C.U. acknowledges funding from Siam Commercial Bank under VISTEC-Siriraj Frontier Research Center, and from Thailand Science Research and Innovation (TSRI), fundamental fund, fiscal year 2024,&#160;grant number FRB670026/0457. R.K. and M.P. are supported by studentship and research assistantship funds from VISTEC, respectively.

1. Preparation of lyophilized RT-RPA premixed reagents
<ol>
	<li>Equipment preparation
	<ol>
		<li>Prepare a liquid nitrogen dewar or tray for flash-freezing of reactions. Fill the dewar or tray with liquid nitrogen.</li>
		<li>Freeze dryer
		<ol>
			<li>Check for condensed water in draining tubes and the chamber interior; remove the water if needed.</li>
			<li>Clean the chamber interior and the 1.5 mL microcentrifuge tube metal rack with RNase decontamination solution, followed by 70% ethanol.</li>
	...

Optimized CRISPR-Based Molecular Diagnostics Protocol for Point-of-Care Use

<ol>
	<li>Gootenberg, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleic+acid+detection+with+CRISPR-Cas13a/C2c2.">Nucleic acid detection with CRISPR-Cas13a/C2c2.</a> Science. 356 (6336), 438-442 (2017).</li><li>Kaminski, M. M., Abudayyeh, O. O., Gootenberg, J. S., Zhang, F., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-based+diagnostics.">CRISPR-based diagnostics.</a> Nat Biomed Eng. 5 (7), 643-656 (2021).</li><li>Makarova, K. S., Koonin, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotation+and+classification+of+CRISPR-Cas+systems.">Annotation and classification of CRISPR-Cas systems.</a> Methods Mol Biol. (1311), 47-75 (2015).</li><li>Chen, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas12a+target+binding+unleashes+indiscriminate+single-stranded+DNase+activity.">CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity.</a> Science. 360 (6387), 436-439 (2018).</li><li>Arizti-Sanz, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simplified+Cas13-based+assays+for+the+fast+identification+of+SARS-CoV-2+and+its+variants.">Simplified Cas13-based assays for the fast identification of SARS-CoV-2 and its variants.</a> Nat Biomed Eng. 6 (8), 932-943 (2022).</li><li>Broughton, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas12-based+detection+of+SARS-CoV-2.">CRISPR-Cas12-based detection of SARS-CoV-2.</a> Nat Biotechnol. 38 (7), 870-874 (2020).</li><li>Patchsung, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multiplexed+Cas13-based+assay+with+point-of-care+attributes+for+simultaneous+COVID-19+diagnosis+and+variant+surveillance.">A multiplexed Cas13-based assay with point-of-care attributes for simultaneous COVID-19 diagnosis and variant surveillance.</a> CRISPR J. 6 (2), 99-115 (2023).</li><li>Patchsung, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+validation+of+a+Cas13-based+assay+for+the+detection+of+SARS-CoV-2+RNA.">Clinical validation of a Cas13-based assay for the detection of SARS-CoV-2 RNA.</a> Nat Biomed Eng. 4 (12), 1140-1149 (2020).</li><li>Gootenberg, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+and+portable+nucleic+acid+detection+platform+with+Cas13,+Cas12a,+and+Csm6.">Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6.</a> Science. 360 (6387), 439-444 (2018).</li><li>Lee, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+CRISPR-based+diagnostic+for+field-applicable+detection+of+Plasmodium+species+in+symptomatic+and+asymptomatic+malaria.">Ultrasensitive CRISPR-based diagnostic for field-applicable detection of Plasmodium species in symptomatic and asymptomatic malaria.</a> Proc Natl Acad Sci U S A. 117 (41), 25722-25731 (2020).</li><li>Myhrvold, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Field-deployable+viral+diagnostics+using+CRISPR-Cas13.">Field-deployable viral diagnostics using CRISPR-Cas13.</a> Science. 360 (6387), 444-448 (2018).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Versatile+detection+with+CRISPR/Cas+system+from+applications+to+challenges.">Versatile detection with CRISPR/Cas system from applications to challenges.</a> Trends Analyt Chem. 135, 116150 (2021).</li><li>Yao, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas13a-based+detection+for+bovine+viral+diarrhea+virus.">CRISPR-Cas13a-based detection for bovine viral diarrhea virus.</a> Front Vet Sci. 8, 603919 (2021).</li><li>Kellner, M. J., Koob, J. G., Gootenberg, J. S., Abudayyeh, O. O., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SHERLOCK:+nucleic+acid+detection+with+CRISPR+nucleases.">SHERLOCK: nucleic acid detection with CRISPR nucleases.</a> Nat Protoc. 14 (10), 2986-3012 (2019).</li><li>Selvam, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-LAMP+CRISPR-Cas12/13-based+SARS-CoV-2+detection+methods.">RT-LAMP CRISPR-Cas12/13-based SARS-CoV-2 detection methods.</a> Diagnostics (Basel). 11 (9), 1646 (2021).</li><li>Carter, C., Akrami, K., Hall, D., Smith, D., Aronoff-Spencer, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lyophilized+visually+readable+loop-mediated+isothermal+reverse+transcriptase+nucleic+acid+amplification+test+for+detection+Ebola+Zaire+RNA.">Lyophilized visually readable loop-mediated isothermal reverse transcriptase nucleic acid amplification test for detection Ebola Zaire RNA.</a> J Virol Methods. 244, 32-38 (2017).</li><li>Bhardwaj, P., Kant, R., Behera, S. P., Dwivedi, G. R., Singh, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+diagnostic+with+CRISPR/Cas:+Beyond+nucleic+acid+detection.">Next-generation diagnostic with CRISPR/Cas: Beyond nucleic acid detection.</a> Int J Mol Sci. 23 (11), 6052 (2022).</li><li>Twistamp. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Twistamp&#174; assay design manual. , (2023).</li><li>Qian, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+isothermal+amplification+assay+for+viral+detection.">An enhanced isothermal amplification assay for viral detection.</a> Nat Commun. 11 (1), 5920 (2020).</li><li>Ghouneimy, A., Mahas, A., Marsic, T., Aman, R., Mahfouz, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-based+diagnostics:+Challenges+and+toward+point-of-care+applications.">CRISPR-based diagnostics: Challenges and toward point-of-care applications.</a> ACSSynth Biol. 12 (1), 1-16 (2023).</li><li>Jones, K. L., Drane, D., Gowans, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+storage+of+DNA-free+RNA+for+use+in+vaccine+studies.">Long-term storage of DNA-free RNA for use in vaccine studies.</a> Biotechniques. 43 (5), 675-681 (2007).</li><li>Fang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+strand-displacement+DNA+amplification+by+a+contactless+electrochemical+microsystem+using+interdigitated+electrodes.">Real-time monitoring of strand-displacement DNA amplification by a contactless electrochemical microsystem using interdigitated electrodes.</a> Lab Chip. 12 (17), 3190-3196 (2012).</li><li>Mok, E., Wee, E., Wang, Y., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+evaluation+of+molecular+enhancers+of+the+isothermal+exponential+amplification+reaction.">Comprehensive evaluation of molecular enhancers of the isothermal exponential amplification reaction.</a> Sci Rep. 6 (1), 37837 (2016).</li><li>Wan, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+test+kit+for+visual+loop-mediated+isothermal+amplification+of+Salmonella+in+spiked+ready-to-eat+fruits+and+vegetables.">Development of a test kit for visual loop-mediated isothermal amplification of Salmonella in spiked ready-to-eat fruits and vegetables.</a> J Microbiol Methods. 169, 105830 (2020).</li><li>Curti, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+a+lyophilized+CRISPR-Cas12+assay+for+a+ensitive,+specific,+and+rapid+detection+of+SARS-CoV-2.">Evaluation of a lyophilized CRISPR-Cas12 assay for a ensitive, specific, and rapid detection of SARS-CoV-2.</a> Viruses. 13 (3), 420 (2021).</li><li>Joung, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+SARS-CoV-2+with+SHERLOCK+one-pot+testing.">Detection of SARS-CoV-2 with SHERLOCK one-pot testing.</a> N Engl J Med. 383 (15), 1492-1494 (2020).</li></ol>

M.P. and C.U. have filed a patent in Thailand on the formulations for multiplexed detection of SARS-CoV-2 RNA. R.K. declares no competing interests.

There are critical steps in this protocol. For area segregation, it is recommended to use separate spaces for nucleic acid extraction, mastermix preparation (pre amplification area), sample addition, and amplicon detection (post amplification area). Each area should be set by using a separate set of tools and equipment. Do not bring tools from one area into another area, especially from the post amplification area into the pre amplification area. Cleaning of working areas is necessary: one should clean working areas, pip...

CRISPR-based diagnostics for the detection of nucleic acid biomarkers was first reported in 20171,2,3,4, and since then, has been proven as next-generation diagnostics with Food and Drug Administration (FDA)-approved tests, particularly for the detection of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) RNA, in multiple countries5,6,7,8. Beyond coronavirus disease 2019 (COVID-19), the technologies have been demonstrated as effective for detecting diverse viruses and bacteria9,10,11,12,13, genetic disease mutations and deletions, and can be engineered to detect protein and small molecule biomarkers2,12. CRISPR-based diagnostics often combine isothermal amplification methods-such as recombinase polymerase amplification (RPA) or loop-mediated isothermal amplification (LAMP)14,15-with CRISPR-based detection using RNA-guided CRISPR-associated (Cas) enzymes with &#34;collateral&#34; endonuclease activity after target recognition3. The dual use of isothermal amplification and CRISPR-based detection confers several desirable attributes to the technologies, particularly high diagnostic accuracy approaching that of the gold-standard polymerase chain reaction (PCR), and capability to multiplex and detect small sequence differences, including single-nucleotide polymorphisms1,9.
The most accurate versions of CRISPR-based diagnostics, however, contain multiple components and steps and can be complicated to perform with non-experts or at the point of care (POC). To address this challenge of extending the use of highly accurate CRISPR-based diagnostics to POC settings, we have developed protocols to prepare premixed, lyophilized, recombinase-based isothermal amplification and CRISPR-based detection reactions, which are easy to use and store7. These protocols should complement existing excellent protocols on CRISPR-based diagnostics14, which contain additional information on the production of biochemical components needed for CRISPR-based diagnostics7, design guidelines1, and formulations using alternative isothermal amplification techniques2,14,15,16 and Cas enzymes12. Ultimately, we hope that CRISPR-based diagnostics can help realize rapid, inexpensive, and sensitive nucleic detection in settings where portable and instrumental-free analyses are required1,9,17.
We primarily use the combination of RPA and Cas13-based detection in our protocols. RPA functions at near-ambient temperatures (37-42 &#176;C), and therefore, has low energy and equipment requirements. Other isothermal amplification reactions require higher temperatures (LAMP, 60-65 &#176;C; strand-displacement amplification (SDA), 60 &#176;C; exponential amplification reaction (EXPAR), 55 &#176;C; and helicase-dependent amplification (HDA), 65 &#176;C)2. The design of RPA primers is also not complex, unlike LAMP primers, and can be extended to multiplexed amplification7,9,14. Even though multiplexing beyond two targets with RPA is difficult in practice, there are clear guidelines on how to design multiplexed RPA primers to minimize interference18.
While carryover contamination remains a big issue in the two-step workflow, the generated amplicons of RPA are small in size and less likely to cause carryover contamination compared to large concatemeric amplicons from LAMP14. RPA primers can be designed according to standard guidelines14: they are generally 25-35 nucleotide-long with melting temperatures of 54 to 67 &#176;C. The amplicon size should be smaller than 200 base pairs. The reverse transcriptase enzyme (RT) can be added to RPA to enable amplification from RNA, and in reverse transcription-RPA (RT-RPA), another enzyme Ribonuclease H (RNase H) is typically added in small amounts to help resolve the resulting RNA: DNA hybrid and promote the amplification reaction5,19. To allow T7 transcription for Cas13-based detection, the T7 RNA polymerase promoter can be placed at the 5&#39; end of the forward RPA primer.
After amplicons are generated from RPA, they can be detected with crRNA-programmed Cas enzymes. Among various Cas enzymes that can be used for amplicon detection, we prefer RNA-targeting Cas13 variants due to their high cleavage activity1 and well-characterized polynucleotide cleavage preferences7,9, the latter of which can be used for multiplexed detection. The crRNA sequence for Cas13 is designed to be complementary (reverse complement) to the target site in the produced RNA with spacer and direct repeat (DR) sequences. The crRNA sequence and RPA primers should not overlap, to avoid undesired Cas-based detection of off-target amplification products, which increases background and false positives14.
Cas-based detection relies on different detection modalities to monitor the cleavage of reporter nucleic acid molecules (RNA reporters for Cas13-based reactions)1,2,14. Different detection modalities include colorimetry, electrochemical readouts, fluorescence, sequencing readouts, and lateral flow strips2. We focus on the fluorescence readout given a variety of fluorophores and reporters such as cyanine 5 (Cy5), rhodamine X (ROX), and carboxyfluorescein (FAM), which can be effectively excited using a single blue LED light source, and their fluorescence analyzed by a microplate reader or a real-time thermal cycler7,14. In addition, fluorescence readout is easy to set up and allows continuous monitoring, which enables real-time quantitation. Multiplexed RPA preamplification and multiplexed Cas13-based detection using Cas enzymes can be combined with multicolor fluorescence readouts for the simultaneous detection of multiple genetic targets2,7.
In our protocols, we first isothermally amplify RNA with RT-RPA by adding the RNA sample to the lyophilized form of the RT-RPA reagent (Figure 1). During RT-RPA, the T7 promoter is added to the generated double-stranded DNA amplicon. Thereafter, the RPA products are transferred to the lyophilized Cas13-based detection, which also contains T7 RNA polymerase. This detection reaction will convert DNA amplicons into RNA (via T7 RNA polymerase), which can be readily detected with crRNA-programmed Cas13. Target-activated Cas13 will cleave reporter molecules to produce detectable fluorescence signal2,7,14. While the protocols here pertain to detection by Leptotrichia wadei (LwaCas13a), they can be extended to simultaneous, multiplexed detection of up to four targets using orthogonal Cas13 and Cas12 enzymes7,9. RPA and Cas-based detection reactions can also be combined into a single tube, albeit at a loss of sensitivity14.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/66703/66703fig01v2.jpg" /> 
Figure 1: CRISPR-based detection workflow. The workflow illustrates the detection of two target genes. First, regions of interest within the DNA target are isothermally amplified with RPA; the reaction can be performed with reverse transcription (RT-RPA) when detecting RNA targets. Thereafter, T7 transcription converts dsDNA amplicons to RNAs, which in turn are recognized by Cas13-crRNA complexes capable of eliciting collateral RNase activity upon target binding. Cleavage of quenched fluorescence reporters produces fluorescence signals that can be monitored using a microplate reader, visualized by an LED transilluminator, or used with a real-time thermal cycler. Abbreviations: CRISPR = Clustered Regularly Interspaced Short Palindromic Repeats; RT = reverse transcription; RPA = recombinase polymerase amplification; Cas = CRISPR-associated protein; LED = light-emitting diode. <a href="https://www.jove.com/files/ftp_upload/66703/66703fig01largev2.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
The key features of the protocols presented here are the premixing formulations for lyophilization. Premixing simplifies the reaction use and enhances reproducibility, but many components within RPA and Cas-based detection-particularly reverse transcription and some labile cofactors such as ATP are not stable in solution. Therefore, we formulate the premixed solutions such that they can be freeze-dried for long-term storage and easy transport and deployment1,9,20. Premixed, freeze-dried reagents also help improve the detection sensitivity, as higher sample volume (and therefore, higher DNA/RNA input) can be added to reconstitute the reaction10. In our formulations, we primarily use trehalose21 as the cryoprotectant in lyophilized RPA and Cas-based detection reactions7. In addition to reagent preservation, trehalose also promotes the reactions via increasing enzyme stabilization16,22,23,24 and decreasing melting temperatures of dsDNA23. Explorations of other stabilizers5,7,21,25,26 beyond trehalose may yield even more optimal formulations for different use scenarios.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Material</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Betaine solution</td>
			<td>Sigma-Aldrich</td>
			<td>B0300-1VL</td>
			<td></td>
		</tr>
		<tr>
			<td>DEPC-Treated water</td>
			<td>Invitrogen</td>
			<td>AM9915G</td>
			<td></td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>Merck</td>
			<td>3870-25GM</td>
			<td></td>
		</tr>
		<tr>
			<td>EpiScript reverse transcriptase</td>
			<td>Lucigen</td>
			<td>ERT12925K</td>
			<td></td>
		</tr>
		<tr>
			<td>Gly-Gly-Gly&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>SIA-50239-1G</td>
			<td></td>
		</tr>
		<tr>
			<td>LwaCas13a</td>
			<td>Producing in-house</td>
			<td></td>
			<td>Strain name:Leptotrichia wadei, Abbreviation: Lwa, Protein name: LwaCas13a</td>
		</tr>
		<tr>
			<td>Magnesium chloride solution, 1M</td>
			<td>Sigma-Aldrich</td>
			<td>M1028-10X1ML</td>
			<td></td>
		</tr>
		<tr>
			<td>NxGenT7 RNA polymerase</td>
			<td>Lucigen</td>
			<td>30223-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Poly(ethylene glycol)</td>
			<td>Sigma-Aldrich</td>
			<td>81300-1KG</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium acetate solution, 5M</td>
			<td>Sigma-Aldrich</td>
			<td>95843-100ML-F</td>
			<td></td>
		</tr>
		<tr>
			<td>Riobnucleotide Solution Mix</td>
			<td>NEB</td>
			<td>N0466L</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase H</td>
			<td>NEB</td>
			<td>M0297L</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>TCI</td>
			<td>TCI-S0111-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>Trehalose Dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>SIA-90210-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>Trizma hydrochloride solution, 1M, pH 7.4</td>
			<td>Sigma-Aldrich</td>
			<td>T2194-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>TwistAmp Basic kit</td>
			<td>TwistDx</td>
			<td>TABAS03KIT</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BluPAD Dual LED Blue/White light transilluminator</td>
			<td>Bio-Helix</td>
			<td>BP001CU</td>
			<td></td>
		</tr>
		<tr>
			<td>Dry Bath Dual Block</td>
			<td>ELITE</td>
			<td>4-2-EL-02-220</td>
			<td>Model: EL-02</td>
		</tr>
		<tr>
			<td>Fluorescence microplate reader</td>
			<td>Tecan</td>
			<td>30050303</td>
			<td>Model: Infinite 200 Pro</td>
		</tr>
		<tr>
			<td>Freeze dryer</td>
			<td>LABCONCO</td>
			<td>794001030</td>
			<td>FreeZone Triad Benchtop Freeze Dryer</td>
		</tr>
		<tr>
			<td>Microplate 384-well</td>
			<td>Greiner</td>
			<td>GDE0784076</td>
			<td>F-Bottom, small volume, Hibase, Med. Binding, Black</td>
		</tr>
		<tr>
			<td>Real-time thermal cycler (CFX Connect Real-Time PCR System)</td>
			<td>Bio-Rad</td>
			<td>185-5201</td>
			<td>Model: CFX Connect Optics Module</td>
		</tr>
		<tr>
			<td>Oligonucleotide</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>s-gene forward RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>GAAATTAATACGACTCAC 
			TATAGGGAGGTTTCAAAC 
			TTTACTTGCTTTACATAGA</td>
		</tr>
		<tr>
			<td>s-gene reverse RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>TCCTAGGTTGAAGA 
			TAACCCACATAATAAG</td>
		</tr>
		<tr>
			<td>n-gene forward RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>GAAATTAATACGACTC 
			ACTATAGGAACTTCTC 
			CTGCTAGAATGGCTG</td>
		</tr>
		<tr>
			<td>n-gene reverse RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>CAGACATTTTGCTCTC 
			AAGCTGGTTCAATC</td>
		</tr>
		<tr>
			<td>LwaCas13a-crRNA for the s gene</td>
			<td>Synthego</td>
			<td></td>
			<td>GAUUUAGACUACCCCAAAAAC 
			GAAGGGGACUAAAACGCAGCA 
			CCAGCUGUCCAACCUGAAGAAG</td>
		</tr>
		<tr>
			<td>LwaCas13a-crRNA for the n gene</td>
			<td>Synthego</td>
			<td></td>
			<td>GAUUUAGACUACCCCAAAAACG 
			AAGGGGACUAAAACAAAGCAAG 
			AGCAGCAUCACCGCCAUUGC</td>
		</tr>
		<tr>
			<td>FAM-polyU-IABkFQ reporter</td>
			<td>IDT</td>
			<td></td>
			<td>56-FAM/rUrUrUrUrU/3IABkFQ</td>
		</tr>
		<tr>
			<td>O-hannah_cytb_F RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>GAAATTAATACGACTCACTA 
			TAGGGTACGGATGAACCATA 
			CAAAACCTTCACGCAATCG</td>
		</tr>
		<tr>
			<td>O-hannah_cytb_R RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>AAGATCCATAGTAGATTC 
			CTCGTGCGATGTGGATA</td>
		</tr>
		<tr>
			<td>synT7crRNA13a_ O_hannah&#160;</td>
			<td>IDT</td>
			<td></td>
			<td>GCGCATCCATATTCTTCAT 
			CTGCATTTAGTTTTAGTCC 
			CCTTCGTTTTTGGGGTA 
			GTCTAAATCCCCTATAGT 
			GAGTCGTATTAATTTC</td>
		</tr>
	</tbody>
</table>

point-of-care crispr-based diagnostics with premixed and freeze-dried reagents

Molecular diagnostics by Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based detection have high diagnostic accuracy and attributes that are suitable for use at point-of-care settings such as fast turnaround times for results, convenient simple readouts, and no requirement of complicated instruments. However, the reactions can be cumbersome to perform at the point of care due to their many components and manual handling steps. Herein, we provide a step-by-step, optimized protocol for the robust detection of disease pathogens and genetic markers with recombinase-based isothermal amplification and CRISPR-based reagents, which are premixed and then freeze-dried in easily stored and ready-to-use formats. Premixed, freeze-dried reagents can be rehydrated for immediate use and retain high amplification and detection efficiencies. We also provide a troubleshooting guide for commonly found problems upon preparing and using premixed, freeze-dried reagents for CRISPR-based diagnostics, to make the detection platform more accessible to the wider diagnostic/genetic testing communities.

Author Spotlight: Development of Simplified CRISPR-Based Tests for Rapid Detection of Infectious Diseases

Point-of-care CRISPR-based Diagnostics with Premixed and Freeze-dried Reagents

We developing point-of-care test to detecting these material of infectious diseases. This test use isothermal nucleic acid amplification and CRISPR-based detection. With highly osmotic accuracy similar to PCR, they can detect small sequence differences including single nucleotide polymorphism and can be multiples.CRISPR, the osmotic reactions contain multiple components and steps and are difficult to perform at the point of care. As CRISPR-based, the osmotics are highly sensitive, there is a risk of carryover contamination which can lead to false results. Fortunately, this problem can be mitigated if we simplify the procedures of the reactions.We offer an easy to use method to detect our disease pathogens and genetics markers using recombinase isothermal amplification and CRISPR-based reagents. These reagents are simple to store and use. We also offer tips to fix common issues when using these methods and reagents, making it easier for people to use them.The protocol here uses CRISPR reagents, which facilitate the transportation and storage. The freeze-dried reagents can easily be rehydrated at the points of use and retain high amplification and detection efficiencies. We hope to apply CRISPR diagnostic technologies to detect endemic and emerging infectious disease.If this test can be routinely and correctly performed at the point of care, that could inform antiviral and antibiotic treatment options, potentially save lives, reduce drug overuse, and the development of resistance.

We highlight the kinetics of FAM fluorescence signal generation from the combined detection of s and n genes of SARS-CoV-2, and how the information was used to determine optimal conditions for lyophilized, premixed reaction formulations. In all cases, we included samples with Ct values well within the determined detection limit (LoD) (Ct ~31-33), as well as those with Ct at the LoD (Ct ~35-37)7, to allow differentiation of protocols wit...

Here, we present the step-by-step preparation of premixed, lyophilized recombinase-based isothermal amplification and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based reactions, which can be used for the detection of nucleic acid biomarkers of infectious disease pathogens or other genetic markers of interest.

Molecular diagnostics by Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based detection have high diagnostic accuracy and attributes ...

point-care-crispr-based-diagnostics-with-premixed-freeze-dried

Research

JoVE Journal

Bioengineering

456 Views.  Vidyasirimedhi Institute of Science and Technology (VISTEC). We developing point-of-care test to detecting these material of infectious diseases. This test use isothermal nucleic acid amplification and CRISPR-based detection. With highly osmotic accuracy similar to PCR, they can detect small sequence differences including single nucleotide polymorphism and can be multiples.CRISPR, the osmotic reactions contain multiple components and steps and are difficult to perform at the point of care. As CRISPR-based, the osmotics are highly sensitive, ther...