We would like to thank all our co-authors in the article where this method was first described14, especially Tatiana Cajuso, Kimmo Palin, Outi Kilpivaara and Esa Pitk&#228;nen for valuable discussions while developing the method. L.K. is funded by the Academy of Finland (grant numbers 25996, 292789, 306026 and 314394), the Sigrid Juselius Foundation, and the Finnish Cancer Society. B.P. is recipient of University of Helsinki Research Foundation PhD studentship, a Finnish Cancer Society dissertation grant, and a doctoral research grant from Ida Montinin S&#228;&#228;ti&#246;. We also thank Teemu Masalin (University of Helsinki) and Kul Shrestha from L.K.&#39;s research group for assisting us with the video production.

This research was approved by the Institutional Review Board and Ethics committee of Helsinki University Hospital. Signed informed consent was obtained from the subject for the blood sample used to demonstrate this protocol.
1. Designing inverse primers and selecting restriction enzymes (bioinformatics)
<ol>
	<li>Determining a LINE-1 associated unique tag
	<ol>
		<li>Download the TTC28-LINE-1 sequence in FASTA format from a LINE-1 database such as L1Base17. The L1base ID for TTC28-LINE-1 is 135.</li>
		<li>Include 5 kb sequence flanking both 5&#180; and 3&#180; ends of the LINE-1 sequence and annotate it in a word processor. 
		NOTE: Here the LINE-1 flanking sequence is annotated in brown font, and LINE-1 sequence is in grey font (Supplemental File).</li>
		<li>Enter 1 kb sequence downstream of selected LINE-1&#39;s cognate PAS into a PAS prediction tool such as polyadq18 or Dragon PolyA spotter19 and annotate all the polyadenylation signal in this 1 kb window. 
		NOTE: If there is no PAS in the 1 kb window, search for PAS in next 1 kb window downstream. TTC28-LINE-1&#39;s own weak PAS is highlighted in pink and all the other PAS in 1 kb window downstream is highlighted in red (Supplemental File).</li>
		<li>Annotate the sequence between the end of LINE-1&#39;s cognate PAS and the strongest PAS downstream as &#34;unique tag&#34;. 
		NOTE: The &#34;unique tag&#34; of TTC28-LINE-1 is highlighted in yellow (Supplemental File).</li>
	</ol>
	</li>
	<li>Designing inverse primers
	<ol>
		<li>Design inverse PCR primers by entering the &#34;unique tag&#34; sequence into a web-based primer-designing tool like Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) or NCBI&#8217;s primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Since primer pairs designed by these tools face each other facilitating conventional PCR, use the reverse-complement function for the primer pair to perform inverse PCR. 
		NOTE: As LINE-1 transductions are heavily truncated at their 5&#180; end and the size of the transduced region is highly variable, aim to keep the distance between the two inverse primers minimal, by setting the &#34;PCR product length&#34; parameter in NCBI primer-BLAST to the minimum. In the case of multiple PAS within the unique tag, design several primer pairs that correspond to different PASs. Design primers close to the PAS, as LINE-1 insertions initiate from the 3&#180;end of the RNA intermediate and the 5&#180; end is variably truncated. Here three primer pairs were designed, highlighted in teal and green, corresponding to three strong polyadenylation signals in the unique tag of TTC28 LINE-1 (Supplemental File).</li>
	</ol>
	</li>
	<li>Selecting restriction enzymes
	<ol>
		<li>Digest the LINE-1 sequence along with its 5 kb upstream and downstream flanks in silico using web-based tool such as RestrictionMapper. This will give a comprehensive list of restriction enzymes that digests this region, generating different restriction fragments.</li>
		<li>Select restriction enzymes that cut the native locus of LINE-1 as follows: at the 5&#180; end, either upstream of the LINE-1&#180;s 5&#180;end or far 5&#180;end of the LINE-1 itself, and at the 3&#180; end, downstream of the LINE-1&#39;s unique tag. 
		NOTE: The selected restriction enzyme should be insensitive to DNA methylation, should be heat-inactivatable, and should generate staggered &#34;sticky&#34; ends that are complementary to each other. In order to demonstrate LDI-PCR, SacI restriction enzyme that cuts DNA at GAGCTC sites, highlighted here in light green, is used (Supplemental File).</li>
		<li>Take note of the restriction fragment size made by selected restriction enzymes. This should not be longer than 12 kb as it might not be efficiently amplified by PCR.</li>
	</ol>
	</li>
</ol>
2. Making circular DNA templates for long-distance inverse PCR
<ol>
	<li>DNA extraction and quality assessment
	<ol>
		<li>Extract genomic DNA from samples (tumor or blood) using commercially available DNA extraction kits that can extract good quality, high molecular weight DNA necessary for LDI-PCR according to the manufacturer&#39;s instructions. Alternatively, high molecular weight DNA can also be extracted by phenol:chloroform20.</li>
		<li>Measure the DNA concentration using a fluorometer according to the manufacturer&#39;s instructions, and run 100 ng of DNA on 1% (w/v) agarose gel containing ethidium bromide (0.5 &#181;g/mL) in 1x Tris-acetate-EDTA (TAE) buffer at 4.5 V/cm21 alongside &#955;-HindIII DNA molecular weight markers to check DNA quality and quantity.</li>
	</ol>
	</li>
	<li>Digesting genomic DNA
	<ol>
		<li>Make a digestion reaction mix (final volume of 50 &#181;L) by adding 20 units SacI restriction enzyme, 5 &#181;L of 10x reaction buffer (Table of Materials), 100 ng of DNA (up to 44 &#181;L) in a 0.2 mL PCR tube on ice (1 &#181;L of restriction enzyme from most manufacturers is sufficient to completely digest 100 ng of genomic DNA). Mix the solution by flicking the tube, and centrifuge briefly.</li>
		<li>Use a thermal cycler to incubate the reaction mix at 37 &#176;C for 1 h, followed by heat inactivation at 65 &#176;C for 5 min.</li>
	</ol>
	</li>
	<li>Self-ligating the digested genomic DNA
	<ol>
		<li>To the 50 &#181;L digestion mix (after step 2.2.2), add 8 &#181;L of 10x T4 DNA ligase buffer, 1 &#181;L (5 units) of T4 DNA ligase and 21 &#181;L of ultrapure water to make a final reaction volume of 80 &#181;L. Mix the solution by flicking the tubes, and centrifuge briefly.</li>
		<li>Incubate in a thermal cycler at 22 &#176;C for 10 min, terminating with a heat inactivation step at 65 &#176;C for 10 min.</li>
	</ol>
	</li>
</ol>
3. Long-distance inverse PCR
<ol>
	<li>Determining primer annealing temperature by gradient PCR
	<ol>
		<li>Set an annealing temperature gradient of (A-4) &#176;C, (A-2)&#176;C, A, (A+2)&#176;C, (A+4) &#176;C where A is the theoretical&#160;annealing temperature of the primer pair calculated using the commercial vendor&#39;s web-based tool. 
		NOTE: Thermal cyclers from some manufacturers may not allow setting the temperature gradient manually. In that case, the automatic gradient setting can be used with a temperature range of (A-4) &#176;C to (A+4) &#176;C.</li>
		<li>Prepare a master mix for the PCR by combining and mixing the following components in a 1.5 mL microcentrifuge tube: 4 &#181;L of 5x reaction buffer, 0.4 &#181;L of 10 mM dNTP, 5 &#181;L of 2 &#181;M PCR primer (forward and reverse, designed in step 1.3.1), 0.2 &#181;L (0.1 U) of DNA polymerase per reaction. Set up one reaction for each annealing temperature in the gradient.</li>
		<li>For each reaction, aliquot 19 &#181;L of the master mix into 0.2 mL PCR tubes and add 1 &#181;L (1.25 ng) of circular DNA template made in section 2. 
		NOTE: Use circular self-ligated DNA generated from normal blood DNA as template so as to avoid consuming potentially precious tumor DNA for this optimization step.</li>
		<li>Run gradient PCR program on a thermal cycler as described below: (i) one cycle of 3 min&#160;at 98 &#176;C (denaturation); (ii) 35 cycles of (10 s at 98 &#176;C [denaturation], 20 s at the temperature gradient of [A-4] to [A+4] &#176;C [Annealing] and 1&#8722;6 min [30 s per kilobase of expected PCR product] at 72 &#176;C [extension]); (iii) one cycle of 10 min at 72 &#176;C (final extension).</li>
		<li>Run 6 &#181;L of the PCR product in 1% agarose gel21 prepared in 1x TAE buffer at 4.5 V/cm and analyze the PCR products yielded at different annealing temperatures.</li>
		<li>Select the annealing temperature that yields a PCR product that corresponds to the expected size.</li>
	</ol>
	</li>
	<li>Detecting de novo LINE-1 retrotransposition activity in the tumor genome
	<ol>
		<li>Perform LDI-PCR using the inverse PCR primer pair on circular DNA templates generated from tumor samples (section 2). Follow same instructions as for gradient PCR (section 3.1), but this time replacing the temperature gradient with the optimal annealing temperature.</li>
		<li>Analyze the PCR products by agarose gel electrophoresis as done in step 3.1.5. PCR product of known size or the &#34;native&#34; PCR product corresponding to the LINE-1 at its native locus should be visible for each reaction. De novo LINE-1 3&#180; transduction in the tumor sample assayed is detectable as PCR products of different sizes, along with the native PCR product in the agarose gel.</li>
	</ol>
	</li>
</ol>
4. Sequencing LDI-PCR products to reveal the identity of target sites for LINE-1 3&#180; transduction
<ol>
	<li>Perform single-molecule long read sequencing of all the PCR amplicons generated in each LDI-PCR reaction to identify the target integration sites of these LINE-1 3&#180; transduction events. 
	NOTE: Cloning and Sanger sequencing of the LDI-PCR products is also a possible, albeit cumbersome, approach.</li>
	<li>Align the reads produced by single-molecule long read sequencing platforms to the reference genome using standard sequence alignment pipelines. Analyze the aligned reads using LDI-PCR software14 to identify de novo LINE-1 insertions and its target sites.</li>
</ol>

<ol>
	<li>Lander, E. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Initial+sequencing+and+analysis+of+the+human+genome.">Initial sequencing and analysis of the human genome.</a> Nature. 409 (6822), 860-921 (2001).</li><li>Brouha, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hot+LINE-1s+account+for+the+bulk+of+retrotransposition+in+the+human+population.">Hot LINE-1s account for the bulk of retrotransposition in the human population.</a> Proceedings of the National Academy of Sciences of the United States of America. 100 (9), 5280-5285 (2003).</li><li>Goodier, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restricting+retrotransposons:+a+review.">Restricting retrotransposons: a review.</a> Mobile DNA. 7, 16 (2016).</li><li>Lee, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+of+somatic+retrotransposition+in+human+cancers.">Landscape of somatic retrotransposition in human cancers.</a> Science. 337 (6097), 967-971 (2012).</li><li>Miki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disruption+of+the+APC+gene+by+a+retrotransposal+insertion+of+L1+sequence+in+a+colon+cancer.">Disruption of the APC gene by a retrotransposal insertion of L1 sequence in a colon cancer.</a> Cancer Research. 52 (3), 643-645 (1992).</li><li>Scott, E. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hot+L1+retrotransposon+evades+somatic+repression+and+initiates+human+colorectal+cancer.">A hot L1 retrotransposon evades somatic repression and initiates human colorectal cancer.</a> Genome Research. 26 (6), 745-755 (2016).</li><li>Pitkanen, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Frequent+L1+retrotranspositions+originating+from+TTC28+in+colorectal+cancer.">Frequent L1 retrotranspositions originating from TTC28 in colorectal cancer.</a> Oncotarget. 5 (3), 853-859 (2014).</li><li>Tubio, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mobile+DNA+in+cancer.+Extensive+transduction+of+nonrepetitive+DNA+mediated+by+L1+retrotransposition+in+cancer+genomes.">Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes.</a> Science. 345 (6196), 1251343 (2014).</li><li>Badge, R. M., Alisch, R. S., Moran, J. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATLAS:+a+system+to+selectively+identify+human-specific+L1+insertions.">ATLAS: a system to selectively identify human-specific L1 insertions.</a> American Journal of Human Genetics. 72 (4), 823-838 (2003).</li><li>Rodic, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrotransposon+insertions+in+the+clonal+evolution+of+pancreatic+ductal+adenocarcinoma.">Retrotransposon insertions in the clonal evolution of pancreatic ductal adenocarcinoma.</a> Nature Medicine. 21 (9), 1060-1064 (2015).</li><li>Ewing, A. D., Kazazian, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+sequencing+reveals+extensive+variation+in+human-specific+L1+content+in+individual+human+genomes.">High-throughput sequencing reveals extensive variation in human-specific L1 content in individual human genomes.</a> Genome Research. 20 (9), 1262-1270 (2010).</li><li>Sanchez-Luque, F. J., Richardson, S. R., Faulkner, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrotransposon+Capture+Sequencing+(RC-Seq):+A+Targeted,+High-Throughput+Approach+to+Resolve+Somatic+L1+Retrotransposition+in+Humans.">Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans.</a> Methods in Molecular Biology. 1400, 47-77 (2016).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+LINE-1+retrotransposition+in+cortical+neurons+and+non-brain+tissues+of+Rett+patients+and+healthy+individuals.">Somatic LINE-1 retrotransposition in cortical neurons and non-brain tissues of Rett patients and healthy individuals.</a> PLOS Genetics. 15 (4), e1008043 (2019).</li><li>Pradhan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+subclonal+L1+transductions+in+colorectal+cancer+by+long-distance+inverse-PCR+and+Nanopore+sequencing.">Detection of subclonal L1 transductions in colorectal cancer by long-distance inverse-PCR and Nanopore sequencing.</a> Scientific Reports. 7 (1), 14521 (2017).</li><li>Moran, J. V., DeBerardinis, R. J., Kazazian, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exon+shuffling+by+L1+retrotransposition.">Exon shuffling by L1 retrotransposition.</a> Science. 283 (5407), 1530-1534 (1999).</li><li>Philippe, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+individual+L1+retrotransposon+instances+is+restricted+to+cell-type+dependent+permissive+loci.">Activation of individual L1 retrotransposon instances is restricted to cell-type dependent permissive loci.</a> Elife. 5, (2016).</li><li>Penzkofer, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=L1Base+2:+more+retrotransposition-active+LINE-1s,+more+mammalian+genomes.">L1Base 2: more retrotransposition-active LINE-1s, more mammalian genomes.</a> Nucleic Acids Research. 45 (D1), D68-D73 (2017).</li><li>Tabaska, J. E., Zhang, M. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+polyadenylation+signals+in+human+DNA+sequences.">Detection of polyadenylation signals in human DNA sequences.</a> Gene. 231 (1-2), 77-86 (1999).</li><li>Kalkatawi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dragon+PolyA+Spotter:+predictor+of+poly(A)+motifs+within+human+genomic+DNA+sequences.">Dragon PolyA Spotter: predictor of poly(A) motifs within human genomic DNA sequences.</a> Bioinformatics. 29 (11), 1484 (2013).</li><li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+nucleic+acids+by+extraction+with+phenol:chloroform.">Purification of nucleic acids by extraction with phenol:chloroform.</a> Cold Spring Harbor Protocols. 2006 (1), (2006).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+Gel+Electrophoresis.">Agarose Gel Electrophoresis.</a> Cold Spring Harbor Protocols. 2019 (1), (2019).</li><li>Macfarlane, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transduction-specific+ATLAS+reveals+a+cohort+of+highly+active+L1+retrotransposons+in+human+populations.">Transduction-specific ATLAS reveals a cohort of highly active L1 retrotransposons in human populations.</a> Human Mutation. 34 (7), 974-985 (2013).</li><li>Beck, C. R., Garcia-Perez, J. L., Badge, R. M., Moran, J. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LINE-1+elements+in+structural+variation+and+disease.">LINE-1 elements in structural variation and disease.</a> Annual Review of Genomics and Human Genetics. 12, 187-215 (2011).</li><li>Morrish, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+mediated+by+endonuclease-independent+LINE-1+retrotransposition.">DNA repair mediated by endonuclease-independent LINE-1 retrotransposition.</a> Nature Genetics. 31 (2), 159-165 (2002).</li><li>Li, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leukaemia+disease+genes:+large-scale+cloning+and+pathway+predictions.">Leukaemia disease genes: large-scale cloning and pathway predictions.</a> Nature Genetics. 23 (3), 348-353 (1999).</li><li>Pradhan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+screening+of+chromosomal+rearrangements+in+uterine+leiomyomas+by+long-distance+inverse+PCR.">Detection and screening of chromosomal rearrangements in uterine leiomyomas by long-distance inverse PCR.</a> Genes, Chromosomes and Cancer. 55 (3), 215-226 (2016).</li></ol>

The authors have nothing to disclose.

Here we describe a method that can be used to identify de novo LINE-1 insertions stemming from any active LINE-1 of interest. We have optimized this method for a highly active LINE-1, located at 22q12.1, and previously demonstrated it to be highly sensitive in detecting sub-clonal insertions in colorectal cancer14.
Success of LDI-PCR depends on the quality of genomic DNA. Therefore, we have included an additional quality control step to ensure that at the start of the protocol, high-molecular weight DNA is present (step 2.1.2). We recommend storing genomic DNA at -20 &#176;C for long term storage, and to prepare aliquots in order to avoid cycles of freezing and thawing. Using genomic DNA from blood or patient-matched normal tissue is highly recommended to distinguish whether the LINE-1 retrotransposition detected is a germline or a somatic event. Since cut sites for restriction enzymes are stochastic in the genome, it is possible that a particular de novo LINE-1 insertion site might not harbor any cut sites for the restriction enzyme being used in its vicinity. Hence to increase the likelihood of detecting the majority of de novo LINE-1 insertions in tumor DNA, more than one restriction enzyme should be used in separate reactions to generate different libraries of circular DNA template. Furthermore, if the unique tag of the LINE-1 of interest has more than one PAS, then using primer pairs adjacent to each PAS improves the chances of detecting heavily truncated transductions.
Although elegant methods for genome-wide detection of de novo LINE-1 insertions exist, they can be overwhelming if the aim is to probe the retrotransposition competence of a particular LINE-1 in a specific cellular context. For this purpose, LDI-PCR can be an inexpensive and simple yet robust approach to visualize LINE-1 retrotransposition events. The targeting approach used in this method is similar to TS-ATLAS22; however, LDI-PCR avoids using linker oligonucleotides and can amplify both 5&#180; and 3&#180; junctions of de novo LINE-1 insertion simultaneously. Information regarding both 5&#180; and 3&#180; junctions of the LINE-1 insertion, the target site of integration, polyA tail and target-site modifications, all of which are hallmarks of LINE-1 retrotransposition, can be obtained by coupling LDI-PCR with single-molecule long-read sequencing technologies. Long reads thus generated contain the inserted LINE-1 sequence, its unique tag and the target sequences in one single read, circumventing difficulties of mapping short reads in the repetitive region.
There are two major limitations to using LDI-PCR for detection of LINE-1 activity. The first is inherent to PCR: it can only reliably amplify fragments up to 10 kb in size. This should be considered while selecting restriction enzyme(s), as the native fragment should not exceed this limit. Secondly, this method can only detect retrotransposition events that mobilize the LINE-1&#39;s 3&#180; flanking region by 3&#180; transductions. Hence, activity of those LINE-1s that do not exhibit 3&#180; transduction will not be detected using this method. Additionally, despite of being amplified by LDI-PCR, some LINE-1 retrotransposition events that (a) generate a PCR target of similar size as the &#34;native&#34; location or other retrotranspositions or (b) are rare or subclonal, may not be detected by agarose gel electrophoresis. Such LINE-1 retrotransposition events can be captured by sequencing the LDI-PCR product using single molecule long-read sequencing technologies14.
The workflow described here can be easily modified to detect the activity of other &#34;hot&#34; LINE-1s by using a suitable restriction enzyme and by designing inverse primers targeting these LINE-1s. In addition to detection of LINE-1 mediated 3&#180; transduction, this method can be adapted to detect less frequent LINE-1 mediated 5&#180; transductions23. Similar method have been used to identify the integration site of LINE-1 reporters in cell-based assays24 and proviral integration sites in cancer25. Besides LINE-1 insertions, this method can also be utilized to detect other genomic aberrations, such as DNA rearrangements, where information regarding the rearrangement-prone region pre-exists26.

Long interspersed nuclear elements (LINE-1s) are a family of mobile genetic elements called retrotransposons that can independently move from one place to another via a copy-and-paste mechanism called retrotransposition. Over evolutionary time, the human genome has accumulated more than 500,000 copies of LINE-1 repeats1. However, most of the LINE-1 copies present in the genome are mutated and hence cannot move via retrotransposition; only ~150 copies have intact copy of DNA sequence necessary for them to move2. In normal somatic cells, the mobility of these LINE-1s is restricted by different host factors3. These restrictions are relieved in different epithelial tumors, causing LINE-1s to be derepressed and resulting in many de novo insertions in the tumor genome4. Some of these tumor-associated de novo insertions have been shown to cause insertional mutagenesis in genes, hence driving tumor progression5,6. Therefore, it is important to be able to map novel insertions in the tumor genome.
Existing methods to detect de novo LINE-1 insertions use (1) whole-genome sequencing approach4,7,8, where different computational algorithms are used to find de novo LINE-1 insertions from WGS data, or (2) next-generation sequencing that targets the 3&#180; end of young, potentially active LINE-1s9,10,11,12,13. However, finding novel insertions among several thousand near-identical copies with these methods is far from trivial, and the challenge is further aggravated by tumor heterogeneity and genomic alterations associated with LINE-1 insertion4.
Studies using these existing methods showed that just a few LINE-1s account for&#160;the majority of de novo LINE-1 insertions observed in tumors7,8. Therefore, to answer whether or not a particular tumor sample displays LINE-1 activity, it suffices to map retrotransposition events caused by this handful of highly active LINE-1 loci. In this article, we describe a simple polymerase chain reaction (PCR)-based method14 that can be used to monitor the activity of a particular LINE-1 locus in the first intron of the TTC28 gene at 22q12.1 that is highly active in colorectal cancer7,8. This LINE-1 locus will be referred to as TTC28-LINE-1 throughout the article. This assay specifically identifies de novo LINE-1 retrotransposition events that mobilize non-repetitive sequence on the 3&#180; flanking region of the source LINE-1 by a mechanism called 3&#180; transduction15. 3&#180; transduction occurs due to the weak LINE-1 polyadenylation signal (PAS) that causes the transcriptional machinery to skip it and to instead terminate transcription at the stronger PAS downstream, thus capturing the flanking non-repetitive sequence (henceforth referred to as the &#34;unique tag&#34;) which is then inserted into the target location alongside the LINE-1 sequence. Philippe et al.16 recently showed that different cell types can express different LINE-1 loci. In light of this finding, this method can be applied to monitor the activity of the most highly expressed LINE-1 that mobilize&#160;their&#160;unique tag in the cancer type of interest.
The first step in LDI-PCR is digestion of genomic DNA with a restriction enzyme that generates a restriction fragment containing the LINE-1 being assayed (here, TTC28-LINE-1) and its unique tag (Figure 1). Digested DNA is then circularized by self-ligation and PCR amplified using inverse primers located within the unique tag. By doing so, the full-length source LINE-1 at its &#34;native&#34; location is always amplified and alongside it, offspring LINE-1 insertions at different target loci containing the unique tag will also be amplified (Figure 1), thus reporting retrotransposition activity of the LINE-1 in question.

<table><tbody><tr><td>1 Kb DNA Ladder</td><td>New England Biolabs</td><td>N3232L</td><td></td></tr><tr><td>10 mM dNTP</td><td>ThermoFisher Scientific</td><td>18427013</td><td></td></tr><tr><td>Acetic acid</td><td>ThermoFisher Scientific</td><td>64-19-7</td><td>Used to make TAE buffer</td></tr><tr><td>Agarose</td><td>BioNordika</td><td>BN-50004</td><td></td></tr><tr><td>Blood sample (frozen)</td><td></td><td></td><td>Blood sample from a healthy individual for control PCR</td></tr><tr><td>ChemiDoc XRS+ System</td><td>Bio-rad</td><td>1708265</td><td></td></tr><tr><td>DNA Gel Loading Dye (6X)</td><td>ThermoFisher Scientific</td><td>R0611</td><td></td></tr><tr><td>DNeasy Blood &amp;amp; Tissue Kits</td><td>Qiagen</td><td>69504</td><td></td></tr><tr><td>Ethidium Bromide</td><td>Bio-rad</td><td>161-0433</td><td></td></tr><tr><td>Ethylenediaminetetraacetic acid (EDTA)</td><td>ThermoFisher Scientific</td><td>25102-12-9</td><td>Used to make TAE buffer</td></tr><tr><td>FastDigest buffer</td><td>ThermoFisher Scientific</td><td>B64</td><td></td></tr><tr><td>FastDigest SacI</td><td>ThermoFisher Scientific</td><td>FD1133</td><td></td></tr><tr><td>Generuler 1 Kb plus DNA Ladder</td><td>ThermoFisher Scientific</td><td>SM1331</td><td></td></tr><tr><td>Generuler Lambda DNA/HindIII Marker, 2</td><td>ThermoFisher Scientific</td><td>SM0103</td><td></td></tr><tr><td>Mini-Sub&amp;nbsp;Cell GT Cell</td><td>Bio-rad</td><td>1704406</td><td></td></tr><tr><td>Phusion Green Hot Start II High-Fidelity DNA Polymerase</td><td>ThermoFisher Scientific</td><td>F537L</td><td></td></tr><tr><td>PowerPac Basic Power Supply</td><td>Bio-rad</td><td>1645050</td><td></td></tr><tr><td>Quantus Fluorometer</td><td>Promega</td><td>E6150</td><td></td></tr><tr><td>T4 DNA Ligase</td><td>ThermoFisher Scientific</td><td>EL0011</td><td></td></tr><tr><td>Tear-A-Way 96/8, 96 Well PCR Plate</td><td>4titude</td><td>4ti-0750/TA</td><td></td></tr><tr><td>Tris(hydroxymethyl)aminomethane</td><td>ThermoFisher Scientific</td><td>77-86-1</td><td>Used to make TAE buffer</td></tr><tr><td>Veriti Thermal Cycler</td><td>Applied Bioscience</td><td>4375786</td><td></td></tr></tbody></table>

detection of retrotransposition activity of hot line-1s by long-distance inverse pcr

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so by a process called retrotransposition wherein they transcribe to form an mRNA intermediate which is then consequently inserted into the genome by reverse transcription. Despite being silent in normal cells, LINE-1s are highly active in different epithelial tumors. De novo LINE-1 insertions can potentially drive tumorigenesis, and hence it is important to systematically study LINE-1 retrotransposition in cancer. Out of ~150 retrotransposition-competent LINE-1s present in the human genome, only a handful of LINE-1 loci, also referred to as &#34;hot&#34; LINE-1s, account for the majority of de novo LINE-1 insertion in different cancer types. We have developed a simple polymerase chain reaction (PCR)-based method to monitor retrotransposition activity of these hot LINE-1s. This method, based on long-distance inverse (LDI)-PCR, takes advantage of 3&#180; transduction, a mechanism by which a LINE-1 mobilizes its flanking non-repetitive region, which can subsequently be used to identify de novo LINE-1 3&#180; transduction events stemming from a particular hot LINE-1.

In case of TTC28-LINE-1, there is more than one PAS within a 1 kb window downstream of its cognate PAS, hence the region between the TTC28-LINE-1 PAS and strongest PAS at 811 bp downstream was considered as the unique tag for TTC28-LINE-1. Three inverse PCR primer pairs were designed at this unique tag that correspond to different PASs present14. We selected three restriction enzymes: (i) NsiI that cuts 5&#180; upstream of TTC28-LINE-1 and 3&#180; outside the unique tag, and (ii) SacI and (iii) PstI that cut 5&#180; within the LINE-1 in its far 5&#180; end, and 3&#180; outside the unique tag. These generate restriction fragments of 10,288 bp, 5,699 bp, and 6,305 bp respectively.
In order to demonstrate this method, we performed LDI-PCR on DNA extracted from MCF7 cell line. This breast cancer cell line has been previously reported to display TTC28-LINE-1 activity16. For simplicity, we made a circular DNA template using one restriction enzyme, SacI, out of three and performed an LDI-PCR using one primer pair out of three (Table 1) to detect de novo LINE-1 insertions stemming from TTC28-LINE-1.
Good quality of DNA extracted from MCF7 cell line was ensured by agarose gel electrophoresis (Figure 2). Intact high molecular weight DNA shows that the genomic DNA is of optimum quality for this assay. If a smear is visible instead, this indicates poor quality of the extracted DNA, which in turn will hamper downstream procedures.
Figure 3&#160;shows a representative result of a gradient PCR experiment, aimed at determining the optimal annealing temperature of the TTC28-LINE-1 inverse primer pair. Blood genomic DNA digested with SacI, followed by self-ligation to form a circular DNA template, was used for this reaction. A highly specific PCR product of expected size (5,649 bp) at 62, 64 and 66 &#176;C shows that the optimum annealing temperature for this primer pair lies within the range of 62&#8722;66 &#176;C.
We generated a circular DNA template by digesting MCF7 genomic DNA with the SacI restriction enzyme followed by self-ligation. Figure 4 shows that TTC28-LINE-1 3&#180; transduction occurs in MCF7 cell lines: de novo insertions can be detected as LDI-PCR products of varying sizes along with a native PCR product of known size (5,649 bp). To identify genomic coordinates of the de novo target sites, PCR amplicons can be sequenced (see protocol section 4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59880/59880fig1.jpg" /> 
Figure 1: Overview of LDI-PCR to detect LINE-1 3&#180; transduction. A circular DNA template is generated by first digesting (I) it with a restriction enzyme and self-ligating (II) it. This step is followed by inverse PCR (III) with inverse PCR primers targeted to the unique tag of the LINE-1 of interest (sequence between LINE-1&#39;s own weaker PAS, in pink, and stronger PAS downstream, in red). <a href="https://www.jove.com/files/ftp_upload/59880/59880fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59880/59880fig2.jpg" /> 
Figure 2: Quality assessment of extracted DNA. 100 ng of DNA extracted from the MCF7 cell line and blood from a normal individual, which will be used as a control sample, were run alongside 1 &#181;L and 2 &#181;L of &#955; DNA/HindIII marker labelled as M. <a href="https://www.jove.com/files/ftp_upload/59880/59880fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59880/59880fig3.jpg" /> 
Figure 3: Gradient PCR to determine optimal annealing temperature for inverse PCR primers (Table 1). LDI-PCR using inverse primer pairs at annealing temperature ranging from 56 to 66 &#176;C shows a distinct PCR product at 62&#8722;66 &#176;C. Green arrow indicates the selected annealing temperature for future experiments. Circular DNA template generated by digesting blood genomic DNA from a normal individual with SacI followed by self-ligation was used for this optimization step. M, marker (1 kb plus DNA ladder). <a href="https://www.jove.com/files/ftp_upload/59880/59880fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59880/59880fig4.jpg" /> 
Figure 4: LDI-PCR to identify LINE-1 3&#180; transduction stemming from TTC28-LINE-1. Circular DNA templates generated by digesting MCF7 and blood (from normal individual) genomic DNA with SacI followed by self-ligation were amplified by inverse primers in optimum annealing temperature. &#34;Native&#34; PCR product, marked with asterisk, of expected size (5,649 bp) was detected in both MCF7 DNA and normal blood DNA, while MCF7 also produced additional PCR products of varying sizes, indicating de novo LINE-1 retrotransposition. M, marker (1 kb DNA ladder). <a href="https://www.jove.com/files/ftp_upload/59880/59880fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Sequence (5&#180;&#8594; 3&#180;)</td>
		</tr>
		<tr>
			<td>L1_001 (rev)</td>
			<td>TTCACTAAGCATGTATGTGGAAAAC</td>
		</tr>
		<tr>
			<td>L1_002 (fwd)</td>
			<td>CCCAAAATATACCCAATTACTGGCA</td>
		</tr>
	</tbody>
</table>
Table 1: Inverse PCR primer pair designed for the unique tag of TTC28-LINE-114.
Supplemental File.&#160; <a href="https://www.jove.com/files/ftp_upload/59880/Supplemental_File_revised.docx" target="_blank">Please click here to download this file.</a>

Watch this Scientific Journal Video about Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR at JoVE.com

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

This article outlines a simple PCR-based assay to monitor the activity of an active LINE-1 retrotransposon and to map de novo retrotranspositions in a given genome. Using the MCF7 cell line, we demonstrate herein how this method can be applied to detect activity of a LINE-1 located at 22q12.1.

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

detection-retrotransposition-activity-hot-line-1s-long-distance

Research

JoVE Journal

Cancer Research

8.5K Views.  University of Helsinki. This article outlines a simple PCR-based assay to monitor the activity of an active LINE-1 retrotransposon and to map de novo retrotranspositions in a given genome. Using the MCF7 cell line, we demonstrate herein how this method can be applied to detect activity of a LINE-1 located at 22q12.1.

Video: Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

This manuscript describes the experimental procedure and software analysis for a bidirectional integration site assay that can simultaneously analyze upstream and downstream vector-host junction DNA. Bidirectional PCR products can be used for any downstream sequencing platform. The resulting data are useful for a high-throughput, quantitative comparison of integrated DNA targets.

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

Genetics

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Identification of Homologous Recombination Events in Mouse Embryonic Stem Cells Using Southern Blotting and Polymerase Chain Reaction

Relative to the issues of off-target effects and the difficulty of inserting a long DNA fragment in the application of designer nucleases for genome editing, embryonic stem (ES) cell-based gene-targeting technology does not have these shortcomings and is widely used to modify animal/mouse genome ranging from large deletions/insertions to single nucleotide substitutions. Notably, identifying the relatively few homologous recombination (HR) events necessary to obtain desired ES clones is a key step, which demands accurate and reliable methods. Southern blotting and/or conventional PCR are often utilized for this purpose. Here, we describe the detailed procedures of using those two methods to identify HR events that occurred in mouse ES cells in which the endogenous Myh9 gene is intended to be disrupted and replaced by cDNAs encoding other nonmuscle myosin heavy chain IIs (NMHC IIs). The whole procedure of Southern blotting includes the construction of targeting vector(s), electroporation, drug selection, the expansion and storage of ES cells/clones, the preparation, digestion, and blotting of genomic DNA (gDNA), the hybridization and washing of probe(s), and a final step of autoradiography on the X-ray films. PCR can be performed directly with prepared and diluted gDNA. To obtain ideal results, the probes and restriction enzyme (RE) cutting sites for Southern blotting and the primers for PCR should be carefully planned. Though the execution of Southern blotting is time-consuming and labor-intensive and PCR results have false positives, the correct identification by Southern blotting and the rapid screening by PCR allow the sole or combined application of these methods described in this paper to be widely used and consulted by most labs in the identification of genotypes of ES cells and genetically modified animals.

Here, we present a detailed protocol for identifying homologous recombination events that occurred in mouse embryonic stem cells using Southern blotting and/or PCR. This method is exemplified by the generation of nonmuscle myosin II genetic replacement mouse models using traditional embryonic stem cell-based homologous recombination-mediated targeting technology.

Relative to the issues of off-target effects and the difficulty of inserting a long DNA fragment in the application of designer nucleases for genome ...

RNA Next-Generation Sequencing and a Bioinformatics Pipeline to Identify Expressed LINE-1s at the Locus-Specific Level

Long INterspersed Elements-1 (LINEs/L1s) are repetitive elements that can copy and randomly insert in the genome resulting in genomic instability and mutagenesis. Understanding the expression patterns of L1 loci at the individual level will lend to the understanding of the biology of this mutagenic element. This autonomous element makes up a significant portion of the human genome with over 500,000 copies, though 99% are truncated and defective. However, their abundance and dominant number of defective copies make it challenging to identify authentically expressed L1s from L1-related sequences expressed as part of other genes. It is also challenging to identify which specific L1 locus is expressed due to the repetitive nature of the elements. Overcoming these challenges, we present an RNA-Seq bioinformatic approach to identify L1 expression at the locus specific level. In summary, we collect cytoplasmic RNA, select for polyadenylated transcripts, and utilize strand-specific RNA-Seq analyses to uniquely map reads to L1 loci in the human reference genome. We visually curate each L1 locus with uniquely mapped reads to confirm transcription from its own promoter and adjust mapped transcript reads to account for mappability of each individual L1 locus. This approach was applied to a prostate tumor cell line, DU145, to demonstrate the ability of this protocol to detect expression from a small number of the full-length L1 elements.

Here, we present a bioinformatic approach and analyses to identify LINE-1 expression at the locus specific level.

Long INterspersed Elements-1 (LINEs/L1s) are repetitive elements that can copy and randomly insert in the genome resulting in genomic instability and ...

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Genomic, proteomic, transcriptomic, and epigenomic analyses of human tumors indicate that there are thousands of anomalies within each cancer genome compared to matched normal tissue. Based on these analyses it is evident that there are many undiscovered genetic drivers of cancer1. Unfortunately these drivers are hidden within a much larger number of passenger anomalies in the genome that do not directly contribute to tumor formation. Another aspect of the cancer genome is that there is considerable genetic heterogeneity within similar tumor types. Each tumor can harbor different mutations that provide a selective advantage for tumor formation2. Performing an unbiased forward genetic screen in mice provides the tools to generate tumors and analyze their genetic composition, while reducing the background of passenger mutations. The Sleeping Beauty (SB) transposon system is one such method3. The SB system utilizes mobile vectors (transposons) that can be inserted throughout the genome by the transposase enzyme. Mutations are limited to a specific cell type through the use of a conditional transposase allele that is activated by Cre Recombinase. Many mouse lines exist that express Cre Recombinase in specific tissues. By crossing one of these lines to the conditional transposase allele (e.g. Lox-stop-Lox-SB11), the SB system is activated only in cells that express Cre Recombinase. The Cre Recombinase will excise a stop cassette that blocks expression of the transposase allele, thereby activating transposon mutagenesis within the designated cell type. An SB screen is initiated by breeding three strains of transgenic mice so that the experimental mice carry a conditional transposase allele, a concatamer of transposons, and a tissue-specific Cre Recombinase allele. These mice are allowed to age until tumors form and they become moribund. The mice are then necropsied and genomic DNA is isolated from the tumors. Next, the genomic DNA is subjected to linker-mediated-PCR (LM-PCR) that results in amplification of genomic loci containing an SB transposon. LM-PCR performed on a single tumor will result in hundreds of distinct amplicons representing the hundreds of genomic loci containing transposon insertions in a single tumor4. The transposon insertions in all tumors are analyzed and common insertion sites (CISs) are identified using an appropriate statistical method5. Genes within the CIS are highly likely to be oncogenes or tumor suppressor genes, and are considered candidate cancer genes. The advantages of using the SB system to identify candidate cancer genes are: 1) the transposon can easily be located in the genome because its sequence is known, 2) transposition can be directed to almost any cell type and 3) the transposon is capable of introducing both gain- and loss-of-function mutations6. The following protocol describes how to devise and execute a forward genetic screen using the SB transposon system to identify candidate cancer genes (Figure 1).

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

A method of identifying unknown drivers of carcinogenesis using an unbiased approach is described. The method uses the Sleeping Beauty transposon as a random mutagen directed to specific tissues. Genomic mapping of transposon insertions that drive tumor formation identifies novel oncogenes and tumor suppressor genes

Genomic, proteomic, transcriptomic, and epigenomic analyses of human tumors indicate that there are thousands of anomalies within each cancer genome ...

Medicine

Associated Chromosome Trap for Identifying Long-range DNA Interactions

Genetic information encoded by DNA is organized in a complex and highly regulated chromatin structure. Each chromosome occupies a specific territory, that may change according to stage of development or cell cycle. Gene expression can occur in specialized transcriptional factories where chromatin segments may loop out from various chromosome territories, leading to co-localization of DNA segments which may exist on different chromosomes or far apart on the same chromosome. The Associated Chromosome Trap (ACT) assay provides an effective methodology to identify these long-range DNA associations in an unbiased fashion by extending and modifying the chromosome conformation capture technique. The ACT assay makes it possible for us to investigate mechanisms of transcriptional regulation in trans, and can help explain the relationship of nuclear architecture to gene expression in normal physiology and during disease states.

The associated chromosome trap (ACT) assay is a novel unbiased method for identifying long-range DNA interactions. The characterization of long range DNA interactions will allow us to determine the relationship of nuclear architecture to gene expression in both normal physiology and in diseased states.

Genetic information encoded by DNA is organized in a complex and highly regulated chromatin structure.  Each chromosome occupies a specific territory, ...

Biology

Multiplex PCR and Reverse Line Blot Hybridization Assay (mPCR/RLB)

Multiplex PCR/Reverse Line Blot Hybridization assay allows the detection of up to 43 molecular targets in 43 samples using one multiplex PCR reaction followed by probe hybridization on a nylon membrane, which is re-usable. Probes are 5' amine modified to allow fixation to the membrane. Primers are 5' biotin modified which allows detection of hybridized PCR products using streptavidin-peroxidase and a chemiluminescent substrate via photosensitive film. With low setup and consumable costs, this technique is inexpensive (approximately US$2 per sample), high throughput (multiple membranes can be processed simultaneously) and has a short turnaround time (approximately 10 hours). 
The technique can be utilized in a number of ways. Multiple probes can be designed to detect sequence variation within a single amplified product, or multiple products can be amplified
simultaneously, with one (or more) probes used for subsequent detection. A combination of both approaches can also be used within a single assay. The ability to include multiple probes for a single target sequence makes the assay highly specific.
Published applications of mPCR/RLB include detection of antibiotic resistance genes1,2, typing of methicillin-resistant Staphylococcus aureus3-5 and Salmonella sp6, molecular serotyping of Streptococcus pneumoniae7,8, Streptococcus agalactiae9 and enteroviruses10,11, identification of Mycobacterium sp12, detection of genital13-15 and respiratory tract16 and other17 pathogens and detection and identification of mollicutes18. However, the versatility of the technique means the applications are virtually limitless and not restricted to molecular analysis of micro-organisms.
The five steps in mPCR/RLB are a) Primer and Probe design, b) DNA extraction and PCR amplification c) Preparation of the membrane, d) Hybridization and detection, and e) Regeneration of the Membrane.

Multiplex PCR and Reverse Line Blot Hybridization Assay mPCR/RLB

An inexpensive, high throughput method for simultaneous detection of up to 43 molecular targets is described. Applications of mPCR/RLB include microbial typing and detection of multiple pathogens from clinical samples.

Multiplex PCR/Reverse Line Blot Hybridization assay allows the detection of up to 43 molecular targets in 43 samples using one multiplex PCR reaction ...

Quantitation and Analysis of the Formation of HO-Endonuclease Stimulated Chromosomal Translocations by Single-Strand Annealing in Saccharomyces cerevisiae

Genetic variation is frequently mediated by genomic rearrangements that arise through interaction between dispersed repetitive elements present in every eukaryotic genome. This process is an important mechanism for generating diversity between and within organisms1-3. The human genome consists of approximately 40% repetitive sequence of retrotransposon origin, including a variety of LINEs and SINEs4. Exchange events between these repetitive elements can lead to genome rearrangements, including translocations, that can disrupt gene dosage and expression that can result in autoimmune and cardiovascular diseases5, as well as cancer in humans6-9.
Exchange between repetitive elements occurs in a variety of ways. Exchange between sequences that share perfect (or near-perfect) homology occurs by a process called homologous recombination (HR). By contrast, non-homologous end joining (NHEJ) uses little-or-no sequence homology for exchange10,11. The primary purpose of HR, in mitotic cells, is to repair double-strand breaks (DSBs) generated endogenously by aberrant DNA replication and oxidative lesions, or by exposure to ionizing radiation (IR), and other exogenous DNA damaging agents. 
In the assay described here, DSBs are simultaneously created bordering recombination substrates at two different chromosomal loci in diploid cells by a galactose-inducible HO-endonuclease (Figure 1). The repair of the broken chromosomes generates chromosomal translocations by single strand annealing (SSA), a process where homologous sequences adjacent to the chromosome ends are covalently joined subsequent to annealing. One of the substrates, his3-&Delta;3', contains a 3' truncated HIS3 allele and is located on one copy of chromosome XV at the native HIS3 locus. The second substrate, his3-&Delta;5', is located at the LEU2 locus on one copy of chromosome III, and contains a 5' truncated HIS3 allele. Both substrates are flanked by a HO endonuclease recognition site that can be targeted for incision by HO-endonuclease. HO endonuclease recognition sites native to the MAT locus, on both copies of chromosome III, have been deleted in all strains. This prevents interaction between the recombination substrates and other broken chromosome ends from interfering in the assay. The KAN-MX-marked galactose-inducible HO endonuclease expression cassette is inserted at the TRP1 locus on chromosome IV. The substrates share 311 bp or 60 bp of the HIS3 coding sequence that can be used by the HR machinery for repair by SSA. Cells that use these substrates to repair broken chromosomes by HR form an intact HIS3 allele and a tXV::III chromosomal translocation that can be selected for by the ability to grow on medium lacking histidine (Figure 2A). Translocation frequency by HR is calculated by dividing the number of histidine prototrophic colonies that arise on selective medium by the total number of viable cells that arise after plating appropriate dilutions onto non-selective medium (Figure 2B). A variety of DNA repair mutants have been used to study the genetic control of translocation formation by SSA using this system12-14.

Quantitation and Analysis of the Formation of HO-Endonuclease Stimulated Chromosomal Translocations by Single-Strand Annealing in Saccharomyces cerevisiae

The HO-stimulated translocation assay monitors single-strand annealing following the creation of DNA double-strand breaks at multiple loci in diploid Saccharomyces cerevisiae. This mechanism may model genome rearrangements in somatic cells of higher eukaryotes following exposure to high doses of ionizing radiation.

Genetic variation is frequently mediated by genomic rearrangements that arise through interaction between dispersed repetitive elements present in every ...

Single Cell Multiplex Reverse Transcription Polymerase Chain Reaction After Patch-clamp

The cerebral cortex is composed of numerous cell types exhibiting various morphological, physiological, and molecular features. This diversity hampers easy identification and characterization of these cell types, prerequisites to study their specific functions. This article describes the multiplex single cell reverse transcription polymerase chain reaction (RT-PCR) protocol, which allows, after patch-clamp recording in slices, to detect simultaneously the expression of tens of genes in a single cell. This simple method can be implemented with morphological characterization and is widely applicable to determine the phenotypic traits of various cell types and their particular cellular environment, such as in the vicinity of blood vessels. The principle of this protocol is to record a cell with the patch-clamp technique, to harvest and reverse transcribe its cytoplasmic content, and to detect qualitatively the expression of a predefined set of genes by multiplex PCR. It requires a careful design of PCR primers and intracellular patch-clamp solution compatible with RT-PCR. To ensure a selective and reliable transcript detection, this technique also requires appropriate controls from cytoplasm harvesting to amplification steps. Although precautions discussed here must be strictly followed, virtually any electrophysiological laboratory can use the multiplex single cell RT-PCR technique.

This protocol describes the critical steps and precautions required to perform single cell multiplex reverse transcription polymerase chain reaction after patch-clamp. This technique is a simple and effective method to analyze the expression profile of a predetermined set of genes from a single cell characterized by patch-clamp recordings.

The cerebral cortex is composed of numerous cell types exhibiting various morphological, physiological, and molecular features. This diversity hampers ...

Neuroscience

Linear Amplification Mediated PCR &#8211; Localization of Genetic Elements and Characterization of Unknown Flanking DNA

Linear-amplification mediated PCR (LAM-PCR) has been developed to study hematopoiesis in gene corrected cells of patients treated by gene therapy with integrating vector systems. Due to the stable integration of retroviral vectors, integration sites can be used to study the clonal fate of individual cells and their progeny. LAM- PCR for the first time provided evidence that leukemia in gene therapy treated patients originated from provirus induced overexpression of a neighboring proto-oncogene. The high sensitivity and specificity of LAM-PCR compared to existing methods like inverse PCR and ligation mediated (LM)-PCR is achieved by an initial preamplification step (linear PCR of 100 cycles) using biotinylated vector specific primers which allow subsequent reaction steps to be carried out on solid phase (magnetic beads). LAM-PCR is currently the most sensitive method available to identify&#160;unknown DNA which is located in the proximity of known DNA. Recently, a variant of LAM-PCR has been developed that circumvents restriction digest thus abrogating retrieval bias of integration sites and enables a comprehensive analysis of provirus locations in host genomes. The following protocol explains step-by-step the amplification of both 3&#8217;- and 5&#8217;- sequences adjacent to the integrated lentiviral vector.

Linear-amplification mediated (LAM)-PCR is a method developed to identify the exact positions of integrating viral vectors in the genome. The technique has evolved to be the superior method to study clonal dynamics in gene therapy patients, biosafety of novel vector technologies, T-cell diversity, cancer stem cell models, etc.

Linear-amplification mediated PCR (LAM-PCR) has been developed to study hematopoiesis in gene corrected cells of patients treated by gene therapy with ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Summary

Explore More Videos

Chapters in this video

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Identification of Homologous Recombination Events in Mouse Embryonic Stem Cells Using Southern Blotting and Polymerase Chain Reaction

RNA Next-Generation Sequencing and a Bioinformatics Pipeline to Identify Expressed LINE-1s at the Locus-Specific Level

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Associated Chromosome Trap for Identifying Long-range DNA Interactions

Multiplex PCR and Reverse Line Blot Hybridization Assay (mPCR/RLB)

Quantitation and Analysis of the Formation of HO-Endonuclease Stimulated Chromosomal Translocations by Single-Strand Annealing in Saccharomyces cerevisiae

Single Cell Multiplex Reverse Transcription Polymerase Chain Reaction After Patch-clamp

Linear Amplification Mediated PCR – Localization of Genetic Elements and Characterization of Unknown Flanking DNA