This work was supported by the Czech Science Foundation (18-10035S), the National Sustainability Program I (LO1419), institutional support (RVO68378050), the European Regional Development Fund (CZ.02.1.01/0.0/0.0/16_013/0001775) and the Grant Agency of Charles University (GAUK 134516). We further acknowledge the Light Microscopy Core Facility, IMG CAS, Prague, Czech Republic (supported by grants (Czech-Bioimaging - LM2015062).

1. Preparation of snRNAs for Microinjection
<ol>
	<li>Prepare a DNA template containing the full-length or truncated/mutated version of snRNA by PCR using a following PCR setup: 98 &#176;C for 60 s, 98 &#176;C for 15 s, 68 &#176;C for 30 s, 72 &#176;C for 1 min, 98 &#176;C for 15 s for 35x, and 72 &#176;C for 5 min.</li>
	<li>The forward primer must contain a promoter sequence for in vitro transcription just upstream of the first transcribed nucleotide. Amplify U2 snRNA sequence using the forward primer containing the T7 promoter and the reverse primer, which ends with the last transcribed nucleotide (see Table of Materials for details).</li>
	<li>Synthesize snRNA using a kit for short RNA synthesis (see&#160;Table of Materials&#160;for details) containing T7 RNA polymerase. Add 1 mM ATP, 1 mM CTP, 1 mM GTP, 0.8 mM UTP, 0.2 mM UTP-Alexa488, 1.8 mM trimethylguanosine cap analogue (m32,2,7G(5&#8217;)ppp(5&#8217;)G), 1 &#956;L of an RNA inhibitor and 500-700 ng of the DNA template to the reaction mixture and incubate at 37 &#730;C overnight.</li>
	<li>Add 1 &#181;L (2U) of DNase into the reaction and incubate for additional 15 min at 37 &#730;C.</li>
	<li>Isolate snRNA by acidic phenol/chloroform extraction. Remove the top water phase and add 1/10 of the original volume of 3 M sodium acetate (pH = 5.2), 3 &#181;L of glycogen for better pellet visualization and 2.5 volumes of 100% ethanol. Incubate for 1 h at -80 &#730;C, centrifuge for 10 min at 14,000 x g and 4 &#176;C.</li>
	<li>Wash the pellet with 70% ethanol and dissolve in 12 &#181;L of nuclease-free water. The usual RNA yield was around 600 ng/&#956;L. Store at -80 &#176;C.</li>
	<li>Monitor the integrity of in vitro transcribed snRNAs by agarose gel electrophoreses.</li>
	<li>Before microinjection, dilute RNA to the final concentration 200 ng/&#956;L in water containing 10 &#181;g/&#181;L dextran-TRITC 70 kDa.</li>
</ol>
2. Cells
<ol>
	<li>Before the use, treat the coverslips with 1 M HCl for 1 h, wash thoroughly in distilled water and store in 100% ethanol. Acidic treatment promotes cells adhesion to prevent cell peeling during or after injection. For easier identification of injected cells, use a coverslip with a grid.</li>
	<li>Seed HeLa or other adherent cells 1 day before microinjection on 12 mm coverslips (no. 1 or no. 1.5) to reach 50% confluency at the time of microinjection.</li>
</ol>
3. Injection
NOTE: HeLa cells were microinjected in the Dulbecco&#39;s Modified Eagle Medium (D-MEM, 4.5 g/L D-glucose containing phenol red and antibiotics). Injection was carried out using an injector and a micromanipulator equipped with the sterile needle (see Table of Materials for details). The whole microscopic/micromanipulator system was pre-heated to 37 &#176;C for at least 4 h to prevent fluctuation of individual parts of the microscope and the microinjector.
<ol>
	<li>Put the Petri dish (30 mm) containing 2 mL of culture media with the coverslip in the middle into the holder of the microscope. Load 3 &#181;L of snRNA mixture into the needle using a microloader. Install the needle into the holder of the microinjector in 45&#176; with respect to the surface of the Petri dish.</li>
	<li>To find the needle, use a 10x long distance objective. First, set the speed COARSE on the injector and lower the needle until it touches the culture medium. Using the microscope binoculars, find the bright spot, which is the place where the needle touches the culture medium.</li>
	<li>Change the speed to FINE and further lower the needle while looking into the microscope until the tip of the needle is observed. Move the needle in the middle of visual field and switch to a 40x long distance objective.</li>
	<li>After changing the objective, select the cell and move the needle above this cell. Set the pressures and time for the cell contact (see Tips and troubleshooting in discussion).</li>
	<li>Move the needle down into the cell and then set the lower limit on the micromanipulator. Be careful not to move the needle below the cell.</li>
	<li>After setting the lower limit, move the needle back above the cell and press the injection button on the joystick of the injector. The needle moves automatically inside the cell to the place where the limit is set and injects the RNA mixture.</li>
	<li>To finish, push the button MENU on the injector and remove the needle from the holder. Then disconnect the tube from the injector before switching off the injector and the micromanipulator.</li>
</ol>
4. Cell Fixation and Staining
<ol>
	<li>After the microinjection, return the cells into a CO2 incubator and incubate at 37 &#176;C for 1 h.</li>
	<li>After the incubation, rinse the cells three times with phosphate buffered saline solution (PBS) at room temperature, fix for 20 min with 4% paraformaldehyde in 0.1 M PIPES pH 6.9, and wash three times with room temperature PBS. If only snRNA localization is analyzed, briefly rinse the cells in water and mount in a mounting medium with DAPI.</li>
	<li>In case of additional protein localization, permeabilize the cells with 0.5% Triton-X100 in PBS for 5 min at room temperature. After three rinses with PBS, incubate the cells with primary and secondary antibodies and after final washes in PBS and brief rinse in water, mount in a mounting medium with DAPI.</li>
</ol>
5. Microscopy
<ol>
	<li>If not imaged immediately after mounting, store the slides at 4 &#176;C until imaging.</li>
	<li>Acquire images using a high-end fluorescence microscopic system equipped with an immersion objective (60X or 100x/1.4NA).</li>
	<li>Once microinjected cells are identified, collect a stack of 20 z-sections with 200 nm z steps per sample and subject to mathematical deconvolution. Maximal projections or individual z stacks were then presented.</li>
	<li>To quantify the fluorescent signal, draw Region of Interest (ROI) around a Cajal body identified by coilin immunostaining. Measure the intensity of the snRNA signal in the coilin-defined ROI. Next determine the intensity of snRNA fluorescence in ROI randomly placed in the nucleoplasm and calculate the ratio of RNA signal in the Cajal body and nucleoplasm.</li>
</ol>

<ol>
	<li>Ishikawa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+truncated+forms+of+U1+snRNA+reveals+a+novel+RNA+degradation+pathway+during+snRNP+biogenesis.">Identification of truncated forms of U1 snRNA reveals a novel RNA degradation pathway during snRNP biogenesis.</a> Nucleic Acids Research. 42 (4), 2708-2724 (2014).</li><li>Stanek, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cajal+bodies+and+snRNPs+-+friends+with+benefits.">Cajal bodies and snRNPs - friends with benefits.</a> RNA Biology. 14 (6), 671-679 (2017).</li><li>Stanek, D., Fox, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+bodies:+news+insights+into+structure+and+function.">Nuclear bodies: news insights into structure and function.</a> Curentr Opinion in Cell Biology. 46, 94-101 (2017).</li><li>Novotny, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SART3-Dependent+Accumulation+of+Incomplete+Spliceosomal+snRNPs+in+Cajal+Bodies.">SART3-Dependent Accumulation of Incomplete Spliceosomal snRNPs in Cajal Bodies.</a> Cell Reports. 10, 429-440 (2015).</li><li>Roithova, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sm-core+mediates+the+retention+of+partially-assembled+spliceosomal+snRNPs+in+Cajal+bodies+until+their+full+maturation.">The Sm-core mediates the retention of partially-assembled spliceosomal snRNPs in Cajal bodies until their full maturation.</a> Nucleic Acids Research. 46 (7), 3774-3790 (2018).</li><li>Fischer, U., Sumpter, V., Sekine, M., Satoh, T., Luhrmann, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleo-cytoplasmic+transport+of+U+snRNPs:+definition+of+a+nuclear+location+signal+in+the+Sm+core+domain+that+binds+a+transport+receptor+independently+of+the+m3G+cap.">Nucleo-cytoplasmic transport of U snRNPs: definition of a nuclear location signal in the Sm core domain that binds a transport receptor independently of the m3G cap.</a> EMBO Journal. 12 (2), 573-583 (1993).</li><li>Shukla, S., Parker, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quality+control+of+assembly-defective+U1+snRNAs+by+decapping+and+5&#39;-to-3&#39;+exonucleolytic+digestion.">Quality control of assembly-defective U1 snRNAs by decapping and 5&#39;-to-3&#39; exonucleolytic digestion.</a> Proceeding of the National Academy of U S A. 111 (32), E3277-E3286 (2014).</li><li>Weil, T. T., Parton, R. M., Davis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Making+the+message+clear:+visualizing+mRNA+localization.">Making the message clear: visualizing mRNA localization.</a> Trends in Cell Biology. 20 (7), 380-390 (2010).</li><li>Klingauf, M., Stanek, D., Neugebauer, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+U4/U6+small+nuclear+ribonucleoprotein+particle+association+in+Cajal+bodies+predicted+by+mathematical+modeling.">Enhancement of U4/U6 small nuclear ribonucleoprotein particle association in Cajal bodies predicted by mathematical modeling.</a> Molecular Biology of the Cell. 17 (12), 4972-4981 (2006).</li><li>Mhlanga, M. M., Vargas, D. Y., Fung, C. W., Kramer, F. R., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=tRNA-linked+molecular+beacons+for+imaging+mRNAs+in+the+cytoplasm+of+living+cells.">tRNA-linked molecular beacons for imaging mRNAs in the cytoplasm of living cells.</a> Nucleic Acids Research. 33 (6), 1902-1912 (2005).</li></ol>

The authors have nothing to disclose.

We employed microinjection of fluorescently labelled snRNAs to determine sequences important for snRNA localization into nuclear Cajal bodies. Due to rapid and rather simple preparation of labelled RNAs (preparation of DNA template by PCR followed by in vitro transcription) the method offers effective analysis of how various sequences contribute to RNA localization. In relatively short time, we were able to analyze ten different deletions or substitutions of the U2 snRNA (reference5 and data not s...

RNA splicing is one of the crucial steps in gene expression, which is catalyzed by a large ribonucleoprotein complex called the spliceosome. In total, more than 150 proteins and 5 small nuclear RNAs (snRNAs) are integrated into the spliceosome at different stages of the splicing pathway. U1, U2, U4, U5 and U6 snRNAs are participating in splicing of major GU-AG introns. These snRNAs join the spliceosome as pre-formed small nuclear ribonucleoprotein particles (snRNPs) that contain snRNA, seven Sm proteins associated with snRNA (or Like-Sm proteins, which associate with the U6 snRNA) and 1-12 proteins specific for each snRNP.
Assembly of snRNPs involves cytoplasmic and nuclear stages. Newly transcribed snRNA is exported to the cytoplasm where it acquires a ring assembled from seven Sm proteins. The Sm ring subsequently serves as a signal for snRNA re-import back to the nucleus. Defective snRNAs that fail to associate with Sm proteins are retained in the cytoplasm1. Newly imported snRNPs first appear in the Cajal body where they meet snRNP-specific proteins and finish their maturation (reviewed in reference2,3). We recently showed that inhibition of final maturation steps results in sequestration of immature snRNPs in Cajal bodies4,5. We proposed a model where the final snRNP maturation is under quality control that monitors addition of snRNP-specific proteins and the formation of active snRNPs. However, molecular details of how cells distinguish between correctly assembled mature and aberrant immature particles remain elusive.
To determine snRNA sequences that are essential for targeting and accumulation of snRNAs in nuclear Cajal bodies, we decided to employ microinjection of fluorescently labelled snRNAs. Microinjection was a method of choice because: 1) it does not require an additional sequence tag to distinguish synthetic snRNAs form their endogenous counterparts which is especially important for short RNAs with little space for insertion of extra tag sequence; 2) it allows analysis of sequences that are important for biogenesis. For example, the Sm sequence is essential for Sm ring assembly and re-import into the nucleus6. When snRNAs are expressed in the cell, snRNAs lacking the Sm sequence are degraded in the cytoplasm and do not reach the nucleus and Cajal bodies7. However, snRNAs without the Sm sequence can be directly microinjected into the nucleus and thus a potential role of the Sm sequence in Cajal body localization assayed.
Here, we describe in detail a microinjection method that we applied to determine snRNA sequences necessary to target snRNAs into the Cajal body5. We showed that Sm and SMN binding sites are together necessary and sufficient to localize not only snRNAs but various short non-coding RNAs into the Cajal body. Based on microinjection as well as other evidence, we proposed that the Sm ring assembled on the Sm binding site is the Cajal body localization signal.

<table>
	<tbody>
		<tr>
			<td>ChromaTide Alexa fluor 488-5-UTP</td>
			<td>ThermoFisher</td>
			<td>C11403</td>
			<td>Stock concentration 1 mM</td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium - high glucose</td>
			<td>Sigma-Aldrich</td>
			<td>D5796</td>
			<td>Containing 4.5 g&#8260;L D-glucose, Phenol red and antibiotics</td>
		</tr>
		<tr>
			<td>FemtoJet express Injector</td>
			<td>Eppendorf</td>
			<td>5247000013</td>
			<td></td>
		</tr>
		<tr>
			<td>Femtotips II</td>
			<td>Eppendorf</td>
			<td>930000043</td>
			<td>Microinjection needle of 0.5 &#181;m inner and 0.7 &#181;m outer diameter</td>
		</tr>
		<tr>
			<td>Fluoromont G with DAPI</td>
			<td>SouthernBiotech</td>
			<td>0100-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycogen</td>
			<td>ThermoFisher</td>
			<td>AM9510</td>
			<td>Stock concentration 5 mg/mL</td>
		</tr>
		<tr>
			<td>Gridded Glass Coverslips</td>
			<td>Ibidi</td>
			<td>10817</td>
			<td>Coverslips with a grid, no direct experience with them</td>
		</tr>
		<tr>
			<td>InjectMan NI 2 Micromanipulator</td>
			<td>Eppendorf</td>
			<td>5181000017</td>
			<td></td>
		</tr>
		<tr>
			<td>m3-2,2,7G(5&#39;)ppp(5&#39;)G trimethyled cap analogue</td>
			<td>Jena Bioscience</td>
			<td>NU-853-1</td>
			<td>Stock concentration 40 mM</td>
		</tr>
		<tr>
			<td>MEGAshortscript T7 Transcription Kit</td>
			<td>ThermoFisher</td>
			<td>AM1354</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Cover Glasses 12 mm, No. 1</td>
			<td>Paul Marienfeld GmbH</td>
			<td>111520</td>
			<td>For routine work</td>
		</tr>
		<tr>
			<td>Microscope Cover Glasses 12 mm, No. 1.5</td>
			<td>Paul Marienfeld GmbH</td>
			<td>117520</td>
			<td>For high resolution images</td>
		</tr>
		<tr>
			<td>Microscope DeltaVision</td>
			<td>GE Healthcare</td>
			<td></td>
			<td>For image acquisition</td>
		</tr>
		<tr>
			<td>Microscope DMI6000</td>
			<td>Leica</td>
			<td></td>
			<td>For microinjection</td>
		</tr>
		<tr>
			<td>Paraformaldehyde 32% solution EM grade</td>
			<td>EMS</td>
			<td>15714</td>
			<td>Dissolved in PIPES to the final concentration 4%</td>
		</tr>
		<tr>
			<td>Phenol:Chloroform 5:1</td>
			<td>Sigma-Aldrich</td>
			<td>P1944</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers for U2 amplification: Forward: 5&#8217;-TAATACGACTCACTATAGGGATCGCTTCTCGGCCTTTTGG, 
			Reverse: 5&#180; TGGTGCACCGTTCCTGGAGGT</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>T7 rpromoter sequence in italics</td>
		</tr>
		<tr>
			<td>Phusion High Fidelity DNA polymerase</td>
			<td>BioLab</td>
			<td>M0530L</td>
			<td></td>
		</tr>
		<tr>
			<td>RNasin Plus</td>
			<td>Promega</td>
			<td>N2615</td>
			<td>Stock concentration 40 mM</td>
		</tr>
		<tr>
			<td>Tetramethylrhodamine isothiocyanate Dextran 65-85 kDa</td>
			<td>Sigma-Aldrich</td>
			<td>T1162</td>
			<td>Dissolved in water, stock concentration 1 mg/mL</td>
		</tr>
		<tr>
			<td>Triton-X100</td>
			<td>Serva</td>
			<td>37240</td>
			<td>Dissolved in water, stock concentration 10%</td>
		</tr>
	</tbody>
</table>

analysis of spliceosomal snrna localization in human hela cells using microinjection

Biogenesis of spliceosomal snRNAs is a complex process involving both nuclear and cytoplasmic phases and the last step occurs in a nuclear compartment called the Cajal body. However, sequences that direct snRNA localization into this subnuclear structure have not been known until recently. To determine sequences important for accumulation of snRNAs in Cajal bodies, we employed microinjection of fluorescently labelled snRNAs followed by their localization inside cells. First, we prepared snRNA deletion mutants, synthesized DNA templates for in vitro transcription and transcribed snRNAs in the presence of UTP coupled with Alexa488. Labelled snRNAs were mixed with 70 kDa-Dextran conjugated with TRITC, and microinjected to the nucleus or the cytoplasm of human HeLa cells. Cells were incubated for 1 h and fixed and the Cajal body marker coilin was visualized by indirect immunofluorescence, while snRNAs and dextran, which serves as a marker of nuclear or cytoplasmic injection, were observed directly using a fluorescence microscope. This method allows for efficient and rapid testing of how various sequences influence RNA localization inside cells. Here, we show the importance of the Sm-binding sequence for efficient localization of snRNAs into the Cajal body.

To monitor snRNA localization and the role of the Sm binding site in Cajal body targeting, we prepared a DNA template containing the T7 promoter and either the full-length U2 snRNA or U2 snRNA lacking the seven nucleotides (AUUUUUG) forming the Sm binding site. snRNAs were in vitro transcribed, isolated and mixed with TRITC-coupled dextran-70kDa. We microinjected the mixture containing in vitro transcribed snRNA into the nucleus or the cytoplasm of HeLa cells.
It has been previously shown that...

Watch this Scientific Journal Video about Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection at JoVE.com

Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection

Biogenesis of spliceosomal snRNAs is a complex process involving various cellular compartments. Here, we employed microinjection of fluorescently labelled snRNAs in order to monitor their transport inside the cell.

Biogenesis of spliceosomal snRNAs is a complex process involving both nuclear and cytoplasmic phases and the last step occurs in a nuclear compartment ...

analysis-spliceosomal-snrna-localization-human-hela-cells-using

Research

JoVE Journal

Neuroscience

6.0K Views.  Institute of Molecular Genetics of the Czech Academy of Sciences. Biogenesis of spliceosomal snRNAs is a complex process involving various cellular compartments. Here, we employed microinjection of fluorescently labelled snRNAs in order to monitor their transport inside the cell.

Video: Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection

Time-lapse Live Imaging of Clonally Related Neural Progenitor Cells in the Developing Zebrafish Forebrain

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To understand the behavior of neural progenitor cells in the complex in vivo environment, time-lapse live imaging of neural progenitor cells in an intact brain is critically required. In this video, we exploit the unique features of zebrafish embryos to visualize the development of forebrain neural progenitor cells in vivo. We use electroporation to genetically and sparsely label individual neural progenitor cells. Briefly, DNA constructs coding for fluorescent markers were injected into the forebrain ventricle of 22 hours post fertilization (hpf) zebrafish embryos and electric pulses were delivered immediately. Six hours later, the electroporated zebrafish embryos were mounted with low melting point agarose in glass bottom culture dishes. Fluorescently labeled neural progenitor cells were then imaged for 36hours with fixed intervals under a confocal microscope using water dipping objective lens. The present method provides a way to gain insights into the in vivo development of forebrain neural progenitor cells and can be applied to other parts of the central nervous system of the zebrafish embryo.

The present video demonstrates a method which takes advantage of the combination of electroporation and confocal microscopy to perform live imaging on individual neural progenitor cells in the developing zebrafish forebrain. In vivo analysis of the development of forebrain neural progenitor cells at a clonal level can be achieved in this way.

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To ...

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Since the discovery of Green Fluorescent Protein (GFP), there has been a revolutionary change in the use of live-cell imaging as a tool for understanding fundamental biological mechanisms. Striking progress has been particularly evident in Drosophila, whose extensive toolkit of mutants and transgenic lines provides a convenient model to study evolutionarily-conserved developmental and cell biological mechanisms. We are interested in understanding the mechanisms that control cell fate specification in the adult peripheral nervous system (PNS) in Drosophila. Bristles that cover the head, thorax, abdomen, legs and wings of the adult fly are individual mechanosensory organs, and have been studied as a model system for understanding mechanisms of Notch-dependent cell fate decisions. Sensory organ precursor (SOP) cells of the microchaetes (or small bristles), are distributed throughout the epithelium of the pupal thorax, and are specified during the first 12 hours after the onset of pupariation. After specification, the SOP cells begin to divide, segregating the cell fate determinant Numb to one daughter cell during mitosis. Numb functions as a cell-autonomous inhibitor of the Notch signaling pathway.
Here, we show a method to follow protein dynamics in SOP cell and its progeny within the intact pupal thorax using a combination of tissue-specific Gal4 drivers and GFP-tagged fusion proteins 1,2.This technique has the advantage over fixed tissue or cultured explants because it allows us to follow the entire development of an organ from specification of the neural precursor to growth and terminal differentiation of the organ. We can therefore directly correlate changes in cell behavior to changes in terminal differentiation. Moreover, we can combine the live imaging technique with mosaic analysis with a repressible cell marker (MARCM) system to assess the dynamics of tagged proteins in mitotic SOPs under mutant or wildtype conditions. Using this technique, we and others have revealed novel insights into regulation of asymmetric cell division and the control of Notch signaling activation in SOP cells (examples include references 1-6,7 ,8).

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

In this video, we describe a method for live cell imaging of asymmetrically dividing sensory organ progenitor cells and epidermal cells in intact Drosophila pupae

Since the discovery of Green Fluorescent Protein (GFP), there has been a revolutionary change in the use of live-cell imaging as a tool for understanding ...

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date this tool has been widely used to study the regulation of cellular proliferation, differentiation and neuronal migration especially in the developing cerebral cortex 6-8. Here we detail our protocol to electroporate in utero the cerebral cortex and the hippocampus and provide evidence that this approach can be used to study dendrites and spines in these two cerebral regions.
Visualization and manipulation of neurons in primary cultures have contributed to a better understanding of the processes involved in dendrite, spine and synapse development. However neurons growing in vitro are not exposed to all the physiological cues that can affect dendrite and/or spine formation and maintenance during normal development. Our knowledge of dendrite and spine structures in vivo in wild-type or mutant mice comes mostly from observations using the Golgi-Cox method 9. However, Golgi staining is considered to be unpredictable. Indeed, groups of nerve cells and fiber tracts are labeled randomly, with particular areas often appearing completely stained while adjacent areas are devoid of staining. Recent studies have shown that IUE of fluorescent constructs represents an attractive alternative method to study dendrites, spines as well as synapses in mutant / wild-type mice 10-11 (Figure 1A). Moreover in comparison to the generation of mouse knockouts, IUE represents a rapid approach to perform gain and loss of function studies in specific population of cells during a specific time window. In addition, IUE has been successfully used with inducible gene expression or inducible RNAi approaches to refine the temporal control over the expression of a gene or shRNA 12. These advantages of IUE have thus opened new dimensions to study the effect of gene expression/suppression on dendrites and spines not only in specific cerebral structures (Figure 1B) but also at a specific time point of development (Figure 1C).
Finally, IUE provides a useful tool to identify functional interactions between genes involved in dendrite, spine and/or synapse development. Indeed, in contrast to other gene transfer methods such as virus, it is straightforward to combine multiple RNAi or transgenes in the same population of cells. 
In summary, IUE is a powerful method that has already contributed to the characterization of molecular mechanisms underlying brain function and disease and it should also be useful in the study of dendrites and spines.

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

This article describes in detail a protocol to electroporate in utero the cerebral cortex and the hippocampus at E14.5 in mice. We also show that this is a valuable method to study dendrites and spines in these two cerebral regions.

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date ...

Micromanipulation of Gene Expression in the Adult Zebrafish Brain Using Cerebroventricular Microinjection of Morpholino Oligonucleotides

Manipulation of gene expression in tissues is required to perform functional studies. In this paper, we demonstrate the cerebroventricular microinjection (CVMI) technique as a means to modulate gene expression in the adult zebrafish brain. By using CVMI, substances can be administered into the cerebroventricular fluid and be thoroughly distributed along the rostrocaudal axis of the brain. We particularly focus on the use of antisense morpholino oligonucleotides, which are potent tools for knocking down gene expression in vivo. In our method, when applied, morpholino molecules are taken up by the cells lining the ventricular surface. These cells include the radial glial cells, which act as neurogenic progenitors. Therefore, knocking down gene expression in the radial glial cells is of utmost importance to analyze the widespread neurogenesis response in zebrafish, and also would provide insight into how vertebrates could sustain adult neurogenesis response. Such an understanding would also help the efforts for clinical applications in human neurodegenerative disorders and central nervous system regeneration. Thus, we present the cerebroventricular microinjection method as a quick and efficient way to alter gene expression and neurogenesis response in the adult zebrafish forebrain. We also provide troubleshooting tips and other useful information on how to carry out the CVMI procedure.

In this article, we demonstrate a method for manipulation of gene expression in the ventricular cells of the adult zebrafish telencephalon using antisense morpholino oligonucleotides. We present this method as an efficient and quick protocol that can be used for functional studies in the adult vertebrate brain.

Manipulation of gene expression in tissues is  required to perform functional studies. In this paper, we demonstrate the  cerebroventricular ...

Quantification of Endosome and Lysosome Motilities in Cultured Neurons Using Fluorescent Probes

In the brain, membrane trafficking systems play important roles in regulating neuronal functions, such as neuronal morphology, synaptic plasticity, survival, and glial communications. To date, numerous studies have reported that defects in these systems cause various neuronal diseases. Thus, understanding the mechanisms underlying vesicle dynamics may provide influential clues that could aid in the treatment of several neuronal disorders. Here, we describe a method for quantifying vesicle motilities, such as motility distance and rate of movement, using a software plug-in for the ImageJ platform. To obtain images for quantification, we labeled neuronal endosome-lysosome structures with EGFP-tagged vesicle marker proteins and observed the movement of vesicles using a time-lapse microscopy. This method is highly useful and simplify measuring vesicle motility in neurites, such as axons and dendrites, as well as in the soma of both neurons and glial cells. Furthermore, this method can be applied to other cell lines, such as fibroblasts and endothelial cells. This approach could provide a valuable advancement of our understanding of membrane trafficking.

The investigation of membrane trafficking is crucial for understanding neuronal functions. Here, we introduce a method for quantifying vesicle motility in neurons. This is a convenient method that can be adapted to the quantification of membrane trafficking in the nervous system.

In the brain, membrane trafficking systems play important roles in regulating neuronal functions, such as neuronal morphology, synaptic plasticity, ...

3D Kinematic Analysis for the Functional Evaluation in the Rat Model of Sciatic Nerve Crush Injury

Compared to the Sciatic Functional Index (SFI), kinematic analysis is a more reliable and sensitive method for performing functional evaluations of sciatic nerve injury rodent models. In this protocol, we describe a novel kinematic analysis method that uses a three-dimensional (3D) motion capture apparatus for functional evaluations using a rat sciatic nerve crush injury model. First, the rat is familiarized with treadmill walking. Markers are then attached to the designated bone landmarks and the rat is made to walk on the treadmill at the desired speed. Meanwhile, the posterior limb movements of the rat are recorded using four cameras. Depending on the software used, marker tracings are created using both automatic and manual modes and the desired data are produced after subtle adjustments. This method of kinematic analysis, which uses a 3D motion capture apparatus, offers numerous advantages, including superior precision and accuracy. Many more parameters can be investigated during the comprehensive functional evaluations. This method has several shortcomings that require consideration: The system is expensive, can be complicated to operate, and may produce data deviations due to skin shifting. Nevertheless, kinematic analysis using a 3D motion capture apparatus is useful for performing functional anterior and posterior limb evaluations. In the future, this method may become increasingly useful for generating accurate assessments of various traumas and diseases.

We introduce a kinematic analysis method that uses a three-dimensional motion capture apparatus containing four cameras and data processing software for performing functional evaluations during fundamental research involving rodent models.

Compared to the Sciatic Functional Index (SFI), kinematic analysis is a more reliable and sensitive method for performing functional evaluations of ...

Shuttle Box Assay as an Associative Learning Tool for Cognitive Assessment in Learning and Memory Studies using Adult Zebrafish

Cognitive deficits, including impaired learning and memory, are a primary symptom of various developmental and age-related neurodegenerative diseases and traumatic brain injury (TBI). Zebrafish are an important neuroscience model due to their transparency during development and robust regenerative capabilities following neurotrauma. While various cognitive tests exist in zebrafish, most of the cognitive assessments that are rapid examine non-associative learning. At the same time, associative-learning assays often require multiple days or weeks. Here, we describe a rapid associative-learning test that utilizes an adverse stimulus (electric shock) and requires minimal preparation time. The shuttle box assay, presented here, is simple, ideal for novice investigators, and requires minimal equipment. We demonstrate that, following TBI, this shuttle box test reproducibly assesses cognitive deficit and recovery from young to old zebrafish. Additionally, the assay is adaptable to examine either immediate or delayed memory. We demonstrate that both a single TBI and repeated TBI events negatively affect learning and immediate memory but not delayed memory. We, therefore, conclude that the shuttle box assay reproducibly tracks the progression and recovery of cognitive impairment.

Learning and memory are potent metrics in studying either developmental, disease-dependent, or environmentally induced cognitive impairments. Most cognitive assessments require specialized equipment and extensive time commitments. However, the shuttle box assay is an associative learning tool that utilizes a conventional gel box for rapid and reliable assessment of adult zebrafish cognition.

Cognitive deficits, including impaired learning and memory, are a primary symptom of various developmental and age-related neurodegenerative diseases and ...

Flow Cytometric Analysis of Multiple Mitochondrial Parameters in Human Induced Pluripotent Stem Cells and Their Neural and Glial Derivatives

Mitochondria are important in the pathophysiology of many neurodegenerative diseases. Changes in mitochondrial volume, mitochondrial membrane potential (MMP), mitochondrial production of reactive oxygen species (ROS), and mitochondrial DNA (mtDNA) copy number are often features of these processes. This report details a novel flow cytometry-based approach to measure multiple mitochondrial parameters in different cell types, including human induced pluripotent stem cells (iPSCs) and iPSC-derived neural and glial cells. This flow-based strategy uses live cells to measure mitochondrial volume, MMP, and ROS levels, as well as fixed cells to estimate components of the mitochondrial respiratory chain (MRC) and mtDNA-associated proteins such as mitochondrial transcription factor A (TFAM). 
By co-staining with fluorescent reporters, including MitoTracker Green (MTG), tetramethylrhodamine ethyl ester (TMRE), and MitoSox Red, changes in mitochondrial volume, MMP, and mitochondrial ROS can be quantified and related to mitochondrial content. Double staining with antibodies against MRC complex subunits and translocase of outer mitochondrial membrane 20 (TOMM20) permits the assessment of MRC subunit expression. As the amount of TFAM is proportional to mtDNA copy number, the measurement of TFAM per TOMM20 gives an indirect measurement of mtDNA per mitochondrial volume. The entire protocol can be carried out within 2-3 h. Importantly, these protocols allow the measurement of mitochondrial parameters, both at the total level and the specific level per mitochondrial volume, using flow cytometry.

This study reports a novel approach to measure multiple mitochondrial functional parameters based on flow cytometry and double staining with two fluorescent reporters or antibodies to detect changes in mitochondrial volume, mitochondrial membrane potential, reactive oxygen species level, mitochondrial respiratory chain composition, and mitochondrial DNA.

Mitochondria are important in the pathophysiology of many neurodegenerative diseases. Changes in mitochondrial volume, mitochondrial membrane potential ...

Comprehensive Understanding of Inactivity-Induced Gait Alteration in Rodents

It is well known that disuse affects neural systems and that joint motions become altered; however, which outcomes properly exhibit these characteristics is still unclear. The present study describes a motion analysis approach that utilizes three-dimensional (3D) reconstruction from video captures. Using this technology, disuse-evoked alterations of walking performances were observed in rodents exposed to a simulated microgravity environment by unloading their hindlimb by their tail. After 2 weeks of unloading, the rats walked on a treadmill, and their gait motions were captured with four charge-coupled device (CCD) cameras. 3D motion profiles were reconstructed and compared to those of control subjects using the image processing software. The reconstructed outcome measures successfully portrayed distinct aspects of distorted gait motion: hyperextension of the knee and ankle joints and higher position of the hip joints during the stance phase. Motion analysis is useful for several reasons. First, it enables quantitative behavioral evaluations instead of subjective observations (e.g., pass/fail in certain tasks). Second, multiple parameters can be extracted to fit specific needs once the fundamental datasets are obtained. Despite hurdles for broader application, the disadvantages of this method, including labor intensity and cost, may be alleviated by determining comprehensive measurements and experimental procedures.

The present protocol describes three-dimensional motion tracking/evaluation to depict gait motion alteration of rats after exposure to a simulated disuse environment.

It is well known that disuse affects neural systems and that joint motions become altered; however, which outcomes properly exhibit these characteristics ...