This research was supported by grants from NSFC Emergency Management Project (Grant No. 81741004), the National Natural Science Foundation of China (Grant No. 81860272), the Major Research Plan of the Provincial Science and Technology Foundation of Guangxi (Grant No. AB16380219), the China Postdoctoral Science Foundation Grant (Grant No. 2018M630993), and the Guangxi Natural Science Foundation (Grant No. 2018GXNSFAA281067).

Ethical approval was granted by the Joint Chinese University of Hong Kong&#8213;New Territories East Cluster Clinical Research Ethics Committee (Reference Number: 2013.055)
1. PCR amplification
<ol>
	<li>Prior to starting, remove PCR buffer mix, sample diluent and DNA samples (both test and reference DNA) (see the Table of Materials) from the -20 &#176;C freezer and keep them at room temperature for 20&#8211;30 min to make sure all reagents and DNA are fully thawed. Vortex a...

<ol>
	<li>Verkerk, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+gene+(FMR-1)+containing+a+CGG+repeat+coincident+with+a+breakpoint+cluster+region+exhibiting+length+variation+in+fragile+X+syndrome.">Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome.</a> Cell. 65, 905-914 (1991).</li><li>Fu, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variation+of+the+CGG+repeat+at+the+fragile+X+site+results+in+genetic+instability:+resolution+of+the+Sherman+paradox.">Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox.</a> Cell. 67, 1047-1058 (1991).</li><li>Antar, L. N., Li, C., Zhang, H., Carroll, R. C., Bassell, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local+functions+for+FMRP+in+axon+growth+cone+motility+and+activity-dependent+regulation+of+filopodia+and+spine+synapses.">Local functions for FMRP in axon growth cone motility and activity-dependent regulation of filopodia and spine synapses.</a> Molecular and Cellular Neurosciences. 32, 37-48 (2006).</li><li>Didiot, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+G-quartet+containing+FMRP+binding+site+in+FMR1+mRNA+is+a+potent+exonic+splicing+enhancer.">The G-quartet containing FMRP binding site in FMR1 mRNA is a potent exonic splicing enhancer.</a> Nucleic Acids Research. 36, 4902-4912 (2008).</li><li>Bechara, E. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+function+for+fragile+X+mental+retardation+protein+in+translational+activation.">A novel function for fragile X mental retardation protein in translational activation.</a> PLoS Biology. 7, e16 (2009).</li><li>Ascano, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMRP+targets+distinct+mRNA+sequence+elements+to+regulate+protein+expression.">FMRP targets distinct mRNA sequence elements to regulate protein expression.</a> Nature. 492, 382-386 (2012).</li><li>Kenny, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MOV10+and+FMRP+regulate+AGO2+association+with+microRNA+recognition+elements.">MOV10 and FMRP regulate AGO2 association with microRNA recognition elements.</a> Cell Reports. 9, 1729-1741 (2014).</li><li>Oberle, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Instability+of+a+550-base+pair+DNA+segment+and+abnormal+methylation+in+fragile+X+syndrome.">Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome.</a> Science. 252, 1097-1102 (1991).</li><li>Hagerman, R., Lauterborn, J., Au, J., Berry-Kravis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+syndrome+and+targeted+treatment+trials.">Fragile X syndrome and targeted treatment trials.</a> Results and Problems in Cell Differentiation. 54, 297-335 (2012).</li><li>Hatton, D. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autistic+behavior+in+children+with+fragile+X+syndrome:+prevalence,+stability,+and+the+impact+of+FMRP.">Autistic behavior in children with fragile X syndrome: prevalence, stability, and the impact of FMRP.</a> American Journal of Medical Genetics Part A. 140A, 1804-1813 (2006).</li><li>Mattei, J. F., Mattei, M. G., Aumeras, C., Auger, M., Giraud, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-linked+mental+retardation+with+the+fragile+X.+A+study+of+15+families.">X-linked mental retardation with the fragile X. A study of 15 families.</a> Human Genetics. 59, 281-289 (1981).</li><li>Backes, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cognitive+and+behavioral+profile+of+fragile+X+boys:+correlations+to+molecular+data.">Cognitive and behavioral profile of fragile X boys: correlations to molecular data.</a> American Journal of Medical Genetics. 95, 150-156 (2000).</li><li>Nolin, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+analysis+of+1112+prenatal+samples+from+1991+to+2010.">Fragile X analysis of 1112 prenatal samples from 1991 to 2010.</a> Prenatal Diagnosis. 31, 925-931 (2011).</li><li>Nolin, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+of+the+fragile+X+CGG+repeat+in+females+with+premutation+or+intermediate+alleles.">Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles.</a> American Journal of Human Genetics. 72, 454-464 (2003).</li><li>Fernandez-Carvajal, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+of+an+FMR1+grey-zone+allele+to+a+full+mutation+in+two+generations.">Expansion of an FMR1 grey-zone allele to a full mutation in two generations.</a> Journal of Molecular Diagnostics. 11, 306-310 (2009).</li><li>Terracciano, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expansion+to+full+mutation+of+a+FMR1+intermediate+allele+over+two+generations.">Expansion to full mutation of a FMR1 intermediate allele over two generations.</a> European Journal of Human Genetics. 12, 333-336 (2004).</li><li>Garcia-Arocena, D., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+understanding+the+molecular+basis+of+FXTAS.">Advances in understanding the molecular basis of FXTAS.</a> Human Molecular Genetics. 19, R83-R89 (2010).</li><li>Juncos, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+clinical+findings+in+the+fragile+X-associated+tremor+ataxia+syndrome+(FXTAS).">New clinical findings in the fragile X-associated tremor ataxia syndrome (FXTAS).</a> Neurogenetics. 12, 123-135 (2011).</li><li>Hagerman, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intention+tremor,+parkinsonism,+and+generalized+brain+atrophy+in+male+carriers+of+fragile+X.">Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X.</a> Neurology. 57, 127-130 (2001).</li><li>Conway, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premature+ovarian+failure+and+FMR1+gene+mutations:+an+update.">Premature ovarian failure and FMR1 gene mutations: an update.</a> Annales d'endocrinologie. 71, 215-217 (2010).</li><li>Conway, G. S., Hettiarachchi, S., Murray, A., Jacobs, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fragile+X+premutations+in+familial+premature+ovarian+failure.">Fragile X premutations in familial premature ovarian failure.</a> Lancet. 346, 309-310 (1995).</li><li>Van Esch, H., Buekenhout, L., Race, V., Matthijs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Very+early+premature+ovarian+failure+in+two+sisters+compound+heterozygous+for+the+FMR1+premutation.">Very early premature ovarian failure in two sisters compound heterozygous for the FMR1 premutation.</a> European Journal of Medical Genetics. 52, 37-40 (2009).</li><li>Bourgeois, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+fragile+X+premutation+disorders:+expanding+the+psychiatric+perspective.">A review of fragile X premutation disorders: expanding the psychiatric perspective.</a> Journal of Clinical Psychiatry. 70, 852-862 (2009).</li><li>Farzin, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autism+spectrum+disorders+and+attention-deficit/hyperactivity+disorder+in+boys+with+the+fragile+X+premutation.">Autism spectrum disorders and attention-deficit/hyperactivity disorder in boys with the fragile X premutation.</a> Journal of Developmental and Behavioral Pediatrics. 27, S137-S144 (2006).</li><li>Hantash, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+premutation+carrier+frequency+in+patients+undergoing+routine+population-based+carrier+screening:+insights+into+the+prevalence+of+fragile+X+syndrome,+fragile+X-associated+tremor/ataxia+syndrome,+and+fragile+X-associated+primary+ovarian+insufficiency+in+the+United+States.">FMR1 premutation carrier frequency in patients undergoing routine population-based carrier screening: insights into the prevalence of fragile X syndrome, fragile X-associated tremor/ataxia syndrome, and fragile X-associated primary ovarian insufficiency in the United States.</a> Genetics in Medicine. 13, 39-45 (2011).</li><li>Kraan, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+allele+size+distribution+in+35,000+males+and+females:+a+comparison+of+developmental+delay+and+general+population+cohorts.">FMR1 allele size distribution in 35,000 males and females: a comparison of developmental delay and general population cohorts.</a> Genetics in Medicine. 20 (12), 1627-1634 (2018).</li><li>Saul, R. A., Tarleton, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1-Related+Disorders.">FMR1-Related Disorders.</a> GeneReviews. , (2012).</li><li>Amos Wilson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Consensus+characterization+of+16+FMR1+reference+materials:+a+consortium+study.">Consensus characterization of 16 FMR1 reference materials: a consortium study.</a> Journal of Molecular Diagnostics. 10, 2-12 (2008).</li><li>Kwok, Y. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+a+robust+PCR-based+assay+for+quantifying+fragile+X+CGG+repeats.">Validation of a robust PCR-based assay for quantifying fragile X CGG repeats.</a> Clinica Chimica Acta. 456, 137-143 (2016).</li><li>Rousseau, F., Rouillard, P., Morel, M. L., Khandjian, E. W., Morgan, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+carriers+of+premutation-size+alleles+of+the+FMRI+gene--and+implications+for+the+population+genetics+of+the+fragile+X+syndrome.">Prevalence of carriers of premutation-size alleles of the FMRI gene--and implications for the population genetics of the fragile X syndrome.</a> American Journal of Human Genetics. 57, 1006-1018 (1995).</li><li>Tassone, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMR1+CGG+allele+size+and+prevalence+ascertained+through+newborn+screening+in+the+United+States.">FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States.</a> Genome Medicine. 4, 100 (2012).</li><li>Dombrowski, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premutation+and+intermediate-size+FMR1+alleles+in+10572+males+from+the+general+population:+loss+of+an+AGG+interruption+is+a+late+event+in+the+generation+of+fragile+X+syndrome+alleles.">Premutation and intermediate-size FMR1 alleles in 10572 males from the general population: loss of an AGG interruption is a late event in the generation of fragile X syndrome alleles.</a> Human Molecular Genetics. 11, 371-378 (2002).</li><li>Cronister, A., Teicher, J., Rohlfs, E. M., Donnenfeld, A., Hallam, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+and+instability+of+fragile+X+alleles:+implications+for+offering+fragile+X+prenatal+diagnosis.">Prevalence and instability of fragile X alleles: implications for offering fragile X prenatal diagnosis.</a> Obstetrics and Gynecology. 111, 596-601 (2008).</li><li>Hayward, B. E., Kumari, D., Usdin, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+assays+for+the+fragile+X-related+disorders.">Recent advances in assays for the fragile X-related disorders.</a> Human Genetics. 136, 1313-1327 (2017).</li><li>Seltzer, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevalence+of+CGG+expansions+of+the+FMR1+gene+in+a+US+population-based+sample.">Prevalence of CGG expansions of the FMR1 gene in a US population-based sample.</a> American Journal of Medical Genetics Part B Neuropsychiatrics Genetics. 259B, 589-597 (2012).</li><li>Hayward, B. E., Usdin, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assays+for+determining+repeat+number,+methylation+status,+and+AGG+interruptions+in+the+Fragile+X-related+disorders.">Assays for determining repeat number, methylation status, and AGG interruptions in the Fragile X-related disorders.</a> Methods in Molecular Biology. , 49-59 (1942).</li><li>Orrico, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaicism+for+full+mutation+and+normal-sized+allele+of+the+FMR1+gene:+a+new+case.">Mosaicism for full mutation and normal-sized allele of the FMR1 gene: a new case.</a> American Journal of Medical Genetics. 78, 341-344 (1998).</li><li>Schmucker, B., Seidel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosaicism+for+a+full+mutation+and+a+normal+size+allele+in+two+fragile+X+males.">Mosaicism for a full mutation and a normal size allele in two fragile X males.</a> American Journal of Medical Genetics. 84, 221-225 (1999).</li></ol>

The authors have nothing to disclose.

FXS is the second most common cause of intellectual impairment after trisomy 21, accounting for nearly one-half of X-linked mental retardation30, which may affect approximately 1 in 4,000 males and 1 in 8,000 females. More importantly, nearly 1 in 250&#8211;1,000 females carry a premutation, and this frequency is 1 in 250&#8211;1,600 in males26,31,32,33. Since the risk o...

Fragile X syndrome (FXS) and Fragile X associated disorders, e.g., tremor and ataxia syndrome (FX-TAS), and primary ovarian insufficiency (FX-POI) are mainly caused by cytosine-guanine-guanine (CGG) trinucleotide repeat expansion in the 5&#8217; untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene on Xq27.31,2. The FMR1 encoded protein (FMRP) is a polyribosome-associated RNA-binding protein that functions in neuronal development and synaptic plasticity by regulating alternative splicing, stability, and dendritic transport of mRNA or modulating synthesis of partial postsynaptic proteins3,4,5,6,7.
The dynamic variation with a CGG repeat size of &#62;200 is described as full mutation, which induces the aberrant hypermethylation and subsequent transcriptional silencing of the FMR1 promoter8. The resulting absence or lack of the FMRP protein disrupts normal neuronal development and causes FXS9, characterized by various clinical symptoms, including moderate to severe intellectual disability, developmental delay, hyperactive behaviors, poor contacts and autistic manifestations10,11,12. The presentation in female FXS patients is generally milder than that in males. The CGG repeat size ranging from 55 to 200 and 45 to 54 are classified as premutation and intermediate status, respectively. Due to the high degree of instability, the CGG repeat size in a premutation or intermediate allele presumably expands when transmitted from parents to offspring13,14. Thus, carriers with premutation alleles are at high risk of having children affected with FXS because of the repeat expansion, and in some cases, intermediate alleles can expand their repeat size to the full mutation range over two generations15,16. Furthermore, males with premutation also convey increased risk of developing late-onset FX-TAS17,18,19, while premutation females are predisposed for both FX-TAS and FX-POI20,21,22. Recently, it has been reported that autistic spectrum disorders with developmental delay and problems in social behaviors are presented in children with premutation FMR1 alleles23,24.
To determine the exact CGG repeat size is of great significance for classification and prediction of the FXS and Fragile X-associated disorders25,26. Historically, the CGG repeat region-specific polymerase chain reaction (PCR) with fragment sizing plus Southern blot analysis have been the gold standard for molecular profiling of the FMR1 CGG repeat27. However, traditional specific PCR is less sensitive to large premutations with more than 100 to 130 repeats and is incapable of amplifying full mutations27,28. Furthermore, capillary electrophoresis on a traditional genetic analyzer for repeat sizing fails to detect FMR1 PCR products with more than 200 CGG repeats. The Southern blot analysis enables differentiation of a wider range of repeat size, from normal to full mutation repeat numbers, and has been widely used for confirming full mutations (in males) and differentiating heterozygous alleles with a full mutation from apparently homozygous alleles with normal repeat sizes (in females). However, the resolution for quantifying the repeats is limited. More importantly, this step-by-step testing strategy is labor-intensive, time-consuming, and cost-ineffective.
Here, we present an accurate and robust PCR-based method for quantification of the CGG repeats of FMR1. The first step of this test is PCR amplification of the repeat sequences in the 5&#8217;UTR of the FMR1 promoter using Fragile X PCR kit. The PCR products are purified and fragment sizing is performed on a microfluidic capillary electrophoresis instrument, and subsequent interpretation of the number of CGG repeats using the analysis software by referencing standards with known repeats based on the rationale that PCR fragment length is directly proportional to the number of CGG repeats. The PCR system include reagents that facilitate the amplification of the highly GC-rich trinucleotide repeat region. This PCR-based assay is reproducible and capable of identifying all ranges of CGG repeats of FMR1 promoters. This is a cost-effective method that can find wide application in molecular diagnosis and screening of FXS and Fragile X-related disorders with less turn-around time and investment in equipment and thus, can be utilized in a broader spectrum of clinical laboratories.

<table>
	<tbody>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes</td>
			<td>Axygen</td>
			<td>PCR-02D-C</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free</td>
			<td>Ambion</td>
			<td>AM9849</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument</td>
			<td>Agilent</td>
			<td>G2939AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate</td>
			<td>Thermo Fisher</td>
			<td>AB0800</td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Electrode cartridge</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: IKA vortex mixer</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent 2100 Bioanalyzer instrument: Test chips</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit</td>
			<td>Agilent</td>
			<td>5067-1506</td>
			<td>For Fragment sizing</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA 7500 Markers (green cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA chips</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap)</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Electrode Cleaner</td>
			<td>Agilent</td>
			<td></td>
			<td>In kit: Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Spin Filter</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Agilent DNA 7500 kit: Syringe</td>
			<td>Agilent</td>
			<td></td>
			<td>Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506)</td>
		</tr>
		<tr>
			<td>Chip priming station</td>
			<td>Agilent</td>
			<td>5065-4401</td>
			<td>Supplies equipment of the 2100 Bioanayzer instrument</td>
		</tr>
		<tr>
			<td>Cubee Mini-centrifuge</td>
			<td>GeneReach</td>
			<td>aqbd-i</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold</td>
			<td>Merck Millipore</td>
			<td>MSVMHTS00</td>
			<td>Vacuum instrument for Filter plate vacuum Manifold for PCR product purification</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Silicone stopper</td>
			<td>Merck Millipore</td>
			<td>XX2004718</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Vacuum pump</td>
			<td>Merck Millipore</td>
			<td>WP6122050</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>Filter plate vacuum Manifold: Waste collection vessel</td>
			<td>Merck Millipore</td>
			<td>XX1004705</td>
			<td>Filter plate vacuum Manifold</td>
		</tr>
		<tr>
			<td>FragilEase Fragile X PCR kit</td>
			<td>PerkinElmer</td>
			<td>3101-0010</td>
			<td>For PCR amplification</td>
		</tr>
		<tr>
			<td>FragilEase Fragile X PCR kit: Sample Diluent</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )</td>
		</tr>
		<tr>
			<td>FragilEase PCR Buffer mix</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward) 
			FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse)</td>
		</tr>
		<tr>
			<td>FragilEase Polymerase</td>
			<td>PerkinElmer</td>
			<td></td>
			<td>In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 )</td>
		</tr>
		<tr>
			<td>FraXsoft analysis software</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 Spectrophotometer</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Paper towels</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PCR clean up plate: NucleoFast 96 PCR plate</td>
			<td>MACHEREY-NAGEL</td>
			<td>743100</td>
			<td></td>
		</tr>
		<tr>
			<td>reference DNA sample</td>
			<td>Coriell</td>
			<td>NA20240 &#38; NA20239</td>
			<td></td>
		</tr>
		<tr>
			<td>S1000 96-well Thermal Cycler</td>
			<td>Bio-Rad</td>
			<td>1852196</td>
			<td>This can be replaced by other Thermal Cyclers (eg. Veriti&#8482; 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786)</td>
		</tr>
		<tr>
			<td>TriNEST Incubator/Shaker instrument</td>
			<td>PerkinElmer</td>
			<td>1296-0050</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure DNase/RNase-Free Distilled Water</td>
			<td>Life Technologies</td>
			<td>10977015</td>
			<td>For 2100 Bioanalyzer electrode cleaning</td>
		</tr>
		<tr>
			<td>Vortex-Genie 2</td>
			<td>Scientific Industries</td>
			<td>SI-0256 (Model G560E)</td>
			<td>Conventional vortex mixer</td>
		</tr>
	</tbody>
</table>

a robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in fragile x mental retardation-1 gene

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5&#8217; untranslated region (UTR) of the Fragile X mental retardation-1 (FMR1) gene promoter. Conventionally, capillary electrophoresis fragment analysis on a genetic analyzer is used for the sizing of the CGG repeats of FMR1, but additional Southern blot analysis is required for exact measurement when the repeat number is higher than 200. Here, we present an accurate and robust polymerase chain reaction (PCR)-based method for quantification of the CGG repeats of FMR1. The first step of this test is PCR amplification of the repeat sequences in the 5&#8217;UTR of the FMR1 promoter using a Fragile X PCR kit, followed by purification of the PCR products and fragment sizing on a microfluidic capillary electrophoresis instrument, and subsequent interpretation of the number of CGG repeats by referencing standards with known repeats using the analysis software. This PCR-based assay is reproducible and capable of identifying the full range of CGG repeats of FMR1 promoters, including those with a repeat number of more than 200 (classified as full mutation), 55 to 200 (premutation), 46 to 54 (intermediate), and 10 to 45 (normal). It is a cost-effective method that facilitates classification of the FXS and Fragile X-associated disorders with robustness and rapid reporting time.

The sizing results of the premutation female reference sample (NA20240, repeat sizes of 30 and 80) and the full mutation female reference sample (NA20239, repeat sizes of 20 and 200) are shown in Figure 1A and Figure 1B, respectively. Typically, two marker peaks (lower marker 50 base pairs [bp] and upper marker 10,380 bp) are included in the fragment size profile. There is usually a primer complex peak with a size of nearly 95 bp. Through the reference sample, a...

Watch this Scientific Journal Video about A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene at JoVE.c

A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene

An accurate and robust polymerase chain reaction-based assay for quantifying cytosine-guanine-guanine trinucleotide repeats in the Fragile X mental retardation-1 gene facilitates molecular diagnosis and screening of Fragile X syndrome and Fragile X-related disorders with shorter turn-around time and investment in equipment.

Fragile X syndrome (FXS) and associated disorders are caused by expansion of the cytosine-guanine-guanine (CGG) trinucleotide repeat in the 5&#8217; ...

This cost-effective method can find wide applications in molecular diagnosis and screening of FXS and Fragile X-related disorders. It's fast in turnaround time and less investment in equipment. Our PCR-based assay can facilitate classification of full spectrum of the FXS and Fragile X-associated disorders, including intermediate, premutation, and full mutation with robustness and rapid reporting time.The procedure will be demonstrated by Weng Chua from PerkinElmer Singapore. Start by removing the PCR buffer mix, sample diluent, and DNA samples from the 20 degree Celsius freezer, and leaving them at room temperature for 20 to 30 minutes to thaw. Prior to using the reagents, vortex and briefly spin them down.Measure the DNA sample concentration with a spectrophotometer, and if required, dilute it to 25 nanograms per microliter with sample diluent. Label the wells of a PCR plate to identify reference and tested DNA samples and calculate the number of reactions needed for the test, reference, and negative control samples. Prepare the PCR master mix by combining 15 microliters of PCR buffer mix to 0.6 microliters of sample diluent and 0.4 microliters of polymerase for each reaction.Vortex the mix and spin it down. Then dispense 18 microliters of the mixture into each well. Then pipette two microliters of each DNA into the appropriate well.Mix the reagents by pipetting up and down five times, then seal the plate. Place the plate in the thermocycler and run the PCR according to the manuscript directions. Preheat the incubator shaker to 65 degrees Celsius and add 80 microliters of 1X TE buffer to each PCR product.Use a multichannel pipette to transfer the samples to a PCR cleanup plate and put the plate in the shaker. Incubate it at 65 degrees Celsius while shaking at 1200 RPM for 10 minutes. After the incubation, cool the incubator shaker down to 25 degrees Celsius, set the vacuum instrument to 250 millibar, and aspirate the solution through the filter.After 15 minutes, the wells should have no liquid remaining. Turn off the vacuum and add 50 microliters of 1X TE buffer to each well. Aspirate the solution for 10 minutes using the previous vacuum settings.Dry the bottom of the filter plate by pressing it firmly on a stack of paper towels and then add 20 microliters of 1X TE buffer to the bottom center of each well. Place the plate in the shaker and incubate at 25 degrees Celsius while shaking at 1200 RPM for five minutes. After the incubation, transfer at least 15 microliters of the purified PCR product to a fresh 96 well PCR plate.Prior to starting, bring the DNA dye concentrate, DNA gel matrix, DNA marker, DNA ladder, and purified DNA samples to room temperature. Set up the priming station by replacing the syringe and adjusting the base plate, then release the lever of the syringe clip and slide it to the top position. Start the sizing software and prepare the gel dye mix.Vortex the dye concentrate for 10 seconds, then spin it down. Then, add 25 microliters of the dye to a gel matrix vial and vortex the solution to mix. Transfer the gel dye mix to a spin filter, place it in the centrifuge, and spin it for 10 minutes at 1500 times g.When ready to load the gel dye mix, insert a new DNA chip into the priming station and add nine microliters of the gel dye mix into the well that is marked with G.Close the priming station and ensure that the plunger is positioned at the one milliliter mark. Press the syringe plunger down until it is held by the clip. Wait for exactly 30 seconds, and then release the clip.Wait for five more seconds, and then slowly pull the plunger back to the one milliliter position. Open the priming station and add nine microliters of gel dye mix into the wells marked with G.Add five microliters of marker into the well marked with a ladder symbol and each of the 12 sample wells. Add one microliter of the ladder to the well with the ladder symbol and one microliter of the PCR product or water to the sample wells.Vortex the chip for one minute at 2400 RPM. Insert it into the bioanalyzer and run the chip within five minutes. When the run is complete, export the peak data as csv table files.A premutation female sample and a full mutation female sample are used as reference samples. An upper and lower marker peak are included in the fragment size profile, and there is usually a primer complex peak at about 95 base pairs. These reference samples are used to construct a regression standard curve.The linear regression standard curve is then used to calculate repeat sizes of unknown samples. Clinical normal, intermediate, premutation, full mutation, and mosaic full mutation samples can be correctly classified with this method. In some cases, only one peak is displayed in the microfluidic electrophoresis results, which is likely due to the presence of normal homozygous alleles.One type of suboptimal result is baseline bias, which can be ambiguous or uninterpretable, and is suspected to be caused by instrument malfunction. When attempting this procedure, it is important to ensure appropriate amount of DNA and quality before starting the protocol. FMR1 gene sequencing can be performed to identify the AGG interruption pattern.And methylation-sensitive restriction enzyme or bisulfide modification assay can be used to monitor the methylation status. This is a fast, robust, and cost-effective technique. It will assist other researchers in conducting a population-based study on the carrier status of FXS and Fragile X-associated disorders.

a-robust-polymerase-chain-reaction-based-assay-for-quantifying

Research

JoVE Journal

Genetics

7.7K visualizações.  Jinan University. Este método econômico pode encontrar amplas aplicações no diagnóstico molecular e triagem de fxs e distúrbios frágeis relacionados ao X. É rápido em tempo de reviravolta e menos investimento em equipamentos. Nosso ensaio baseado em PCR pode facilitar a classificação de espectro completo dos transtornos associados ao FXS e frágeis x, incluindo intermediário, premutação e mutação completa com robustez e tempo de relatório rápido.O procedimento será demonstrado por Wen...

Vídeo: A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene