to ensure assay reproducibility. 
		NOTE: It is advised that a large culture of telomerase-negative cells is grown and aliquoted prior to freezing to remove any tissue-culture-related artifacts that may be introduced during the long-term culture of cell lines to help ensure reproducible results of the negative control sample.</li>
		<li>Place the cell pellets on ice. If the cells were frozen, allow them to thaw briefly on ice. 
		NOTE: Typical cell pellet sizes for the ddTRAP are between 500,000 and 1,000,000 cells. Smaller cell pellets may also be used if necessary, but the cell number must/ideally should be known. The ddTRAP can also be performed based on protein input using a BCA protein assay (input usually is 1 &#181;g).</li>
	</ol>
	</li>
	<li>Lysing of the cells
	<ol>
		<li>Lyse the cells in the NP-40 lysis buffer. Maintain a cell equivalence of 25,000 cells/&#181;L of buffer. For example, lyse a pellet (containing 1,000,000 cells) in 40 &#181;L of NP-40 lysis buffer. Gently pipet the lysate up and down in order to break open the cells. Try to avoid making bubbles.</li>
		<li>Allow the cells to lyse on ice for 30 min. Make sure to gently vortex the lysate to prevent clusters of cell debris from forming. This can be done every 10 min and is meant to keep the lysate a homogenized mixture.</li>
		<li>Dilute the cell lysate (25,000 cells/&#181;L) 1:20 in NP-40 lysis buffer, making the new cell equivalence 1,250 cells/&#181;L. For example, dilute 5 &#181;L of cell lysate into 95 &#181;L of lysis buffer.</li>
	</ol>
	</li>
</ol>
3. Telomerase extension reaction
<ol>
	<li>Prepare a master mix (Table 1) for the telomerase extension reaction (per reaction). 
	NOTE: It is best to prepare the extension reaction master mix during the cell lysis and store it on ice.
	<ol>
		<li>Pipet 48 &#181;L of extension master mix into each PCR tube.</li>
		<li>Add 2 &#181;L of the diluted (1,250 cells/&#181;L) lysate to the extension reaction. The total volume should now be 50 &#181;L with a final cell equivalence of 50 cells/&#181;L.</li>
	</ol>
	</li>
	<li>Perform the telomerase extension reaction (Table 2).</li>
	<li>Store the telomerase extension products at 4 &#176;C for up to 3&#8211;5 days; however, it is optimal to use the extension products within the first 24 h.</li>
</ol>
4. Droplet digital PCR setup
<ol>
	<li>Prepare a master mix (Table 3) for the ddTRAP (per reaction). 
	NOTE: Once the reagents are at room temperature, do not place them or the master mix on ice. Placing the mix on ice may increase viscosity and lead to poor droplet formation. The DNA polymerase in the ddPCR supermix is a hot start and should be stable at room temperature. The ddPCR supermix may be stored at 4 &#176;C after an initial thaw from -20 &#176;C.
	<ol>
		<li>Pipet 19.8 &#181;L of ddPCR master mix into each PCR tube.</li>
		<li>Add 2.2 &#181;L of the extension reaction to each tube. Note that the total volume should now be 22&#160;&#181;L. 
		NOTE: The total amount of sample needed for a ddTRAP is 20 &#181;L (cell equivalence of 100 cells). The extra volume is a precaution for pipet error or sample loss.</li>
	</ol>
	</li>
	<li>Set up the droplet generation cartridge. 
	NOTE: The cartridge contains three different columns of wells that are labeled.
	<ol>
		<li>Load 20 &#181;L of the reaction prepared according to step 4.1.2 into the sample well (middle well) in the cartridge. Avoid bubbles when pipetting the sample. 
		NOTE: If there are bubbles, gently tap the side of the cartridge so that these bubbles come to the top of the solution.</li>
		<li>Load 70 &#181;L of droplet generation oil into the oil well (left well). 
		NOTE: In order to avoid contamination, strictly use a separate set of pipettes and tips for ddPCR droplet generation steps. The order of loading the cartridge is important. The sample must be loaded prior to loading oil as oil is heavier and will fill the microfluidic chambers and lead to poor droplet formation. The minimum number of samples that can be run is eight. All wells of the cartridge must be loaded with the sample as any empty well will lead to a halt in the droplet generation from the droplet generator. If adequate samples are not available to load all eight wells within a cartridge, 20 &#181;L of ddTRAP master mix (step 4.1) can be loaded into the remaining cartridges.</li>
		<li>Secure the gasket in place by tethering it to the ends of the cartridge. 
		NOTE: The lack or improper placement of the gasket will prevent the generator from generating droplets.</li>
		<li>Place the loaded and assembled cartridge into the droplet generator. 
		NOTE: The cartridge is recognized by a magnet in the generator, which will inform the user when the cartridge is placed properly.</li>
	</ol>
	</li>
	<li>Remove the cartridge once the droplets are generated and the cycle is complete (~60&#8211;90 s).
	<ol>
		<li>Gently remove the gasket from the cartridge. Pipet the newly generated droplets (right well), using a multichannel pipette, into a 96-well PCR plate. 
		NOTE: The approximate volume for the newly generated droplet emulsion should be 40&#8211;43 &#181;L.</li>
		<li>Heat seal the plate with aluminum foil PCR plate seals once all the samples are loaded in the 96-well plate in order to prevent evaporation during the PCR steps.</li>
	</ol>
	</li>
	<li>Load the 96-well plate into the thermocycler and perform the following PCR reaction (Table 4). 
	NOTE: All ramp rates between the temperature steps must be set to 2.5 &#176;C/s in order to properly heat the reactions.</li>
</ol>
5. Detection of telomerase extension products
<ol>
	<li>Load the 96-well plate in the droplet reader. 
	NOTE: Make sure to orient the plate properly so that the A1 sample matches with that of the holder.
	<ol>
		<li>Open the software associated with the droplet reader. Double-click the first well A1 to open the sample/well editor screen.</li>
		<li>Click Experiment and select ABS from the drop-down menu. 
		NOTE: Experiment defines the type of assay to be used (i.e., absolute quantification or gene copy number assay). ABS stands for absolute quantification.</li>
		<li>Select QX200 ddPCR Evagreen Supermix to ensure that the correct detection method is employed by the reader. Click Apply in the lower right-hand side of the well editor screen to save the user-defined settings to all of the highlighted wells. 
		NOTE: SUPERMIX defines the type of PCR mix and detection chemistry that will be read by the reader.</li>
		<li>Click on TARGET in the well editor screen of the software in order to define the sample.</li>
		<li>Define the TYPE of sample by clicking the TARGET drop-down menu and selecting either unknown, reference, or NTC (no-template control). 
		NOTE: Unknown would refer to an experimental sample, reference could be a control sample of known telomerase activity, and an NTC is a critical control for the determination of assay validity in terms of contamination and background signal.</li>
		<li>Label all the samples in the Sample Name section and click Apply to ensure the highlighted wells are edited appropriately.</li>
	</ol>
	</li>
	<li>Click Run to run/read the plate. Select either Columns or Rows in the RUN OPTIONS screen when prompted to inform the machine about the orientation the plate should be read in.</li>
</ol>
6. Data analysis
<ol>
	<li>Determine the number of accepted droplets for each sample by clicking on individual wells. Double-click the individual wells or column/row headers to view and analyze the sample data. 
	NOTE: The most important criteria on whether or not to proceed with the analysis of a particular sample is the number of &#8220;accepted droplets&#8221;. For the ddTRAP, samples with 10,000 or more accepted droplets are valid for further analysis. Data can be provided to the user in many formats, including a .csv table, .jpg images, histograms, etc. There are many resources available for the in-depth analysis of ddPCR data, including the ddTRAP11,13. These resources offer a guide to analyzing ddTRAP data, from selecting thresholds11,13 to choosing samples for further analysis11,13, identifying false positives and negatives13, and general troubleshooting13.</li>
	<li>Highlight the wells representing sample replicates and NTC samples. Analyze the samples in comparison to either NTC or negative control lines, such as BJ cells (as listed above in step 2.1.2).
	<ol>
		<li>Manually set the threshold for the samples by clicking on the icon for setting thresholds on the bottom left of the screen. Set thresholds for each individual well or for multiple wells at a time (recommended). 
		NOTE: If background is detected in the NTC, it can be subtracted from all of the other samples to &#8216;normalize&#8217; the signal and ensure that only the true positive signal is analyzed. NTC values are typically in the 0.2&#8211;1 molecule/&#181;L range for the NP-40 lysis buffer system. Other buffer systems and components would need to be tested (for example, CHAPS buffers).</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Frenck, R. W., Blackburn, E. H., Shannon, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+rate+of+telomere+sequence+loss+in+human+leukocytes+varies+with+age.">The rate of telomere sequence loss in human leukocytes varies with age.</a> Proceedings of the National Academy of Sciences of the United States of America. 95 (10), 5607-5610 (1998).</li><li>Morin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+telomere+terminal+transferase+enzyme+is+a+ribonucleoprotein+that+synthesizes+TTAGGG+repeats.">The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats.</a> Cell. 59 (3), 521-529 (1989).</li><li>de Lange, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+telomeres+solve+the+end-protection+problem.">How telomeres solve the end-protection problem.</a> Science. 326 (5955), 948-952 (2009).</li><li>Shay, J. W., Wright, W. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+telomeres+and+telomerase+in+cancer.">Role of telomeres and telomerase in cancer.</a> Seminars in Cancer Biology. 21 (6), 349-353 (2011).</li><li>Kim, W., Shay, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-range+telomere+regulation+of+gene+expression:+Telomere+looping+and+telomere+position+effect+over+long+distances+(TPE-OLD).">Long-range telomere regulation of gene expression: Telomere looping and telomere position effect over long distances (TPE-OLD).</a> Differentiation. 99, 1-9 (2018).</li><li>Robin, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Telomere+position+effect:+regulation+of+gene+expression+with+progressive+telomere+shortening+over+long+distances.">Telomere position effect: regulation of gene expression with progressive telomere shortening over long distances.</a> Genes Development. 28 (22), 2464-2476 (2014).</li><li>Shay, J. W., Wright, W. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Senescence+and+immortalization:+role+of+telomeres+and+telomerase.">Senescence and immortalization: role of telomeres and telomerase.</a> Carcinogenesis. 26 (5), 867-874 (2005).</li><li>Norton, J. C., Holt, S. E., Wright, W. E., Shay, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+detection+of+human+telomerase+activity.">Enhanced detection of human telomerase activity.</a> DNA Cell Biology. 17 (3), 217-219 (1998).</li><li>Herbert, B. S., Hochreiter, A. E., Wright, W. E., Shay, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonradioactive+detection+of+telomerase+activity+using+the+telomeric+repeat+amplification+protocol.">Nonradioactive detection of telomerase activity using the telomeric repeat amplification protocol.</a> Nature Protocols. 1 (3), 1583-1590 (2006).</li><li>Vogelstein, B., Kinzler, K. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR.">Digital PCR.</a> Proceedings of the National Academy of Sciences of the United States of America. 96 (16), 9236-9241 (1999).</li><li>Ludlow, A. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+telomerase+enzyme+activity+determination+using+droplet+digital+PCR+with+single+cell+resolution.">Quantitative telomerase enzyme activity determination using droplet digital PCR with single cell resolution.</a> Nucleic Acids Research. 42 (13), e104 (2014).</li><li>Huang, E. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Maintenance+of+Telomere+Length+in+CD28++T+Cells+During+T+Lymphocyte+Stimulation.">The Maintenance of Telomere Length in CD28+ T Cells During T Lymphocyte Stimulation.</a> Scientific Reports. 7 (1), 6785 (2017).</li><li>Ludlow, A. T., Shelton, D., Wright, W. E., Shay, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ddTRAP:+A+Method+for+Sensitive+and+Precise+Quantification+of+Telomerase+Activity.">ddTRAP: A Method for Sensitive and Precise Quantification of Telomerase Activity.</a> Methods Molecular Biology. 1768, 513-529 (2018).</li></ol>

The authors have nothing to disclose.

The measurement of telomerase activity is critical to a plethora of research topics including, but not limited to, cancer, telomere biology, aging, regenerative medicine, and structure-based drug design. Telomerase RNPs are low abundant, even in cancer cells, making the detection and study of this enzyme challenging. In this paper, we described the step-by-step procedures for the newly developed ddTRAP assay to robustly quantify telomerase activity in cells. By combining the traditional telomerase extension reaction with...

Telomeres are dynamic DNA-protein complexes at the ends of linear chromosomes. Human telomeres are composed of an array of 5&#39;-TTAGGGn hexameric repeats which vary in length between 12&#8211;15 kilobases (kb) at birth1. Human telomerase, the ribonucleoprotein enzyme that maintains the telomeres, was first identified in HeLa cell lysates (cancer cell line)2. Together, telomeres and telomerase play a major role in a spectrum of biological processes such as genome protection, gene regulation, and cancer cell immortality3,4,5,6.
Human telomerase is comprised primarily of two key components, namely telomerase reverse transcriptase and telomerase RNA (hTERT and hTERC, respectively). The protein subunit, hTERT, is the catalytically active reverse transcriptase component of the telomerase enzyme. The RNA template, hTERC, provides telomerase with the template to extend and/or maintain telomeres. Most human somatic tissues have no detectable telomerase activity. The inability of DNA polymerase to extend the end of the lagging strand of DNA along with the lack of telomerase leads to the progressive shortening of telomeres after every round of cellular division. These phenomena lead to telomere shortening in most somatic cells until they reach a critically shortened length, whereby cells enter a state of replicative senescence. The maximal number of times a cell can divide is dictated by its telomere length and this block to continued cell division is thought to prevent progression to oncogenesis7. Cancer cells are able to overcome telomere-induced replicative senescence and continue to proliferate by utilizing telomerase to maintain their telomeres. Approximately 90% of cancers activate telomerase, making telomerase activity critically important in both cancer detection and treatment.
The development of the TRAP assay in the 1990s was instrumental in the identification of the necessary components of the telomerase enzyme, as well as for the measurement of telomerase in a wide range of cells and tissues, both normal and cancerous. The original gel-based PCR assay used radioactively labeled DNA substrates to detect telomerase activity. In 2006, the assay was adapted into a nonradioactive form using fluorescently labeled substrates8,9. By using fluorescently labeled substrates, users were able to visualize the telomerase extension products as bands on a gel by exposing it to the correct excitation wavelength. The sensitivity of the TRAP assay and its ability to detect telomerase activity in crude cell lysates has made this assay the most widely used method for telomerase activity detection. However, the TRAP assay has limitations. The assay is gel-based, making it difficult to perform the necessary replicates in moderate to high-throughput studies, and thus, proper statistical analysis is rarely achieved. Furthermore, the gel-based assay is difficult to quantify reliably due to the inability of detecting less than twofold differences in telomerase activity between samples. Overcoming these two limitations is critical for enzymatic activity assays such as the TRAP to move to clinical or industry settings for the detection of telomerase activity in patient samples or drug design studies.
Digital PCR was initially developed in 1999 as a means to convert the exponential and analog nature of PCR into a linear and digital assay10. Droplet digital PCR (ddPCR) is the most recent innovation of the original digital PCR methodology. Droplet digital PCR came about with the advent of advanced microfluidics and oil-in-water emulsion chemistry to reliably generate stable and equally sized droplets. Unlike gel-based and even quantitative PCR (qPCR), ddPCR generates absolute quantification of the input material. The key to ddPCR is the generation of ~20,000 individual reactions by partitioning samples into droplets. Following end-point PCR, the droplet reader scans each droplet in a flow-cytometer-like fashion, counting, sizing, and recording the presence or absence of fluorescence in each individual droplet (i.e., absence or presence of PCR amplicons in each droplet). Then, using Poisson&#8217;s distribution, input molecules are estimated based on the ratio of positive droplets to the total number of droplets. This number represents an estimate of the number of input molecules in each PCR. Furthermore, ddPCR is performed and analyzed on a 96-well plate which allows the user to run many samples, as well as perform biological and technical replicates for proper statistical analysis. As a result, we have combined the powerful quantification and moderate-throughput nature of ddPCR with the TRAP assay to develop the ddTRAP assay11. This assay is designed for users to study and robustly quantify absolute telomerase activity from biological samples11,12. The sensitivity of the ddTRAP allows the quantification of telomerase activity from limited and precious samples, including single-cell measurements. Furthermore, users can also study the effects of telomerase manipulations and/or drugs with absolute quantification of less than twofold changes (~50% differences). The ddTRAP is the natural evolution of the TRAP assay into the digital and higher-throughput nature of modern laboratory experiments and clinical settings.

<table><tbody><tr><td>1 M Tris-HCl pH 8.0</td><td>Ambion</td><td>AM9855G</td><td>RNAse/DNAse free</td></tr><tr><td>1 M MgCl2</td><td>Ambion</td><td>AM9530G</td><td>RnAse/DNAse free</td></tr><tr><td>0.5 M EDTA pH 8.0</td><td>Ambion</td><td>AM9261</td><td>RNAse/DNAse free</td></tr><tr><td>Surfact- Amps NP-40</td><td>Thermo Scientific</td><td>28324</td><td></td></tr><tr><td>100% Ultrapure Glycerol</td><td>Invitrogen</td><td>15514011</td><td>RNAse/DNAse free</td></tr><tr><td>phenylmethylsulfonyl fluoride</td><td>Thermo Scientific</td><td>36978</td><td>Powder</td></tr><tr><td>2-Mercaptoethanol</td><td>SIGMA-ALDRICH</td><td>516732</td><td></td></tr><tr><td>Nuclease Free H20</td><td>Ambion</td><td>AM9932</td><td>RNAse/DNAse free</td></tr><tr><td>2.5 mM dNTP mix</td><td>Thermo Scientific</td><td>R72501</td><td>2.5 mM of each dATP, dCTP, dGTP and dTTP</td></tr><tr><td>2 M KCl</td><td>Ambion</td><td>AM9640G</td><td>RNAse/DNAse free</td></tr><tr><td>100% Tween-20</td><td>Fisher</td><td>9005-64-5</td><td></td></tr><tr><td>0.5 M EGTA pH 8.0</td><td>Fisher</td><td>50-255-956</td><td>RNAse/DNAse free</td></tr><tr><td>Telomerase Substrate (TS) Primer</td><td>Integrated DNA Technology (IDT)</td><td>Custom Primer (HPLC Purified)</td><td>5&#039;- AATCCGTCGAGCAGAGTT-3&#039;</td></tr><tr><td>ACX (Revers) Primer</td><td>Integrated DNA Technology (IDT)</td><td>Custom Primer (HPLC Purified)</td><td>5&#039;- GCGCGGCTTACCCTTACCCTTACCCTAACC -3&#039;</td></tr><tr><td>Thin walled (250 ul) PCR grade tubes</td><td>USA Scientific</td><td>1402-2900</td><td>strips, plates, tubes etc.</td></tr><tr><td>QX200 ddPCR EvaGreen Supermix</td><td>Bio Rad</td><td>1864034</td><td></td></tr><tr><td>Twin-Tec 96 Well Plate</td><td>Fisher</td><td>Eppendorf 951020362</td><td></td></tr><tr><td>Piercable foil heat seal</td><td>Bio Rad</td><td>1814040</td><td></td></tr><tr><td>Droplet generator cartidges (DG8)</td><td>Bio Rad</td><td>1863008</td><td></td></tr><tr><td>Droplet generator oil</td><td>Bio Rad</td><td>1863005</td><td></td></tr><tr><td>Droplet generator gasket</td><td>Bio Rad</td><td>1863009</td><td></td></tr><tr><td>96-well Thermocycler T100</td><td>Bio Rad</td><td>1861096</td><td></td></tr><tr><td>PX1 PCR Plate Sealer</td><td>Bio Rad</td><td>1814000</td><td></td></tr><tr><td>QX200 Droplet Reader and Quantasoft Software</td><td>Bio Rad</td><td>1864001 and 1864003</td><td></td></tr><tr><td>ddPCR Droplet Reader Oil</td><td>Bio Rad</td><td>1863004</td><td></td></tr><tr><td>Nuclease Free Filtered Pipette Tips</td><td>Thermo Scientific</td><td></td><td>10 ul, 20 ul , 200 ul and 1000 ul</td></tr></tbody></table>

droplet digital trap (ddtrap): adaptation of the telomere repeat amplification protocol to droplet digital polymerase chain reaction

The telomere repeat amplification protocol (TRAP) is the most widely used assay to detect telomerase activity within a given a sample. The polymerase chain reaction (PCR)-based method allows for robust measurements of enzyme activity from most cell lysates. The gel-based TRAP with fluorescently labeled primers limits sample throughput, and the ability to detect differences in samples is restricted to two fold or greater changes in enzyme activity. The droplet digital TRAP, ddTRAP, is a highly sensitive approach that has been modified from the traditional TRAP assay, enabling the user to perform a robust analysis on 96 samples per run and obtain absolute quantification of the DNA (telomerase extension products) input within each PCR. Therefore, the newly developed ddTRAP assay overcomes the limitations of the traditional gel-based TRAP assay and provides a more efficient, accurate, and quantitative approach to measuring telomerase activity within laboratory and clinical settings.

Using the ddTRAP, telomerase activity was measured in a cell panel consisting of the following cell lines (Figure 1): nonsmall cell lung cancer (H2882, H1299, Calu6, H920, A549, and H2887), small cell lung cancer (H82 and SHP77), and telomerase-negative fibroblasts (BJ). One million cell pellets were lysed in NP-40 buffer, and telomerase extension reactions were performed in biological triplicates. A common and highly recommended negative control is the &#822...

Watch this Scientific Journal Video about Droplet Digital TRAP ddTRAP: Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction at JoVE.com

Droplet Digital TRAP ddTRAP: Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction

We successfully converted the standard telomere repeat amplification protocol (TRAP) assay to be employed in droplet digital polymerase chain reactions. This new assay, called ddTRAP, is more sensitive and quantitative, allowing for better detection and statistical analysis of telomerase activity within various human cells.

Droplet Digital TRAP (ddTRAP): Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction

The telomere repeat amplification protocol (TRAP) is the most widely used assay to detect telomerase activity within a given a sample. The polymerase ...

droplet-digital-trap-ddtrap-adaptation-telomere-repeat-amplification

Research

JoVE Journal

Cancer Research

8.7K Views.  University of Michigan. We successfully converted the standard telomere repeat amplification protocol (TRAP) assay to be employed in droplet digital polymerase chain reactions. This new assay, called ddTRAP, is more sensitive and quantitative, allowing for better detection and statistical analysis of telomerase activity within various human cells.

Video: Droplet Digital TRAP ddTRAP: Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction

Digital Polymerase Chain Reaction Assay for the Genetic Variation in a Sporadic Familial Adenomatous Polyposis Patient Using the Chip-in-a-tube Format

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as tumors. Because digital polymerase chain reactions (PCR) enable the precise quantification of DNA copy number variants, they are becoming an essential tool for detecting rare genetic variations, such as drug-resistant mutations. It is expected that molecular diagnoses using digital PCR (dPCR) will be available in clinical practice in the near future; thus, how to efficiently conduct dPCR with human genetic material is a hot topic. Here, we introduce a method to detect Adenomatous polyposis coli (APC) somatic mosaicism using dPCR with the chip-in-a-tube format, which allows eight dPCR reactions to be simultaneously conducted. Care should be taken when filling and sealing the reaction mixture on the chips. This article demonstrates how to avoid the over- and underestimation of positive partitions. Furthermore, we present a simple procedure for collecting the dPCR product from the partitions on the chips, which can then be used to confirm the specific amplification. We hope that this methods report will help promote the dPCR with the chip-in-a-tube method in genetic research.

Digital polymerase chain reaction (PCR) is a useful tool for the high-sensitivity detection of single nucleotide variants and DNA copy number variants. Here, we demonstrate key considerations for measuring rare variants in the human genome using digital PCR with the chip-in-a-tube format.

The quantitative analysis of human genetic variation is crucial for understanding the molecular characteristics of serious medical conditions, such as ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Genetics

Detection and Monitoring of Tumor Associated Circulating DNA in Patient Biofluids

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular sub-classification and temporal monitoring of tumor response to therapy. Here, we describe our dPCR-based method for the detection of tumor somatic mutations in cell free DNA (cfDNA), readily available in&#160;patient biofluids. Although limited in the number of mutations that can be tested for in each assay, this method provides a high level of sensitivity and specificity. Monitoring of mutation abundance, as calculated by MAF, allows for the evaluation of tumor response to therapy, thereby providing a much-needed supplement to radiographic imaging.

Here, we present a protocol to detect tumor somatic mutations in circulating DNA present in patient biological fluids (biofluids). Our droplet digital polymerase chain reaction (dPCR)-based method enables quantification of the tumor mutation allelic frequency (MAF), facilitating a minimally invasive complement to diagnosis and temporal monitoring of tumor response.

Complications associated with upfront and repeat surgical tissue sampling present the need for minimally invasive platforms capable of molecular ...

A Droplet-Based Microfluidic Approach and Microsphere-PCR Amplification for Single-Stranded DNA Amplicons

Droplet-based microfluidics enable the reliable production of homogeneous microspheres in the microfluidic channel, providing controlled size and morphology of the obtained microsphere. A microsphere copolymerized with an acrydite-DNA probe was successfully fabricated. Different methods such as asymmetric PCR, exonuclease digestion, and isolation on streptavidin-coated magnetic beads can be used to synthesize single-stranded DNA (ssDNA). However, these methods cannot efficiently use large amounts of highly purified ssDNA. Here, we describe a microsphere-PCR protocol detailing how ssDNA can be efficiently amplified and separated from dsDNA simply by pipetting from a PCR reaction tube. The amplification of ssDNA can be applied as potential reagents for the DNA microarray and DNA-SELEX (Systematic evolution of ligands by exponential enrichment) processes.

This work provides a method for the fabrication of droplet-based microfluidic platforms and the application of polyacrylamide microspheres for microsphere-PCR amplification. The microsphere-PCR method makes it possible to obtain single-stranded DNA amplicons without separating double-stranded DNA.

Droplet-based microfluidics enable the reliable production of homogeneous microspheres in the microfluidic channel, providing controlled size and ...

Bioengineering

Methylation Specific Multiplex Droplet PCR using Polymer Droplet Generator Device for Hematological Diagnostics

A multiplexed droplet PCR (mdPCR) workflow and detailed protocol for determining epigenetic-based white blood cell (WBC) differential count is described, along with a thermoplastic elastomer (TPE) microfluidic droplet generation device. Epigenetic markers are used for WBC&#160;subtyping which is of important prognostic value in different diseases. This is achieved through the quantification of DNA methylation patterns of specific CG-rich regions in the genome (CpG loci). In this paper, bisulfite-treated DNA from peripheral blood mononuclear cells (PBMCs) is encapsulated in droplets with mdPCR reagents including primers and hydrolysis fluorescent probes specific for CpG loci that correlate with WBC sub-populations. The multiplex approach allows for the interrogation of many CpG loci without the need for separate mdPCR reactions, enabling more accurate parametric determination of WBC sub-populations using epigenetic analysis of methylation sites. This precise quantification can be extended to different applications and highlights the benefits for clinical diagnosis and subsequent prognosis.

Epigenetic markers are used for white blood cell (WBC) subtyping through the quantification of DNA methylation patterns. This protocol presents a multiplex droplet polymerase chain reaction (mdPCR) method using a thermoplastic elastomer (TPE)-based microfluidic device for droplet generation allowing for precise and multiplex methylation-specific target quantification of WBC differential counts.

A multiplexed droplet PCR (mdPCR) workflow and detailed protocol for determining epigenetic-based white blood cell (WBC) differential count is described, ...

Measuring Single-Cell Mitochondrial DNA Copy Number and Heteroplasmy Using Digital Droplet Polymerase Chain Reaction

The mammalian mitochondrial (mt)DNA is a small, circular, double-stranded, intra-mitochondrial DNA molecule, encoding 13 subunits of the electron transport chain. Unlike the diploid nuclear genome, most cells contain many more copies of mtDNA, ranging from less than 100 to over 200,000 copies depending on cell type. MtDNA copy number is increasingly used as a biomarker for a number of age-related degenerative conditions and diseases, and thus, accurate measurement of the mtDNA copy number is becoming a key tool in both research and diagnostic settings. Mutations in the mtDNA, often occurring as single nucleotide polymorphisms (SNPs) or deletions, can either exist in all copies of the mtDNA within the cell (termed homoplasmy) or as a mixture of mutated and WT mtDNA copies (termed heteroplasmy). Heteroplasmic mtDNA mutations are a major cause of clinical mitochondrial pathology, either in rare diseases or in a growing number of common late-onset diseases such as Parkinson's disease. Determining the level of heteroplasmy present in cells is a critical step in the diagnosis of rare mitochondrial diseases and in research aimed at understanding common late-onset disorders where mitochondria may play a role. MtDNA copy number and heteroplasmy have traditionally been measured by quantitative (q)PCR-based assays or deep sequencing. However, the recent introduction of ddPCR technology has provided an alternative method for measuring both parameters. It offers several advantages over existing methods, including the ability to measure absolute mtDNA copy number and sufficient sensitivity to make accurate measurements from single cells even at low copy numbers. Presented here is a detailed protocol describing the measurement of mtDNA copy number in single cells using ddPCR, referred to as droplet generation PCR henceforth, with the option for simultaneous measurement of heteroplasmy in cells with mtDNA deletions. The possibility of expanding this method to measure heteroplasmy in cells with mtDNA SNPs is also discussed.

Here we present a protocol for measuring absolute mitochondrial (mt)DNA copy number and mtDNA deletion heteroplasmy levels in single cells.

The mammalian mitochondrial (mt)DNA is a small, circular, double-stranded, intra-mitochondrial DNA molecule, encoding 13 subunits of the electron ...

Medicine

Two-Step Reverse Transcription Droplet Digital PCR Protocols for SARS-CoV-2 Detection and Quantification

Diagnosis of the ongoing SARS-CoV-2 pandemic is a priority for all countries across the globe. Currently, reverse transcription quantitative PCR (RT-qPCR) is the gold standard for SARS-CoV-2 diagnosis as no permanent solution is available. However effective this technique may be, research has emerged showing its limitations in detection and diagnosis especially when it comes to low abundant targets. In contrast, droplet digital PCR (ddPCR), a recent emerging technology with superior advantages over qPCR, has been shown to overcome the challenges of RT-qPCR in diagnosis of SARS-CoV-2 from low abundant target samples. Prospectively, in this article, the capabilities of RT-ddPCR are further expanded by showing steps on how to develop simplex, duplex, triplex probe mix, and quadruplex assays using a two-color detection system. Using primers and probes targeting specific sites of the SARS-CoV-2 genome (N, ORF1ab, RPP30, and RBD2), the development of these assays is shown to be possible. Additionally, step by step detailed protocols, notes, and suggestions on how to improve the assays workflow and analyze data are provided. Adapting this workflow in future works will ensure that the maximum number of targets can be sensitively detected in a small sample significantly improving on cost and sample throughput.

This work summarizes steps on developing different assays for SARS-CoV-2 detection using a two color ddPCR system. The steps are elaborate and notes have been included on how to improve the assays and experiment performance. These assays may be used for multiple SARS-CoV-2 RT-ddPCR applications.

Diagnosis of the ongoing SARS-CoV-2 pandemic is a priority for all countries across the globe. Currently, reverse transcription quantitative PCR (RT-qPCR) ...

Biology

Quantification of Viral Vectors in Tears Using ddPCR for Bioshedding Studies

A Validatable Droplet Digital Polymerase Chain Reaction Assay for the Detection of Adeno-Associated Viral Vectors in Bioshedding Studies of Tears

The use of viral vectors to treat genetic diseases has increased substantially in recent years, with over 2,000 studies registered to date. Adeno-associated viral (AAV) vectors have found particular success in the treatment of eye related diseases, as exemplified by the approval of voretigene neparvovec-rzyl. To bring new therapies to market, regulatory agencies typically request qualified or validated bioshedding studies to evaluate release of the vector into the environment. However, no official guidelines for the development of molecular based assays to support such shedding studies have been released by the United States Food and Drug Administration, leaving developers to determine best practices for themselves. The purpose of this protocol is to present a validatable protocol for the detection of AAV vectors in human tears by droplet digital polymerase chain reaction (ddPCR) in support of clinical bioshedding studies. This manuscript discusses current industry approaches to molecular assay validation and demonstrates that the method exceeds the target assay acceptance criteria currently proposed in white papers. Finally, steps critical in the performance of any ddPCR assay, regardless of application, are discussed.

Author Spotlight: Addressing Regulatory Gaps in Molecular Studies by Quantifying Viral Vectors in Complex Matrices 

Here, we present a protocol for the development and validation of good laboratory practices in the compliant detection of adeno-associated viral vectors in human tears by droplet digital polymerase chain reaction in support of clinical development of gene therapy vectors.

The use of viral vectors to treat genetic diseases has increased substantially in recent years, with over 2,000 studies registered to date. ...

Digital Droplet Polymerase Chain Reaction for Indel Mutation Detection in Target Genes

Source: Carballar-Lejaraz&#250;, R., et al. <a href="https://app.jove.com/v/62607">Digital-Droplet PCR to Detect Indels Mutations in Genetically Modified Anopheline Mosquito Populations.</a> J. Vis. Exp. (2021).
This video demonstrates the role of digital droplet polymerase chain reaction in identifying indel mutation in a DNA sample. The high precision and sensitivity of ddPCR enable accurate and consistent detection of rare mutations present in a sample, even at low levels. It can identify and quantify indel mutations in different regions of the genome, providing valuable insights into the mechanisms of mutation and the functional consequences of these mutations.&#160;

Source: Carballar-Lejaraz&#250;, R., et al. Digital-Droplet PCR to Detect Indels Mutations in Genetically Modified Anopheline Mosquito Populations. J. ...

JoVE Encyclopedia of Experiments

Biological Techniques

PCR Techniques

Droplet Digital Polymerase Chain Reaction: A Method to Generate Nanodroplet PCR Reactions for Detecting Rare Tumor Mutations

Before beginning the droplet digital PCR procedure, clean the bench space and equipment with 10% bleach and 70% ethanol and gently vortex and briefly centrifuge all of the reagents except the droplet-stabilizing oil. Confirm that the compressed nitrogen gas cylinder is attached to the droplet-generating instrument and that the cylinder tank is set at 90 pounds per square inch. Add 38 microliters of digital PCR reaction mixture directly into the bottom of each well of an 8-well PCR tube strip removing any bubbles with a clean pipette tip.
Add 12 microliters of pre-amplified DNA sample in triplicate to the appropriate wells of the tube strip. Gently pipette the full volume 10 times to mix the reaction mixture with the DNA sample and pipette the full volume from each well into the corresponding A through H channels of a droplet-generating instrument chip. Insert a new PCR tube strip into the droplet-generating instrument and scan the droplet-generating instrument chip ID into the software on the instrument computer.
Then, click &#34;Start the run&#34; to begin dropletizing samples. When the dropletization is complete, remove the PCR tube strip and apply tube strip caps. Transfer the tube strip to a thermal cycler and balance the tube with another tube strip containing 80 microliters of water per well. Then, run the thermal cycler under the appropriate thermal cycling conditions. Replace the strip caps with high-speed caps.
When the thermal cycling is complete, transfer the tube strip to the quantification instrument. Click &#34;Setup a run&#34; on the instrument software and place the tube strip into the quantification instrument. Place the metal shield on top of a new quantification instrument chip. Scan the chip ID into the instrument and insert the chip into the machine. Close the lid of the instrument. In the computer software, enter a name for the digital PCR run and for each of the eight channels. Then, select &#34;Fast mode&#34; and click &#34;Start&#34; to begin the quantification.