Name: analysis of spliceosomal snrna localization in human hela cells using microinjection
Uploaded: 2019-08-06T14:45:00
Description: Watch this Scientific Journal Video about Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection at JoVE.com

This work was supported by the Czech Science Foundation (18-10035S), the National Sustainability Program I (LO1419), institutional support (RVO68378050), the European Regional Development Fund (CZ.02.1.01/0.0/0.0/16_013/0001775) and the Grant Agency of Charles University (GAUK 134516). We further acknowledge the Light Microscopy Core Facility, IMG CAS, Prague, Czech Republic (supported by grants (Czech-Bioimaging - LM2015062).

1. Preparation of snRNAs for Microinjection
<ol>
	<li>Prepare a DNA template containing the full-length or truncated/mutated version of snRNA by PCR using a following PCR setup: 98 &#176;C for 60 s, 98 &#176;C for 15 s, 68 &#176;C for 30 s, 72 &#176;C for 1 min, 98 &#176;C for 15 s for 35x, and 72 &#176;C for 5 min.</li>
	<li>The forward primer must contain a promoter sequence for in vitro transcription just upstream of the first transcribed nucleotide. Amplify U2 snRNA sequence using the forward primer containing the ...

<ol>
	<li>Ishikawa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+truncated+forms+of+U1+snRNA+reveals+a+novel+RNA+degradation+pathway+during+snRNP+biogenesis.">Identification of truncated forms of U1 snRNA reveals a novel RNA degradation pathway during snRNP biogenesis.</a> Nucleic Acids Research. 42 (4), 2708-2724 (2014).</li><li>Stanek, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cajal+bodies+and+snRNPs+-+friends+with+benefits.">Cajal bodies and snRNPs - friends with benefits.</a> RNA Biology. 14 (6), 671-679 (2017).</li><li>Stanek, D., Fox, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+bodies:+news+insights+into+structure+and+function.">Nuclear bodies: news insights into structure and function.</a> Curentr Opinion in Cell Biology. 46, 94-101 (2017).</li><li>Novotny, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SART3-Dependent+Accumulation+of+Incomplete+Spliceosomal+snRNPs+in+Cajal+Bodies.">SART3-Dependent Accumulation of Incomplete Spliceosomal snRNPs in Cajal Bodies.</a> Cell Reports. 10, 429-440 (2015).</li><li>Roithova, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sm-core+mediates+the+retention+of+partially-assembled+spliceosomal+snRNPs+in+Cajal+bodies+until+their+full+maturation.">The Sm-core mediates the retention of partially-assembled spliceosomal snRNPs in Cajal bodies until their full maturation.</a> Nucleic Acids Research. 46 (7), 3774-3790 (2018).</li><li>Fischer, U., Sumpter, V., Sekine, M., Satoh, T., Luhrmann, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleo-cytoplasmic+transport+of+U+snRNPs:+definition+of+a+nuclear+location+signal+in+the+Sm+core+domain+that+binds+a+transport+receptor+independently+of+the+m3G+cap.">Nucleo-cytoplasmic transport of U snRNPs: definition of a nuclear location signal in the Sm core domain that binds a transport receptor independently of the m3G cap.</a> EMBO Journal. 12 (2), 573-583 (1993).</li><li>Shukla, S., Parker, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quality+control+of+assembly-defective+U1+snRNAs+by+decapping+and+5&#39;-to-3&#39;+exonucleolytic+digestion.">Quality control of assembly-defective U1 snRNAs by decapping and 5&#39;-to-3&#39; exonucleolytic digestion.</a> Proceeding of the National Academy of U S A. 111 (32), E3277-E3286 (2014).</li><li>Weil, T. T., Parton, R. M., Davis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Making+the+message+clear:+visualizing+mRNA+localization.">Making the message clear: visualizing mRNA localization.</a> Trends in Cell Biology. 20 (7), 380-390 (2010).</li><li>Klingauf, M., Stanek, D., Neugebauer, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+U4/U6+small+nuclear+ribonucleoprotein+particle+association+in+Cajal+bodies+predicted+by+mathematical+modeling.">Enhancement of U4/U6 small nuclear ribonucleoprotein particle association in Cajal bodies predicted by mathematical modeling.</a> Molecular Biology of the Cell. 17 (12), 4972-4981 (2006).</li><li>Mhlanga, M. M., Vargas, D. Y., Fung, C. W., Kramer, F. R., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=tRNA-linked+molecular+beacons+for+imaging+mRNAs+in+the+cytoplasm+of+living+cells.">tRNA-linked molecular beacons for imaging mRNAs in the cytoplasm of living cells.</a> Nucleic Acids Research. 33 (6), 1902-1912 (2005).</li></ol>

We employed microinjection of fluorescently labelled snRNAs to determine sequences important for snRNA localization into nuclear Cajal bodies. Due to rapid and rather simple preparation of labelled RNAs (preparation of DNA template by PCR followed by in vitro transcription) the method offers effective analysis of how various sequences contribute to RNA localization. In relatively short time, we were able to analyze ten different deletions or substitutions of the U2 snRNA (reference5 and data not s...

RNA splicing is one of the crucial steps in gene expression, which is catalyzed by a large ribonucleoprotein complex called the spliceosome. In total, more than 150 proteins and 5 small nuclear RNAs (snRNAs) are integrated into the spliceosome at different stages of the splicing pathway. U1, U2, U4, U5 and U6 snRNAs are participating in splicing of major GU-AG introns. These snRNAs join the spliceosome as pre-formed small nuclear ribonucleoprotein particles (snRNPs) that contain snRNA, seven Sm proteins associated with snRNA (or Like-Sm proteins, which associate with the U6 snRNA) and 1-12 proteins specific for each snRNP.
Assembly of snRNPs involves cytoplasmic and nuclear stages. Newly transcribed snRNA is exported to the cytoplasm where it acquires a ring assembled from seven Sm proteins. The Sm ring subsequently serves as a signal for snRNA re-import back to the nucleus. Defective snRNAs that fail to associate with Sm proteins are retained in the cytoplasm1. Newly imported snRNPs first appear in the Cajal body where they meet snRNP-specific proteins and finish their maturation (reviewed in reference2,3). We recently showed that inhibition of final maturation steps results in sequestration of immature snRNPs in Cajal bodies4,5. We proposed a model where the final snRNP maturation is under quality control that monitors addition of snRNP-specific proteins and the formation of active snRNPs. However, molecular details of how cells distinguish between correctly assembled mature and aberrant immature particles remain elusive.
To determine snRNA sequences that are essential for targeting and accumulation of snRNAs in nuclear Cajal bodies, we decided to employ microinjection of fluorescently labelled snRNAs. Microinjection was a method of choice because: 1) it does not require an additional sequence tag to distinguish synthetic snRNAs form their endogenous counterparts which is especially important for short RNAs with little space for insertion of extra tag sequence; 2) it allows analysis of sequences that are important for biogenesis. For example, the Sm sequence is essential for Sm ring assembly and re-import into the nucleus6. When snRNAs are expressed in the cell, snRNAs lacking the Sm sequence are degraded in the cytoplasm and do not reach the nucleus and Cajal bodies7. However, snRNAs without the Sm sequence can be directly microinjected into the nucleus and thus a potential role of the Sm sequence in Cajal body localization assayed.
Here, we describe in detail a microinjection method that we applied to determine snRNA sequences necessary to target snRNAs into the Cajal body5. We showed that Sm and SMN binding sites are together necessary and sufficient to localize not only snRNAs but various short non-coding RNAs into the Cajal body. Based on microinjection as well as other evidence, we proposed that the Sm ring assembled on the Sm binding site is the Cajal body localization signal.

<table>
	<tbody>
		<tr>
			<td>ChromaTide Alexa fluor 488-5-UTP</td>
			<td>ThermoFisher</td>
			<td>C11403</td>
			<td>Stock concentration 1 mM</td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium - high glucose</td>
			<td>Sigma-Aldrich</td>
			<td>D5796</td>
			<td>Containing 4.5 g&#8260;L D-glucose, Phenol red and antibiotics</td>
		</tr>
		<tr>
			<td>FemtoJet express Injector</td>
			<td>Eppendorf</td>
			<td>5247000013</td>
			<td></td>
		</tr>
		<tr>
			<td>Femtotips II</td>
			<td>Eppendorf</td>
			<td>930000043</td>
			<td>Microinjection needle of 0.5 &#181;m inner and 0.7 &#181;m outer diameter</td>
		</tr>
		<tr>
			<td>Fluoromont G with DAPI</td>
			<td>SouthernBiotech</td>
			<td>0100-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycogen</td>
			<td>ThermoFisher</td>
			<td>AM9510</td>
			<td>Stock concentration 5 mg/mL</td>
		</tr>
		<tr>
			<td>Gridded Glass Coverslips</td>
			<td>Ibidi</td>
			<td>10817</td>
			<td>Coverslips with a grid, no direct experience with them</td>
		</tr>
		<tr>
			<td>InjectMan NI 2 Micromanipulator</td>
			<td>Eppendorf</td>
			<td>5181000017</td>
			<td></td>
		</tr>
		<tr>
			<td>m3-2,2,7G(5&#39;)ppp(5&#39;)G trimethyled cap analogue</td>
			<td>Jena Bioscience</td>
			<td>NU-853-1</td>
			<td>Stock concentration 40 mM</td>
		</tr>
		<tr>
			<td>MEGAshortscript T7 Transcription Kit</td>
			<td>ThermoFisher</td>
			<td>AM1354</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Cover Glasses 12 mm, No. 1</td>
			<td>Paul Marienfeld GmbH</td>
			<td>111520</td>
			<td>For routine work</td>
		</tr>
		<tr>
			<td>Microscope Cover Glasses 12 mm, No. 1.5</td>
			<td>Paul Marienfeld GmbH</td>
			<td>117520</td>
			<td>For high resolution images</td>
		</tr>
		<tr>
			<td>Microscope DeltaVision</td>
			<td>GE Healthcare</td>
			<td></td>
			<td>For image acquisition</td>
		</tr>
		<tr>
			<td>Microscope DMI6000</td>
			<td>Leica</td>
			<td></td>
			<td>For microinjection</td>
		</tr>
		<tr>
			<td>Paraformaldehyde 32% solution EM grade</td>
			<td>EMS</td>
			<td>15714</td>
			<td>Dissolved in PIPES to the final concentration 4%</td>
		</tr>
		<tr>
			<td>Phenol:Chloroform 5:1</td>
			<td>Sigma-Aldrich</td>
			<td>P1944</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers for U2 amplification: Forward: 5&#8217;-TAATACGACTCACTATAGGGATCGCTTCTCGGCCTTTTGG, 
			Reverse: 5&#180; TGGTGCACCGTTCCTGGAGGT</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>T7 rpromoter sequence in italics</td>
		</tr>
		<tr>
			<td>Phusion High Fidelity DNA polymerase</td>
			<td>BioLab</td>
			<td>M0530L</td>
			<td></td>
		</tr>
		<tr>
			<td>RNasin Plus</td>
			<td>Promega</td>
			<td>N2615</td>
			<td>Stock concentration 40 mM</td>
		</tr>
		<tr>
			<td>Tetramethylrhodamine isothiocyanate Dextran 65-85 kDa</td>
			<td>Sigma-Aldrich</td>
			<td>T1162</td>
			<td>Dissolved in water, stock concentration 1 mg/mL</td>
		</tr>
		<tr>
			<td>Triton-X100</td>
			<td>Serva</td>
			<td>37240</td>
			<td>Dissolved in water, stock concentration 10%</td>
		</tr>
	</tbody>
</table>

analysis of spliceosomal snrna localization in human hela cells using microinjection

Biogenesis of spliceosomal snRNAs is a complex process involving both nuclear and cytoplasmic phases and the last step occurs in a nuclear compartment called the Cajal body. However, sequences that direct snRNA localization into this subnuclear structure have not been known until recently. To determine sequences important for accumulation of snRNAs in Cajal bodies, we employed microinjection of fluorescently labelled snRNAs followed by their localization inside cells. First, we prepared snRNA deletion mutants, synthesized DNA templates for in vitro transcription and transcribed snRNAs in the presence of UTP coupled with Alexa488. Labelled snRNAs were mixed with 70 kDa-Dextran conjugated with TRITC, and microinjected to the nucleus or the cytoplasm of human HeLa cells. Cells were incubated for 1 h and fixed and the Cajal body marker coilin was visualized by indirect immunofluorescence, while snRNAs and dextran, which serves as a marker of nuclear or cytoplasmic injection, were observed directly using a fluorescence microscope. This method allows for efficient and rapid testing of how various sequences influence RNA localization inside cells. Here, we show the importance of the Sm-binding sequence for efficient localization of snRNAs into the Cajal body.

To monitor snRNA localization and the role of the Sm binding site in Cajal body targeting, we prepared a DNA template containing the T7 promoter and either the full-length U2 snRNA or U2 snRNA lacking the seven nucleotides (AUUUUUG) forming the Sm binding site. snRNAs were in vitro transcribed, isolated and mixed with TRITC-coupled dextran-70kDa. We microinjected the mixture containing in vitro transcribed snRNA into the nucleus or the cytoplasm of HeLa cells.
It has been previously shown that...

Watch this Scientific Journal Video about Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection at JoVE.com

Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection

Biogenesis of spliceosomal snRNAs is a complex process involving various cellular compartments. Here, we employed microinjection of fluorescently labelled snRNAs in order to monitor their transport inside the cell.

Biogenesis of spliceosomal snRNAs is a complex process involving both nuclear and cytoplasmic phases and the last step occurs in a nuclear compartment ...

Research

JoVE Journal

Neuroscience

Time-lapse Live Imaging of Clonally Related Neural Progenitor Cells in the Developing Zebrafish Forebrain

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To ...

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Since the discovery of Green Fluorescent Protein (GFP), there has been a revolutionary change in the use of live-cell imaging as a tool for understanding ...

Electrophysiological Measurements and Analysis of Nociception in Human Infants

Pain is an unpleasant sensory and emotional experience. Since infants cannot verbally report their experiences, current methods of pain assessment are ...

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date ...

Micromanipulation of Gene Expression in the Adult Zebrafish Brain Using Cerebroventricular Microinjection of Morpholino Oligonucleotides

Manipulation of gene expression in tissues is  required to perform functional studies. In this paper, we demonstrate the  cerebroventricular ...

Quantification of Cerebral Vascular Architecture using Two-photon Microscopy in a Mouse Model of HIV-induced Neuroinflammation

Human Immunodeficiency Virus 1 (HIV-1) infection frequently results in HIV-1 Associated Neurocognitive Disorders (HAND), and is characterized by a chronic ...

Quantification of Endosome and Lysosome Motilities in Cultured Neurons Using Fluorescent Probes

In the brain, membrane trafficking systems play important roles in regulating neuronal functions, such as neuronal morphology, synaptic plasticity, ...

3D Kinematic Analysis for the Functional Evaluation in the Rat Model of Sciatic Nerve Crush Injury

Compared to the Sciatic Functional Index (SFI), kinematic analysis is a more reliable and sensitive method for performing functional evaluations of ...

In Vivo Targeting of Neural Progenitor Cells in Ferret Neocortex by In Utero Electroporation

Manipulation of gene expression in vivo during embryonic development is the method of choice when analyzing the role of individual genes during mammalian ...