This research was supported by grants from NSFC Emergency Management Project (Grant No. 81741004), the National Natural Science Foundation of China (Grant No. 81860272), the Major Research Plan of the Provincial Science and Technology Foundation of Guangxi (Grant No. AB16380219), the China Postdoctoral Science Foundation Grant (Grant No. 2018M630993), and the Guangxi Natural Science Foundation (Grant No. 2018GXNSFAA281067).

Ethical approval was granted by the Joint Chinese University of Hong Kong&#8213;New Territories East Cluster Clinical Research Ethics Committee (Reference Number: 2013.055)
1. PCR amplification
<ol>
	<li>Prior to starting, remove PCR buffer mix, sample diluent and DNA samples (both test and reference DNA) (see the Table of Materials) from the -20 &#176;C freezer and keep them at room temperature for 20&#8211;30 min to make sure all reagents and DNA are fully thawed. Vortex and briefly spin down before use.</li>
	<li>Measure the concentration of the DNA samples using a spectrophotometer (see Table of Materials). The DNA concentration should be 25 ng/&#181;L; dilute with sample diluent to the appropriate concentration if required. 
	NOTE: The DNA should be extracted and purified to remove interfering substances, such as proteins and high salt concentrations. Non-degraded, high-quality DNA should be used for subsequent PCR amplification and analysis (A260/A280: 1.8&#8211;2.0 and A260/A230: &#62;1.0).</li>
	<li>Label wells of a PCR plate or 0.2 mL PCR tubes to identify reference and tested DNA samples.</li>
	<li>Calculate the number of PCR reactions required for the test samples, 2 reference samples and negative control sample. Prepare PCR Master Mix by adding 15 &#181;L of PCR buffer mix, 2.6 &#181;L of sample diluent and 0.4 &#181;L of polymerase for each reaction. 
	NOTE: A negative control using sample diluent is essential to monitor the PCR performance. Prepare the PCR master mix at room temperature, do NOT pipette on ice. The PCR buffer mix is viscous. Mix the tube and then briefly spin down prior to use.</li>
	<li>Vortex the PCR master mix from step 1.4 for 10&#8211;20 s and spin down. Slowly dispense 18 &#181;L of the mixture into each well or tube.</li>
	<li>Vortex and spin down the DNA samples. Pipette 2 &#181;L of each DNA into the appropriate well or tube for a final PCR volume of 20 &#181;L. Mix by pipetting up and down 5 times. 
	NOTE: The total amount of DNA per reaction should be 50&#8211;100 ng. DNA amounts greater than 150 ng per 20 &#181;L PCR reaction may result in a poor amplification of large repeat alleles. For lower concentrated DNAs, the amount of sample diluent in the PCR master mix can be replaced by DNA solution.</li>
	<li>Seal the plate with adhesive plate sealer, or with tube caps.</li>
	<li>Place the sealed PCR plate or tubes in the thermal cycler with heated lid. Run the program with the following settings: 95 &#176;C for 5 min, followed by 25 cycles of denaturing at 98 &#176;C for 35 s, annealing at 59 &#176;C for 35 s, and extension at 72 &#176;C for 4 min; a final step at 72 &#176;C for 10 min. Hold the PCR products at 4 &#176;C in the cycler until removal for further processing.</li>
	<li>After PCR amplification, purify and analyze the products immediately, or store at +2 to +8 &#176;C overnight. Alternatively, the product can be stored for up to 30 days at -30 to -16 &#176;C.</li>
</ol>
2. Purification of the PCR Products
<ol>
	<li>Preheat the incubator shaker to 65 &#176;C.</li>
	<li>For each PCR reaction, add 80 &#181;L of 1x TE buffer (see the Table of Materials) to the 20 &#181;L of each PCR product from section 1.</li>
	<li>Transfer the sample mixture into a PCR clean-up plate (see Table of Materials) using a multichannel pipette.</li>
	<li>Keep the plate uncovered and place it into the incubator shaker, and incubate at 65 &#176;C while shaking at 1,200 rpm for 10 min.</li>
	<li>After incubation, set the vacuum instrument at 250 mbar (or 25 kPa, 188 mmHg, 7.4 in Hg) and aspirate the solution through the filter for 15 min. Wells should have no liquid remaining.</li>
	<li>Cool the incubator shaker down to 25 &#176;C.</li>
	<li>After the first aspiration, turn off the vacuum and add 50 &#181;L of 1x TE buffer to each well. Do not mix. Aspirate the solution for 10 min using the vacuum settings in step 2.5.</li>
	<li>Dry the bottom of the filter plate by pressing it firmly on a stack of paper towels.</li>
	<li>Add 20 &#181;L of 1x TE buffer into the bottom center of each well. Place the plate in the incubator shaker and incubate at 25 &#176;C while shaking at 1,200 rpm for 5 min.</li>
	<li>After incubation, transfer &#62;15 &#181;L of each purified PCR DNA from step 2.9 to a fresh 96-well PCR plate. The purified DNA can be analyzed directly, or alternatively can be stored at -30 to -16 &#176;C until required.</li>
</ol>
3. Fragment Sizing of PCR Products
<ol>
	<li>Prior to starting, allow DNA dye concentrate, DNA gel matrix, DNA marker, DNA ladder and purified DNA samples from step 2 to equilibrate to room temperature for 30 min.</li>
	<li>Set up the priming station.
	<ol>
		<li>Replace the syringe (see Table of Materials) when using a new batch of reagents.</li>
		<li>Adjust the base plate, and release the lever of the syringe clip and slide it up to the top position.</li>
	</ol>
	</li>
	<li>Start the sizing software (see Table of Materials) and prepare the gel-dye mix.</li>
	<li>Vortex dye concentrate for 10 s and spin down. Add 25 &#956;L of the dye to a gel matrix vial. Vortex the mixed solution well and spin down.
	<ol>
		<li>Transfer the gel-dye mix to a spin filter. Place the spin filter in a microcentrifuge and spin for 10 min at room temperature at 1,500 x g &#177; 20%. 
		NOTE: Protect the solution with dye from light and store at 4 &#176;C after use. The gel-dye mix can be used for about 15 chips once prepared. Allow the gel-dye mix to equilibrate to room temperature for 30 min each time before use.</li>
	</ol>
	</li>
	<li>Load the gel-dye mix.
	<ol>
		<li>Insert a new DNA chip on the priming station. Add 9 &#956;L of gel-dye mix into the well marked with &#8220;G&#8221;. Please ensure the plunger is positioned at the 1 mL mark and then close the priming station.</li>
		<li>Press the syringe plunger down until it is held by the clip. Wait for exactly 30 s then release the clip. Wait for 5 s, and then slowly pull the plunger back to the 1 mL position.</li>
		<li>Open the priming station and add 9 &#956;L of gel-dye mix into the wells marked with &#8220;G&#8221;.</li>
	</ol>
	</li>
	<li>Add 5 &#956;L of marker into the well marked with the ladder symbol and also add 5 &#956;L of marker into each of the 12 sample wells. Do not leave any wells empty.</li>
	<li>Add 1 &#181;L of DNA ladder into the well marked with the ladder symbol. Add 1 &#181;L of PCR product (used wells) from step 3.1 or 1 &#181;L of ultrapure water (unused wells) into each of the 12 sample wells. Put the chip horizontally in the adapter of vortex mixer and vortex for 1 min at the indicated setting (2,400 rpm).</li>
	<li>Insert the chip in the bioanalyzer instrument and run the chip in the instrument within 5 min.</li>
	<li>After the assay is complete, immediately remove the used chip from the instrument.</li>
	<li>Slowly add 350 &#956;L of deionized water into one of the wells of the electrode cleaner. Open the lid of the bioanalyzer and place the electrode cleaner into it. Close the lid and incubate for about 10 s. Open the lid and remove the electrode cleaner. Wait another 10 s to allow the water on the electrodes to evaporate and then close the lid.</li>
</ol>
4. Analyze the Fragment Sizing Results
NOTE: The reference samples should be amplified and analyzed by the same thermal cycler and bioanalyzer in the same batch with the unknown samples.
<ol>
	<li>After the bioanalyzer run completes, export the peak data from each run as a .csv table file for subsequent analysis.</li>
	<li>Start the analysis software and open the exported .csv peak table file from step 4.1.</li>
	<li>Through the QC menu tab, review the regression line fitted to the four points (shown as blue diamonds on the plot) from the two reference samples. The R2 value of the regression line should be &#62;0.98 (typical values exceed 0.999).</li>
	<li>Through the Results menu tab, check the repeat size of each sample whose fragment length(s) is automatically plotted against the linear regression standard curve derived from the reference samples. The software also provides the classification of each sample according to different guidelines.</li>
	<li>Through the Export menu tab, export the result report for each sample with the repeat numbers and diagnostic classification, as well as a summary of sample information and QC report for each run. 
	NOTE: Analysis software allows the use of custom classification guidelines, such as American College of Medical Genetics (ACMG) or Clinical Molecular Genetics Society/ European Society of Human Genetics (CMGS/ESHG) guidelines, as well as predefined classification criteria.</li>
</ol>

<ol>
	<li>Verkerk, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+gene+(FMR-1)+containing+a+CGG+repeat+coincident+with+a+breakpoint+cluster+region+exhibiting+length+variation+in+fragile+X+syndrome.">Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome.</a> Cell. 65, 905-914 (1991).</li><li>Fu, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variation+of+the+CGG+repeat+at+the+fragile+X+site+results+in+genetic+instability:+resolution+of+the+Sherman+paradox.">Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox.</a> Cell. 67, 1047-1058 (1991).</li><li>Antar, L. N., Li, C., Zhang, H., Carroll, R. C., Bassell, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local+functions+for+FMRP+in+axon+growth+cone+motility+and+activity-dependent+regulation+of+filopodia+and+spine+synapses.">Local functions for FMRP in axon growth cone motility and activity-dependent regulation of filopodia and spine synapses.</a> Molecular and Cellular Neurosciences. 32, 37-48 (2006).</li><li>Didiot, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+G-quartet+containing+FMRP+binding+site+in+FMR1+mRNA+is+a+potent+exonic+splicing+enhancer.">The G-quartet containing FMRP binding site in FMR1 mRNA is a potent exonic splicing enhancer.</a> Nucleic Acids Research. 36, 4902-4912 (2008).</li><li>Bechara, E. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+function+for+fragile+X+mental+retardation+protein+in+translational+activation.">A novel function for fragile X mental retardation protein in translational activation.</a> PLoS Biology. 7, e16 (2009).</li><li>Ascano, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMRP+targets+distinct+mRNA+sequence+elements+to+regulate+protein+expression.">FMRP targets distinct mRNA sequence elements to regulate protein expression.</a> Nature. 492, 382-386 (2012).</li><li>Kenny, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MOV10+and+FMRP+regulate+AGO2+association+with+microRNA+recognition+elements.">MOV10 and FMRP regulate AGO2 association with microRNA recognition elements.</a> Cell Reports. 9, 1729-1741 (2014).</li><li>Oberle, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Instability+of+a+550-base+pair+DNA+segment+and+abnormal+methylation+in+fragile+X+syndrome.">Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome.</a> Science. 252, 1097-1102 (1991).</li><li>Hagerman, R., Lauterborn, J., Au, J., Berry-Kravis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+syndrome+and+targeted+treatment+trials.">Fragile X syndrome and targeted treatment trials.</a> Results and Problems in Cell Differentiation. 54, 297-335 (2012).</li><li>Hatton, D. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autistic+behavior+in+children+with+fragile+X+syndrome:+prevalence,+stability,+and+the+impact+of+FMRP.">Autistic behavior in children with fragile X syndrome: prevalence, stability, and the impact of FMRP.</a> American Journal of Medical Genetics Part A. 140A, 1804-1813 (2006).</li><li>Mattei, J. F., Mattei, M. G., Aumeras, C., Auger, M., Giraud, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-linked+mental+retardation+with+the+fragile+X.+A+study+of+15+families.">X-linked mental retardation with the fragile X. A study of 15 families.</a> Human Genetics. 59, 281-289 (1981).</li><li>Backes, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cognitive+and+behavioral+profile+of+fragile+X+boys:+correlations+to+molecular+data.">Cognitive and behavioral profile of fragile X boys: correlations to molecular data.</a> American Journal of Medical Genetics. 95, 150-156 (2000).</li><li>Nolin, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+analysis+of+1112+prenatal+samples+from+1991+to+2010.">Fragile X analysis of 1112 prenatal samples from 1991 to 2010.</a> Prenatal Diagnosis. 31, 925-931 (2011).</li><li>Nolin, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+of+the+fragile+X+CGG+repeat+in+females+with+premutation+or+intermediate+alleles.">Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles.</a> American Journal of Human Genetics. 72, 454-464 (2003).</li><li>Fernandez-Carvajal, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+of+an+FMR1+grey-zone+allele+to+a+full+mutation+in+two+generations.">Expansion of an FMR1 grey-zone allele to a full mutation in two generations.</a> Journal of Molecular Diagnostics. 11, 306-310 (2009).</li><li>Terracciano, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+to+full+mutation+of+a+FMR1+intermediate+allele+over+two+generations.">Expansion to full mutation of a FMR1 intermediate allele over two generations.</a> European Journal of Human Genetics. 12, 333-336 (2004).</li><li>Garcia-Arocena, D., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+understanding+the+molecular+basis+of+FXTAS.">Advances in understanding the molecular basis of FXTAS.</a> Human Molecular Genetics. 19, R83-R89 (2010).</li><li>Juncos, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+clinical+findings+in+the+fragile+X-associated+tremor+ataxia+syndrome+(FXTAS).">New clinical findings in the fragile X-associated tremor ataxia syndrome (FXTAS).</a> Neurogenetics. 12, 123-135 (2011).</li><li>Hagerman, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intention+tremor,+parkinsonism,+and+generalized+brain+atrophy+in+male+carriers+of+fragile+X.">Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X.</a> Neurology. 57, 127-130 (2001).</li><li>Conway, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premature+ovarian+failure+and+FMR1+gene+mutations:+an+update.">Premature ovarian failure and FMR1 gene mutations: an update.</a> Annales d'endocrinologie. 71, 215-217 (2010).</li><li>Conway, G. S., Hettiarachchi, S., Murray, A., Jacobs, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+premutations+in+familial+premature+ovarian+failure.">Fragile X premutations in familial premature ovarian failure.</a> Lancet. 346, 309-310 (1995).</li><li>Van Esch, H., Buekenhout, L., Race, V., Matthijs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Very+early+premature+ovarian+failure+in+two+sisters+compound+heterozygous+for+the+FMR1+premutation.">Very early premature ovarian failure in two sisters compound heterozygous for the FMR1 premutation.</a> European Journal of Medical Genetics. 52, 37-40 (2009).</li><li>Bourgeois, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+fragile+X+premutation+disorders:+expanding+the+psychiatric+perspective.">A review of fragile X premutation disorders: expanding the psychiatric perspective.</a> Journal of Clinical Psychiatry. 70, 852-862 (2009).</li><li>Farzin, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autism+spectrum+disorders+and+attention-deficit/hyperactivity+disorder+in+boys+with+the+fragile+X+premutation.">Autism spectrum disorders and attention-deficit/hyperactivity disorder in boys with the fragile X premutation.</a> Journal of Developmental and Behavioral Pediatrics. 27, S137-S144 (2006).</li><li>Hantash, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+premutation+carrier+frequency+in+patients+undergoing+routine+population-based+carrier+screening:+insights+into+the+prevalence+of+fragile+X+syndrome,+fragile+X-associated+tremor/ataxia+syndrome,+and+fragile+X-associated+primary+ovarian+insufficiency+in+the+United+States.">FMR1 premutation carrier frequency in patients undergoing routine population-based carrier screening: insights into the prevalence of fragile X syndrome, fragile X-associated tremor/ataxia syndrome, and fragile X-associated primary ovarian insufficiency in the United States.</a> Genetics in Medicine. 13, 39-45 (2011).</li><li>Kraan, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+allele+size+distribution+in+35,000+males+and+females:+a+comparison+of+developmental+delay+and+general+population+cohorts.">FMR1 allele size distribution in 35,000 males and females: a comparison of developmental delay and general population cohorts.</a> Genetics in Medicine. 20 (12), 1627-1634 (2018).</li><li>Saul, R. A., Tarleton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1-Related+Disorders.">FMR1-Related Disorders.</a> GeneReviews. , (2012).</li><li>Amos Wilson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Consensus+characterization+of+16+FMR1+reference+materials:+a+consortium+study.">Consensus characterization of 16 FMR1 reference materials: a consortium study.</a> Journal of Molecular Diagnostics. 10, 2-12 (2008).</li><li>Kwok, Y. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+a+robust+PCR-based+assay+for+quantifying+fragile+X+CGG+repeats.">Validation of a robust PCR-based assay for quantifying fragile X CGG repeats.</a> Clinica Chimica Acta. 456, 137-143 (2016).</li><li>Rousseau, F., Rouillard, P., Morel, M. L., Khandjian, E. W., Morgan, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+carriers+of+premutation-size+alleles+of+the+FMRI+gene--and+implications+for+the+population+genetics+of+the+fragile+X+syndrome.">Prevalence of carriers of premutation-size alleles of the FMRI gene--and implications for the population genetics of the fragile X syndrome.</a> American Journal of Human Genetics. 57, 1006-1018 (1995).</li><li>Tassone, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+CGG+allele+size+and+prevalence+ascertained+through+newborn+screening+in+the+United+States.">FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States.</a> Genome Medicine. 4, 100 (2012).</li><li>Dombrowski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premutation+and+intermediate-size+FMR1+alleles+in+10572+males+from+the+general+population:+loss+of+an+AGG+interruption+is+a+late+event+in+the+generation+of+fragile+X+syndrome+alleles.">Premutation and intermediate-size FMR1 alleles in 10572 males from the general population: loss of an AGG interruption is a late event in the generation of fragile X syndrome alleles.</a> Human Molecular Genetics. 11, 371-378 (2002).</li><li>Cronister, A., Teicher, J., Rohlfs, E. M., Donnenfeld, A., Hallam, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+and+instability+of+fragile+X+alleles:+implications+for+offering+fragile+X+prenatal+diagnosis.">Prevalence and instability of fragile X alleles: implications for offering fragile X prenatal diagnosis.</a> Obstetrics and Gynecology. 111, 596-601 (2008).</li><li>Hayward, B. E., Kumari, D., Usdin, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+assays+for+the+fragile+X-related+disorders.">Recent advances in assays for the fragile X-related disorders.</a> Human Genetics. 136, 1313-1327 (2017).</li><li>Seltzer, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+CGG+expansions+of+the+FMR1+gene+in+a+US+population-based+sample.">Prevalence of CGG expansions of the FMR1 gene in a US population-based sample.</a> American Journal of Medical Genetics Part B Neuropsychiatrics Genetics. 259B, 589-597 (2012).</li><li>Hayward, B. E., Usdin, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assays+for+determining+repeat+number,+methylation+status,+and+AGG+interruptions+in+the+Fragile+X-related+disorders.">Assays for determining repeat number, methylation status, and AGG interruptions in the Fragile X-related disorders.</a> Methods in Molecular Biology. , 49-59 (1942).</li><li>Orrico, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaicism+for+full+mutation+and+normal-sized+allele+of+the+FMR1+gene:+a+new+case.">Mosaicism for full mutation and normal-sized allele of the FMR1 gene: a new case.</a> American Journal of Medical Genetics. 78, 341-344 (1998).</li><li>Schmucker, B., Seidel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaicism+for+a+full+mutation+and+a+normal+size+allele+in+two+fragile+X+males.">Mosaicism for a full mutation and a normal size allele in two fragile X males.</a> American Journal of Medical Genetics. 84, 221-225 (1999).</li></ol>

The authors have nothing to disclose.

FXS is the second most common cause of intellectual impairment after trisomy 21, accounting for nearly one-half of X-linked mental retardation30, which may affect approximately 1 in 4,000 males and 1 in 8,000 females. More importantly, nearly 1 in 250&#8211;1,000 females carry a premutation, and this frequency is 1 in 250&#8211;1,600 in males26,31,32,33. Since the risk o...

Fragile X syndrome (FXS) and Fragile X associated disorders, e.g., tremor and ataxia syndrome (FX-TAS), and primary ovarian insufficiency (FX-POI) are mainly caused by cytosine-guanine-guanine (CGG) trinucleotide repeat expansion in the 5&#8217; untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene on Xq27.31,2. The FMR1 encoded protein (FMRP) is a polyribosome-associated RNA-binding protein that functions in neuronal development and synaptic plasticity by regulating alternative splicing, stability, and dendritic transport of mRNA or modulating synthesis of partial postsynaptic proteins3,4,5,6,7.
The dynamic variation with a CGG repeat size of &#62;200 is described as full mutation, which induces the aberrant hypermethylation and subsequent transcriptional silencing of the FMR1 promoter8. The resulting absence or lack of the FMRP protein disrupts normal neuronal development and causes FXS9, characterized by various clinical symptoms, including moderate to severe intellectual disability, developmental delay, hyperactive behaviors, poor contacts and autistic manifestations10,11,12. The presentation in female FXS patients is generally milder than that in males. The CGG repeat size ranging from 55 to 200 and 45 to 54 are classified as premutation and intermediate status, respectively. Due to the high degree of instability, the CGG repeat size in a premutation or intermediate allele presumably expands when transmitted from parents to offspring13,14. Thus, carriers with premutation alleles are at high risk of having children affected with FXS because of the repeat expansion, and in some cases, intermediate alleles can expand their repeat size to the full mutation range over two generations15,16. Furthermore, males with premutation also convey increased risk of developing late-onset FX-TAS17,18,19, while premutation females are predisposed for both FX-TAS and FX-POI20,21,22. Recently, it has been reported that autistic spectrum disorders with developmental delay and problems in social behaviors are presented in children with premutation FMR1 alleles23,24.
To determine the exact CGG repeat size is of great significance for classification and prediction of the FXS and Fragile X-associated disorders25,26. Historically, the CGG repeat region-specific polymerase chain reaction (PCR) with fragment sizing plus Southern blot analysis have been the gold standard for molecular profiling of the FMR1 CGG repeat27. However, traditional specific PCR is less sensitive to large premutations with more than 100 to 130 repeats and is incapable of amplifying full mutations27,28. Furthermore, capillary electrophoresis on a traditional genetic analyzer for repeat sizing fails to detect FMR1 PCR products with more than 200 CGG repeats. The Southern blot analysis enables differentiation of a wider range of repeat size, from normal to full mutation repeat numbers, and has been widely used for confirming full mutations (in males) and differentiating heterozygous alleles with a full mutation from apparently homozygous alleles with normal repeat sizes (in females). However, the resolution for quantifying the repeats is limited. More importantly, this step-by-step testing strategy is labor-intensive, time-consuming, and cost-ineffective.
Here, we present an accurate and robust PCR-based method for quantification of the CGG repeats of FMR1. The first step of this test is PCR amplification of the repeat sequences in the 5&#8217;UTR of the FMR1 promoter using Fragile X PCR kit. The PCR products are purified and fragment sizing is performed on a microfluidic capillary electrophoresis instrument, and subsequent interpretation of the number of CGG repeats using the analysis software by referencing standards with known repeats based on the rationale that PCR fragment length is directly proportional to the number of CGG repeats. The PCR system include reagents that facilitate the amplification of the highly GC-rich trinucleotide repeat region. This PCR-based assay is reproducible and capable of identifying all ranges of CGG repeats of FMR1 promoters. This is a cost-effective method that can find wide application in molecular diagnosis and screening of FXS and Fragile X-related disorders with less turn-around time and investment in equipment and thus, can be utilized in a broader spectrum of clinical laboratories.

<table>
	<tbody>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes</td>
			<td>Axygen</td>
			<td>PCR-02D-C</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free</td>
			<td>Ambion</td>
			<td>AM9849</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument</td>
			<td>Agilent</td>
			<td>G2939AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate</td>
			<td>Thermo Fisher</td>
			<td>AB0800</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Electrode cartridge</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: IKA vortex mixer</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Test chips</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit</td>
			<td>Agilent</td>
			<td>5067-1506</td>
			<td>For Fragment sizing</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA 7500 Markers (green cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA chips</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Electrode Cleaner</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Spin Filter</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Syringe</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Chip priming station</td>
			<td>Agilent</td>
			<td>5065-4401</td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Cubee Mini-centrifuge</td>
			<td>GeneReach</td>
			<td>aqbd-i</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold</td>
			<td>Merck Millipore</td>
			<td>MSVMHTS00</td>
			<td>Vacuum instrument for Filter plate vacuum Manifold for PCR product purification</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Silicone stopper</td>
			<td>Merck Millipore</td>
			<td>XX2004718</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Vacuum pump</td>
			<td>Merck Millipore</td>
			<td>WP6122050</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Waste collection vessel</td>
			<td>Merck Millipore</td>
			<td>XX1004705</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>FragilEase Fragile X PCR kit</td>
			<td>PerkinElmer</td>
			<td>3101-0010</td>
			<td>For PCR amplification</td>
		</tr>
		<tr>
			<td>FragilEase Fragile X PCR kit: Sample Diluent</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )</td>
		</tr>
		<tr>
			<td>FragilEase PCR Buffer mix</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward) 
			FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse)</td>
		</tr>
		<tr>
			<td>FragilEase Polymerase</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )</td>
		</tr>
		<tr>
			<td>FraXsoft analysis software</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 Spectrophotometer</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Paper towels</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PCR clean up plate: NucleoFast 96 PCR plate</td>
			<td>MACHEREY-NAGEL</td>
			<td>743100</td>
			<td></td>
		</tr>
		<tr>
			<td>reference DNA sample</td>
			<td>Coriell</td>
			<td>NA20240 &#38; NA20239</td>
			<td></td>
		</tr>
		<tr>
			<td>S1000 96-well Thermal Cycler</td>
			<td>Bio-Rad</td>
			<td>1852196</td>
			<td>This can be replaced by other Thermal Cyclers (eg. Veriti&#8482; 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786)</td>
		</tr>
		<tr>
			<td>TriNEST Incubator/Shaker instrument</td>
			<td>PerkinElmer</td>
			<td>1296-0050</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure DNase/RNase-Free Distilled Water</td>
			<td>Life Technologies</td>
			<td>10977015</td>
			<td>For 2100 Bioanalyzer electrode cleaning</td>
		</tr>
		<tr>
			<td>Vortex-Genie 2</td>
			<td>Scientific Industries</td>
			<td>SI-0256 (Model G560E)</td>
			<td>Conventional vortex mixer</td>
		</tr>
	</tbody>
</table>

a robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in fragile x mental retardation-1 gene

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5&#8217; untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene promoter. Conventionally, capillary electrophoresis fragment analysis on a genetic analyzer is used for the sizing of the CGG repeats of FMR1, but additional Southern blot analysis is required for exact measurement when the repeat number is higher than 200. Here, we present an accurate and robust polymerase chain reaction (PCR)-based method for quantification of the CGG repeats of FMR1. The first step of this test is PCR amplification of the repeat sequences in the 5&#8217;UTR of the FMR1 promoter using a Fragile X PCR kit, followed by purification of the PCR products and fragment sizing on a microfluidic capillary electrophoresis instrument, and subsequent interpretation of the number of CGG repeats by referencing standards with known repeats using the analysis software. This PCR-based assay is reproducible and capable of identifying the full range of CGG repeats of FMR1 promoters, including those with a repeat number of more than 200 (classified as full mutation), 55 to 200 (premutation), 46 to 54 (intermediate), and 10 to 45 (normal). It is a cost-effective method that facilitates classification of the FXS and Fragile X-associated disorders with robustness and rapid reporting time.

The sizing results of the premutation female reference sample (NA20240, repeat sizes of 30 and 80) and the full mutation female reference sample (NA20239, repeat sizes of 20 and 200) are shown in Figure 1A and Figure 1B, respectively. Typically, two marker peaks (lower marker 50 base pairs [bp] and upper marker 10,380 bp) are included in the fragment size profile. There is usually a primer complex peak with a size of nearly 95 bp. Through the reference sample, a...

Watch this Scientific Journal Video about A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene at JoVE.c

A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene

An accurate and robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in the Fragile X mental retardation-1 gene facilitates molecular diagnosis and screening of Fragile X syndrome and Fragile X-related disorders with shorter turn-around time and investment in equipment.

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5&#8217; ...

a-robust-polymerase-chain-reaction-based-assay-for-quantifying

Research

JoVE Journal

Genetics

7.8K Views.  Jinan University. An accurate and robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in the Fragile X mental retardation-1 gene facilitates molecular diagnosis and screening of Fragile X syndrome and Fragile X-related disorders with shorter turn-around time and investment in equipment.

Video: A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene

Improved Polymerase Chain Reaction-restriction Fragment Length Polymorphism Genotyping of Toxic Pufferfish by Liquid Chromatography/Mass Spectrometry

An improved version of a polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method for genotyping toxic pufferfish species by liquid chromatography/electrospray ionization mass spectrometry (LC/ESI-MS) is described. DNA extraction is carried out using a silica membrane-based DNA extraction kit. After the PCR amplification using a detergent-free PCR buffer, restriction enzymes are added to the solution without purifying the reaction solution. A reverse-phase silica monolith column and a Fourier transform high resolution mass spectrometer having a modified Kingdon trap analyzer are employed for separation and detection, respectively. The mobile phase, consisting of 400 mM 1,1,1,3,3,3-hexafluoro-2-propanol, 15 mM triethylamine (pH 7.9) and methanol, is delivered at a flow rate of 0.4 ml/min. The cycle time for LC/ESI-MS analysis is 8 min including equilibration of the column. Deconvolution software having an isotope distribution model of the oligonucleotide is used to calculate the corresponding monoisotopic mass from the mass spectrum. For analysis of oligonucleotides (range 26-79 nucleotides), mass accuracy was 0.62 &#177; 0.74 ppm (n = 280) and excellent accuracy and precision were sustained for 180 hr without use of a lock mass standard.

An improved polymerase chain reaction-restriction fragment length polymorphism method for genotyping pufferfish species by liquid chromatography/mass spectrometry is described. A reverse-phase silica monolith column is employed for separating digested amplicons. This method can elucidate the monoisotopic masses of oligonucleotides, which is useful for identifying base composition.

An improved version of a polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method for genotyping toxic pufferfish species by ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

This article demonstrates a detailed protocol for DNA isolation and high-throughput sequencing library construction from herbarium material including rescue of exceptionally poor-quality DNA.

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

CRISPR-Mediated Reorganization of Chromatin Loop Structure

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene expression, but whether looping is responsible for or a result of alterations in gene expression is still unknown. Until recently, how chromatin looping affects the regulation of gene activity and cellular function has been relatively ambiguous, and limitations in existing methods to manipulate these structures prevented in-depth exploration of these interactions. To resolve this uncertainty, we engineered a method for selective and reversible chromatin loop re-organization using CRISPR-dCas9 (CLOuD9). The dynamism of the CLOuD9 system has been demonstrated by successful localization of CLOuD9 constructs to target genomic loci to modulate local chromatin conformation. Importantly, the ability to reverse the induced contact and restore the endogenous chromatin conformation has also been confirmed. Modulation of gene expression with this method establishes the capacity to regulate cellular gene expression and underscores the great potential for applications of this technology in creating stable de novo chromatin loops that markedly affect gene expression in the contexts of cancer and development.

Chromatin looping plays a significant role in gene regulation; however, there have been no technological advances that allow for selective and reversible modification of chromatin loops. Here we describe a powerful system for chromatin loop re-organization using CRISPR-dCas9 (CLOuD9), demonstrated to selectively and reversibly modulate gene expression at targeted loci.

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene ...

Candidate Gene Testing in Clinical Cohort Studies with Multiplexed Genotyping and Mass Spectrometry

Complex diseases are often underpinned by multiple common genetic variants that contribute to disease susceptibility. Here, we describe a cost-effective tag single nucleotide polymorphism (SNP) approach using a multiplexed genotyping assay with mass spectrometry, to investigate gene pathway associations in clinical cohorts. We investigate the food allergy candidate locus Interleukin13 (IL13) as an example. This method efficiently maximizes the coverage by taking advantage of shared linkage disequilibrium (LD) within a region. Selected LD SNPs are then designed into a multiplexed assay, enabling up to 40 different SNPs to be analyzed simultaneously, boosting cost-effectiveness. Polymerase chain reaction (PCR) is used to amplify the target loci, followed by single nucleotide extension, and the amplicons are then measured using matrix-assisted laser desorption/ionization-time of flight(MALDI-TOF) mass spectrometry. The raw output is analyzed with the genotype calling software, using stringent quality control definitions and cut-offs, and high probability genotypes are determined and output for data analysis.

Identification of genetic variants contributing to complex human disease allows us to identify novel mechanisms. Here, we demonstrate a multiplex genotyping approach to candidate genes or gene pathway analysis that maximizes the coverage at low cost and is amenable to cohort-based studies.

Complex diseases are often underpinned by multiple common genetic variants that contribute to disease susceptibility. Here, we describe a cost-effective ...

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Identification of Homologous Recombination Events in Mouse Embryonic Stem Cells Using Southern Blotting and Polymerase Chain Reaction

Relative to the issues of off-target effects and the difficulty of inserting a long DNA fragment in the application of designer nucleases for genome editing, embryonic stem (ES) cell-based gene-targeting technology does not have these shortcomings and is widely used to modify animal/mouse genome ranging from large deletions/insertions to single nucleotide substitutions. Notably, identifying the relatively few homologous recombination (HR) events necessary to obtain desired ES clones is a key step, which demands accurate and reliable methods. Southern blotting and/or conventional PCR are often utilized for this purpose. Here, we describe the detailed procedures of using those two methods to identify HR events that occurred in mouse ES cells in which the endogenous Myh9 gene is intended to be disrupted and replaced by cDNAs encoding other nonmuscle myosin heavy chain IIs (NMHC IIs). The whole procedure of Southern blotting includes the construction of targeting vector(s), electroporation, drug selection, the expansion and storage of ES cells/clones, the preparation, digestion, and blotting of genomic DNA (gDNA), the hybridization and washing of probe(s), and a final step of autoradiography on the X-ray films. PCR can be performed directly with prepared and diluted gDNA. To obtain ideal results, the probes and restriction enzyme (RE) cutting sites for Southern blotting and the primers for PCR should be carefully planned. Though the execution of Southern blotting is time-consuming and labor-intensive and PCR results have false positives, the correct identification by Southern blotting and the rapid screening by PCR allow the sole or combined application of these methods described in this paper to be widely used and consulted by most labs in the identification of genotypes of ES cells and genetically modified animals.

Here, we present a detailed protocol for identifying homologous recombination events that occurred in mouse embryonic stem cells using Southern blotting and/or PCR. This method is exemplified by the generation of nonmuscle myosin II genetic replacement mouse models using traditional embryonic stem cell-based homologous recombination-mediated targeting technology.

Relative to the issues of off-target effects and the difficulty of inserting a long DNA fragment in the application of designer nucleases for genome ...

Manipulation of Gene Function in Mexican Cavefish

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, including eye degeneration, albinism, sleep loss, hyperphagia, and sensory processing. Species of cavefish from around the world display a convergent evolution of morphological and behavioral traits due to shared environmental pressures between different cave systems. Diverse cave species have been studied in the laboratory setting. The Mexican tetra, Astyanax mexicanus, with sighted and blind forms, has provided unique insights into biological and molecular processes underlying the evolution of complex traits and is well-poised as an emerging model system. While candidate genes regulating the evolution of diverse biological processes have been identified in A. mexicanus, the ability to validate a role for individual genes has been limited. The application of transgenesis and gene-editing technology has the potential to overcome this significant impediment and to investigate the mechanisms underlying the evolution of complex traits. Here, we describe a different methodology for manipulating gene expression in A. mexicanus. Approaches include the use of morpholinos, Tol2 transgenesis, and gene-editing systems, commonly used in zebrafish and other fish models, to manipulate gene function in A. mexicanus. These protocols include detailed descriptions of timed breeding procedures, the collection of fertilized eggs, injections, and the selection of genetically modified animals. These methodological approaches will allow for the investigation of the genetic and neural mechanisms underlying the evolution of diverse traits in A. mexicanus.&#160;

We describe approaches for the manipulation of genes in the evolutionary model system Astyanax mexicanus. Three different techniques are described: Tol2-mediated transgenesis, targeted manipulation of the genome using CRISPR/Cas9, and knockdown of expression using morpholinos. These tools should facilitate the direct investigation of genes underlying the variation between surface- and cave-dwelling forms.

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for reversible and tunable expression control of an endogenous gene of interest in living model systems. The REMOTE-control system employs enhanced lac repression and tet activation systems to achieve down- or upregulation of a target gene within a single biological system. Tight repression can be achieved from repressor binding sites flexibly located far downstream of a transcription start site by inhibiting transcription elongation. Robust upregulation can be attained by enhancing the transcription of an endogenous gene by targeting tet transcriptional activators to the cognate promoter. This reversible and tunable expression control can be applied and withdrawn repeatedly in organisms. The potency and versatility of the system, as demonstrated for endogenous Dnmt1 here, will allow more precise in vivo functional analyses by enabling investigation of gene function at various expression levels and by testing the reversibility of a phenotype.

This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription polymerase chain reaction (nested RT-PCR) was developed to detect the conserved region of the nucleoprotein (N) gene of lyssaviruses. The method applies reverse transcription (RT) using viral RNA as template and oligo (dT)15 and random hexamers as primers to synthesize the viral complementary DNA (cDNA). Then, the viral cDNA is used as a template to amplify an 845 bp N gene fragment in first-round PCR using outer primers, followed by second-round nested PCR to amplify the final 371 bp fragment using inner primers. This method can detect different genetic clades of rabies viruses (RABV). The validation, using 9,624 brain specimens from eight domestic animal species in 10 years of clinical rabies diagnoses and surveillance in China, showed that the method has 100% sensitivity and 99.97% specificity in comparison with the direct fluorescent antibody test (FAT), the gold standard method recommended by the World Health Organization (WHO) and the World Organization for Animal Health (OIE). In addition, the method could also specifically amplify the targeted N gene fragment of 15 other approved and two novel lyssavirus species in the 10th Report of the International Committee on Taxonomy of Viruses (ICTV) as evaluated by a mimic detection of synthesized N gene plasmids of all lyssaviruses. The method provides a convenient alternative to FAT for rabies diagnosis and has been approved as a National Standard (GB/T36789-2018) of China.

A pan-lyssavirus nested reverse transcription polymerase chain reaction has been developed to detect specifically all known lyssaviruses. Validation using rabies brain samples of different animal species showed that this method has a sensitivity and specificity equivalent to the gold standard fluorescent antibody test and could be used for routine rabies diagnosis.

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription ...