C.U. acknowledges funding from Siam Commercial Bank under VISTEC-Siriraj Frontier Research Center, and from Thailand Science Research and Innovation (TSRI), fundamental fund, fiscal year 2024,&#160;grant number FRB670026/0457. R.K. and M.P. are supported by studentship and research assistantship funds from VISTEC, respectively.

1. Preparation of lyophilized RT-RPA premixed reagents
<ol>
	<li>Equipment preparation
	<ol>
		<li>Prepare a liquid nitrogen dewar or tray for flash-freezing of reactions. Fill the dewar or tray with liquid nitrogen.</li>
		<li>Freeze dryer
		<ol>
			<li>Check for condensed water in draining tubes and the chamber interior; remove the water if needed.</li>
			<li>Clean the chamber interior and the 1.5 mL microcentrifuge tube metal rack with RNase decontamination solution, followed by 70% ethanol.</li>
			<li>Close the chamber door and the vacuum release valve.</li>
			<li>Turn on the freeze dryer.</li>
			<li>Manually set the shelf temperature to -30 &#176;C.</li>
		</ol>
		</li>
		<li>Molecular biology equipment
		<ol>
			<li>Clean the following with RNase decontamination solution: pipettes, pipette tip racks, a vortex mixer, a spin-down minicentrifuge, and a permanent marker.</li>
			<li>Clean the following with tap water, then wipe with cleaning wipe paper: plastic racks for microcentrifuge tubes and a foam box for ice.</li>
			<li>Prepare a heating block (used for dissolving/resolubilizing the triglycine solution) by cleaning it with RNase decontamination solution and 70% ethanol. Then, turn it on and set the temperature to 60 &#176;C.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Preparation of premixed RPA reactions 
	NOTE: This formulation is for 10 reactions (using three RPA pellets).
	<ol>
		<li>Check whether there is any precipitate in the triglycine solution before use. If there are precipitates, dissolve these by incubating at 60 &#176;C and mixing thoroughly before use. Cool the triglycine solution down before adding other heat-sensitive reagents. 
		NOTE: Precipitates can form easily if the tube is left at room temperature for a prolonged period.</li>
		<li>Remove three RPA pellet strip tubes from the freezer; tap the strip tubes by knocking them gently against the lab bench to dislodge the white pellets.</li>
		<li>Transfer all three pellets into a 1.5 mL microcentrifuge tube A.</li>
		<li>Pipette 25 &#181;L of nuclease-free water to rinse any remaining RPA powder in the strip tubes and transfer the rinse solution to a new 1.5 mL microcentrifuge tube B.</li>
		<li>Add 10 &#181;L of the 0.57 M triglycine solution and 10 &#181;L of primer mix (10 &#181;M each) to the mastermix tube B.</li>
		<li>Vortex-mix tube B; then spin down and place the tube on ice.</li>
		<li>Add 28.4 &#181;L of the 5x RPA buffer (prepared from 500 &#181;L of 50% (w/v) PEG20000, 250 &#181;L of 1 M Tris pH 7.4, and 100 &#181;L of 100 mM dithiothreitol (DTT)) to the mastermix tube B and mix thoroughly by strong tapping or shaking multiple times. 
		NOTE: We make the solution in this manner to help dilute/decrease the viscosity of PEG in the mastermix tube, prior to adding everything to solubilize RPA pellets.</li>
		<li>Transfer pellets collected in tube A from Step 1.2.3 into the mastermix tube B and then invert the mastermix tube several times to mix. Observe whether the solution appears homogeneous and monophasic (it will also look slightly opaque) and then, place the tube on ice. 
		NOTE: If mixing is not thorough, PEG can cause the solution/suspension to phase-separate.</li>
		<li>Add 0.71 &#181;L of 200 Unit/&#181;L RT and 2.84 &#181;L of 5 Unit/&#181;L RNase H to the mastermix tube. Gently tap or invert the mastermix tube up and down many times. Spin down and place the tube on ice. 
		NOTE: We add these enzymes after heavy mixing of earlier steps since RT and RNase H are sensitive to shear due to mixing; no more vortexing after RT/RNase H addition.</li>
		<li>Aliquot 8.4 &#181;L of the mastermix solution to 10 precooled 1.5 mL tubes and place the tubes on ice. To do this, plunge the pipette tip into the mastermix solution and draw the mastermix solution into the tip slowly and steadily to prevent air bubbles from forming and to ensure accurate volume measurement. Dispense the mastermix solution into a precooled 1.5 ml tube. 
		NOTE: With 8.4 &#181;L aliquoted, in our experience, there will be ~1-2 &#181;L suspension left in the mastermix tube. The experimenter can adjust the aliquoting volume down slightly to ensure enough reagents for all 10 reactions. Use proper pipetting techniques when handling viscous solutions.</li>
		<li>After aliquoting is completed, place the tubes in a metal rack submerged in liquid nitrogen to prepare them for lyophilization. Allow the tubes to be submerged in liquid nitrogen for 5 min. 
		NOTE: As lyophilization removes excess solution, it allows us to add more DNA/RNA input, which helps increase sensitivity. Freeze-dried premixed RPA reactions can be stored at -20 &#176;C for 8 months. Lyophilization helps with reproducibility if a given experiment is performed using RPA mastermixes prepared in the same batch, so making a larger batch also helps.</li>
	</ol>
	</li>
	<li>Lyophilization
	<ol>
		<li>At the freeze dryer, check collector and shelf temperatures. If necessary, wait until the collector temperature reaches -75 &#177; 5 &#176;C and the shelf temperature reaches -30 &#177; 1 &#176;C.</li>
		<li>Cover open tubes in the metal rack with a sheet of cleaning wipe paper, place the metal rack along with the open tubes in the freeze dryer shelf, and close the shelf door.</li>
		<li>Select the program shown in Table 1 and press start. After 30 min of the secondary drying step (20 &#176;C, &#60;0.1 mbar; temperature is held infinitely by setting the time of the step to &#34;infinite&#34;), press stop the program. 
		NOTE: We let the tubes warm up in the freeze dryer to prevent water condensation.</li>
		<li>Release the pressure by opening the vacuum release valve, then remove the rack from the shelf. Cap the tubes immediately and store the lyophilized reactions at -20 &#176;C. 
		NOTE: Lyophilized RPA and CRISPR-Cas13a premixed reactions can be stored at -20 &#176;C for 8 months.</li>
	</ol>
	</li>
</ol>
2. Preparation of lyophilized CRISPR-Cas13a premixed detection reagents
NOTE: Follow step 1.1 for equipment preparation.
<ol>
	<li>CRISPR-Cas13a premixed reaction preparation (10 reactions)
	<ol>
		<li>Remove the following items from storage and place them on ice: 10 &#181;L of LwaCas13a (produced in-house7,8,14) (2 mg/mL), Cas storage buffer, 10 ng/&#181;L (225 nM) crRNA, 25 mM rNTP, 50 Unit/&#181;L T7 RNA polymerase, 2&#160;&#181;M of FAM fluorescence reporter.</li>
		<li>Prepare a working solution of LwaCas13a at 126 &#181;g/mL (900 nM) by adding 148.8 &#181;L of Cas storage buffer (50 mM Tris-HCl pH 7.4, 0.6 M NaCl, 5% Glycerol, 2 mM DTT) to 10 &#181;L of 2 mg/mL LwaCas13a.</li>
		<li>Prepare the CRISPR-Cas13a mastermix reaction as follows: 71 &#181;L of RNase-free water, 20 &#181;L of 400 mM Tris pH 7.4, 20 &#181;L of 60% (w/v) trehalose, 10 &#181;L of 10 ng/&#181;L (225 nM) crRNA (here, targeting the s and n genes of SARS-CoV-2), 8 &#181;L of 100 mM rNTP mix (25 mM each), 6 &#181;L of 50 Unit/&#181;L T7 RNA polymerase, 25 &#181;L of 2 &#181;M FAM fluorescence reporter, and 10 &#181;L of 126 &#181;g/mL (900 nM) LwaCas13a. Mix well by inverting the mastermix tube; then, spin down.</li>
		<li>Aliquot 17 &#181;L of the mastermix into 10 1.5 mL tubes placed on ice. Place the tubes in a rack submerged in liquid nitrogen and allow the tubes to be submerged in liquid nitrogen for 5 min.</li>
	</ol>
	</li>
	<li>Lyophilization
	<ol>
		<li>At the freeze dryer, check collector and shelf temperatures and wait until the collector temperature reaches -75 &#177; 5 &#176;C and the shelf temperature reaches -30 &#177; 1 &#176;C.</li>
		<li>Place the tubes in the freeze-dryer. Select the program shown in Table 1 and press start. After 30 min of the secondary drying step (25 &#176;C, &#60;0.1 mbar; temperature is held infinitely by setting the time of the step to &#34;infinite&#34;), stop the program.</li>
		<li>Release the pressure by opening the vacuum release valve and remove the rack from the shelf. Cap the tubes immediately and store the lyophilized reactions at -20 &#176;C. 
		NOTE: Lyophilized RPA and CRISPR-Cas13a premixed reagents can be stored at -20 &#176;C for 8 months.</li>
	</ol>
	</li>
</ol>
3. RT-RPA nucleic acid amplification
NOTE: To prevent cross-contamination, workplace areas and pipettors should be separated for pre amplification, sample addition, and post amplification. We recommend using filtered pipette tips.
<ol>
	<li>Prewarm a thermal shaking incubator at 42 &#176;C.</li>
	<li>Add 1 &#181;L of magnesium acetate (Mg(OAc)2) and potassium acetate (KOAc) solution mix (composed of 196 mM Mg(OAc)2 and 1.5 M KOAc) to the side of the tube containing the lyophilized, premixed RT-RPA pellet (from section 1). 
	NOTE: A trick to add the Mg(OAc)2 and KOAc mix: the drop should be placed at around the 1 mL volume mark of the tube. Here, the drop will be clearly visible and is not likely to be lost from tube closing or other actions. The amplification will start after spinning down to collect the drop at the tube bottom. When processing more than one reaction at a time the amplification can be initiated simultaneously.</li>
	<li>Resuspend the RT-RPA pellet by adding 12.4 &#181;L of the RNA sample (or the control samples). 
	NOTE: The sequence of addition is negative sample/negative control, RNA/DNA to be tested, positive sample/positive control.</li>
	<li>To initiate the RT-RPA reaction, briefly spin down the added solution from steps 3.2 and 3.3 using a spin-down minicentrifuge at room temperature for 3 s.</li>
	<li>Mix by carefully tapping the tube and then do another brief spin-down for 3 s.</li>
	<li>Incubate the reaction at 42 &#176;C for 60 min by placing it in a preheated heating block or a thermal shaking incubator.</li>
	<li>After the end of the reaction, take out the reaction tubes and place them on ice before proceeding to the CRISPR-Cas detection step (section 4). 
	NOTE: The RPA-amplified product can be used in the detection reaction immediately or can be stored at 4 &#176;C for several days or at -20 &#176;C for several months.</li>
</ol>
4. CRISPR-Cas13 nucleic acid detection
<ol>
	<li>Turn on a fluorescence microplate reader, set and preheat the heating temperature to 37 &#176;C, and select the program shown in Table 2.</li>
	<li>Place a 384-well plate on ice.</li>
	<li>Resuspend the lyophilized CRISPR-Cas premixed detection reaction (from section 2) by adding 17 &#181;L of 8 mM magnesium chloride solution. Mix by carefully tapping the tube; then briefly spin down for 3 s and place the tube on ice.</li>
	<li>Transfer 18 &#181;L of the resuspended reaction mix to each well of the precooled 384-well plate on ice.</li>
	<li>Add 2 &#181;L of the RPA product prepared in section 3 to each reaction well.</li>
	<li>Remove the plate from the ice, quickly place it into a preheated fluorescence microplate reader, and press start. 
	NOTE: A 384-well plate was placed on ice to allow synchronization of reaction initiation when the 384-well plate is transferred into a preheated fluorescence microplate reader.</li>
</ol>

Optimized CRISPR-Based Molecular Diagnostics Protocol for Point-of-Care Use

<ol>
	<li>Gootenberg, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleic+acid+detection+with+CRISPR-Cas13a/C2c2.">Nucleic acid detection with CRISPR-Cas13a/C2c2.</a> Science. 356 (6336), 438-442 (2017).</li><li>Kaminski, M. M., Abudayyeh, O. O., Gootenberg, J. S., Zhang, F., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-based+diagnostics.">CRISPR-based diagnostics.</a> Nat Biomed Eng. 5 (7), 643-656 (2021).</li><li>Makarova, K. S., Koonin, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotation+and+classification+of+CRISPR-Cas+systems.">Annotation and classification of CRISPR-Cas systems.</a> Methods Mol Biol. (1311), 47-75 (2015).</li><li>Chen, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas12a+target+binding+unleashes+indiscriminate+single-stranded+DNase+activity.">CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity.</a> Science. 360 (6387), 436-439 (2018).</li><li>Arizti-Sanz, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simplified+Cas13-based+assays+for+the+fast+identification+of+SARS-CoV-2+and+its+variants.">Simplified Cas13-based assays for the fast identification of SARS-CoV-2 and its variants.</a> Nat Biomed Eng. 6 (8), 932-943 (2022).</li><li>Broughton, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas12-based+detection+of+SARS-CoV-2.">CRISPR-Cas12-based detection of SARS-CoV-2.</a> Nat Biotechnol. 38 (7), 870-874 (2020).</li><li>Patchsung, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multiplexed+Cas13-based+assay+with+point-of-care+attributes+for+simultaneous+COVID-19+diagnosis+and+variant+surveillance.">A multiplexed Cas13-based assay with point-of-care attributes for simultaneous COVID-19 diagnosis and variant surveillance.</a> CRISPR J. 6 (2), 99-115 (2023).</li><li>Patchsung, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+validation+of+a+Cas13-based+assay+for+the+detection+of+SARS-CoV-2+RNA.">Clinical validation of a Cas13-based assay for the detection of SARS-CoV-2 RNA.</a> Nat Biomed Eng. 4 (12), 1140-1149 (2020).</li><li>Gootenberg, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+and+portable+nucleic+acid+detection+platform+with+Cas13,+Cas12a,+and+Csm6.">Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6.</a> Science. 360 (6387), 439-444 (2018).</li><li>Lee, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+CRISPR-based+diagnostic+for+field-applicable+detection+of+Plasmodium+species+in+symptomatic+and+asymptomatic+malaria.">Ultrasensitive CRISPR-based diagnostic for field-applicable detection of Plasmodium species in symptomatic and asymptomatic malaria.</a> Proc Natl Acad Sci U S A. 117 (41), 25722-25731 (2020).</li><li>Myhrvold, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Field-deployable+viral+diagnostics+using+CRISPR-Cas13.">Field-deployable viral diagnostics using CRISPR-Cas13.</a> Science. 360 (6387), 444-448 (2018).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Versatile+detection+with+CRISPR/Cas+system+from+applications+to+challenges.">Versatile detection with CRISPR/Cas system from applications to challenges.</a> Trends Analyt Chem. 135, 116150 (2021).</li><li>Yao, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas13a-based+detection+for+bovine+viral+diarrhea+virus.">CRISPR-Cas13a-based detection for bovine viral diarrhea virus.</a> Front Vet Sci. 8, 603919 (2021).</li><li>Kellner, M. J., Koob, J. G., Gootenberg, J. S., Abudayyeh, O. O., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SHERLOCK:+nucleic+acid+detection+with+CRISPR+nucleases.">SHERLOCK: nucleic acid detection with CRISPR nucleases.</a> Nat Protoc. 14 (10), 2986-3012 (2019).</li><li>Selvam, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-LAMP+CRISPR-Cas12/13-based+SARS-CoV-2+detection+methods.">RT-LAMP CRISPR-Cas12/13-based SARS-CoV-2 detection methods.</a> Diagnostics (Basel). 11 (9), 1646 (2021).</li><li>Carter, C., Akrami, K., Hall, D., Smith, D., Aronoff-Spencer, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lyophilized+visually+readable+loop-mediated+isothermal+reverse+transcriptase+nucleic+acid+amplification+test+for+detection+Ebola+Zaire+RNA.">Lyophilized visually readable loop-mediated isothermal reverse transcriptase nucleic acid amplification test for detection Ebola Zaire RNA.</a> J Virol Methods. 244, 32-38 (2017).</li><li>Bhardwaj, P., Kant, R., Behera, S. P., Dwivedi, G. R., Singh, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+diagnostic+with+CRISPR/Cas:+Beyond+nucleic+acid+detection.">Next-generation diagnostic with CRISPR/Cas: Beyond nucleic acid detection.</a> Int J Mol Sci. 23 (11), 6052 (2022).</li><li>Twistamp. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Twistamp&#174; assay design manual. , (2023).</li><li>Qian, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+isothermal+amplification+assay+for+viral+detection.">An enhanced isothermal amplification assay for viral detection.</a> Nat Commun. 11 (1), 5920 (2020).</li><li>Ghouneimy, A., Mahas, A., Marsic, T., Aman, R., Mahfouz, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-based+diagnostics:+Challenges+and+toward+point-of-care+applications.">CRISPR-based diagnostics: Challenges and toward point-of-care applications.</a> ACSSynth Biol. 12 (1), 1-16 (2023).</li><li>Jones, K. L., Drane, D., Gowans, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+storage+of+DNA-free+RNA+for+use+in+vaccine+studies.">Long-term storage of DNA-free RNA for use in vaccine studies.</a> Biotechniques. 43 (5), 675-681 (2007).</li><li>Fang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+strand-displacement+DNA+amplification+by+a+contactless+electrochemical+microsystem+using+interdigitated+electrodes.">Real-time monitoring of strand-displacement DNA amplification by a contactless electrochemical microsystem using interdigitated electrodes.</a> Lab Chip. 12 (17), 3190-3196 (2012).</li><li>Mok, E., Wee, E., Wang, Y., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+evaluation+of+molecular+enhancers+of+the+isothermal+exponential+amplification+reaction.">Comprehensive evaluation of molecular enhancers of the isothermal exponential amplification reaction.</a> Sci Rep. 6 (1), 37837 (2016).</li><li>Wan, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+test+kit+for+visual+loop-mediated+isothermal+amplification+of+Salmonella+in+spiked+ready-to-eat+fruits+and+vegetables.">Development of a test kit for visual loop-mediated isothermal amplification of Salmonella in spiked ready-to-eat fruits and vegetables.</a> J Microbiol Methods. 169, 105830 (2020).</li><li>Curti, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+a+lyophilized+CRISPR-Cas12+assay+for+a+ensitive,+specific,+and+rapid+detection+of+SARS-CoV-2.">Evaluation of a lyophilized CRISPR-Cas12 assay for a ensitive, specific, and rapid detection of SARS-CoV-2.</a> Viruses. 13 (3), 420 (2021).</li><li>Joung, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+SARS-CoV-2+with+SHERLOCK+one-pot+testing.">Detection of SARS-CoV-2 with SHERLOCK one-pot testing.</a> N Engl J Med. 383 (15), 1492-1494 (2020).</li></ol>

M.P. and C.U. have filed a patent in Thailand on the formulations for multiplexed detection of SARS-CoV-2 RNA. R.K. declares no competing interests.

There are critical steps in this protocol. For area segregation, it is recommended to use separate spaces for nucleic acid extraction, mastermix preparation (pre amplification area), sample addition, and amplicon detection (post amplification area). Each area should be set by using a separate set of tools and equipment. Do not bring tools from one area into another area, especially from the post amplification area into the pre amplification area. Cleaning of working areas is necessary: one should clean working areas, pip...

CRISPR-based diagnostics for the detection of nucleic acid biomarkers was first reported in 20171,2,3,4, and since then, has been proven as next-generation diagnostics with Food and Drug Administration (FDA)-approved tests, particularly for the detection of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) RNA, in multiple countries5,6,7,8. Beyond coronavirus disease 2019 (COVID-19), the technologies have been demonstrated as effective for detecting diverse viruses and bacteria9,10,11,12,13, genetic disease mutations and deletions, and can be engineered to detect protein and small molecule biomarkers2,12. CRISPR-based diagnostics often combine isothermal amplification methods-such as recombinase polymerase amplification (RPA) or loop-mediated isothermal amplification (LAMP)14,15-with CRISPR-based detection using RNA-guided CRISPR-associated (Cas) enzymes with &#34;collateral&#34; endonuclease activity after target recognition3. The dual use of isothermal amplification and CRISPR-based detection confers several desirable attributes to the technologies, particularly high diagnostic accuracy approaching that of the gold-standard polymerase chain reaction (PCR), and capability to multiplex and detect small sequence differences, including single-nucleotide polymorphisms1,9.
The most accurate versions of CRISPR-based diagnostics, however, contain multiple components and steps and can be complicated to perform with non-experts or at the point of care (POC). To address this challenge of extending the use of highly accurate CRISPR-based diagnostics to POC settings, we have developed protocols to prepare premixed, lyophilized, recombinase-based isothermal amplification and CRISPR-based detection reactions, which are easy to use and store7. These protocols should complement existing excellent protocols on CRISPR-based diagnostics14, which contain additional information on the production of biochemical components needed for CRISPR-based diagnostics7, design guidelines1, and formulations using alternative isothermal amplification techniques2,14,15,16 and Cas enzymes12. Ultimately, we hope that CRISPR-based diagnostics can help realize rapid, inexpensive, and sensitive nucleic detection in settings where portable and instrumental-free analyses are required1,9,17.
We primarily use the combination of RPA and Cas13-based detection in our protocols. RPA functions at near-ambient temperatures (37-42 &#176;C), and therefore, has low energy and equipment requirements. Other isothermal amplification reactions require higher temperatures (LAMP, 60-65 &#176;C; strand-displacement amplification (SDA), 60 &#176;C; exponential amplification reaction (EXPAR), 55 &#176;C; and helicase-dependent amplification (HDA), 65 &#176;C)2. The design of RPA primers is also not complex, unlike LAMP primers, and can be extended to multiplexed amplification7,9,14. Even though multiplexing beyond two targets with RPA is difficult in practice, there are clear guidelines on how to design multiplexed RPA primers to minimize interference18.
While carryover contamination remains a big issue in the two-step workflow, the generated amplicons of RPA are small in size and less likely to cause carryover contamination compared to large concatemeric amplicons from LAMP14. RPA primers can be designed according to standard guidelines14: they are generally 25-35 nucleotide-long with melting temperatures of 54 to 67 &#176;C. The amplicon size should be smaller than 200 base pairs. The reverse transcriptase enzyme (RT) can be added to RPA to enable amplification from RNA, and in reverse transcription-RPA (RT-RPA), another enzyme Ribonuclease H (RNase H) is typically added in small amounts to help resolve the resulting RNA: DNA hybrid and promote the amplification reaction5,19. To allow T7 transcription for Cas13-based detection, the T7 RNA polymerase promoter can be placed at the 5&#39; end of the forward RPA primer.
After amplicons are generated from RPA, they can be detected with crRNA-programmed Cas enzymes. Among various Cas enzymes that can be used for amplicon detection, we prefer RNA-targeting Cas13 variants due to their high cleavage activity1 and well-characterized polynucleotide cleavage preferences7,9, the latter of which can be used for multiplexed detection. The crRNA sequence for Cas13 is designed to be complementary (reverse complement) to the target site in the produced RNA with spacer and direct repeat (DR) sequences. The crRNA sequence and RPA primers should not overlap, to avoid undesired Cas-based detection of off-target amplification products, which increases background and false positives14.
Cas-based detection relies on different detection modalities to monitor the cleavage of reporter nucleic acid molecules (RNA reporters for Cas13-based reactions)1,2,14. Different detection modalities include colorimetry, electrochemical readouts, fluorescence, sequencing readouts, and lateral flow strips2. We focus on the fluorescence readout given a variety of fluorophores and reporters such as cyanine 5 (Cy5), rhodamine X (ROX), and carboxyfluorescein (FAM), which can be effectively excited using a single blue LED light source, and their fluorescence analyzed by a microplate reader or a real-time thermal cycler7,14. In addition, fluorescence readout is easy to set up and allows continuous monitoring, which enables real-time quantitation. Multiplexed RPA preamplification and multiplexed Cas13-based detection using Cas enzymes can be combined with multicolor fluorescence readouts for the simultaneous detection of multiple genetic targets2,7.
In our protocols, we first isothermally amplify RNA with RT-RPA by adding the RNA sample to the lyophilized form of the RT-RPA reagent (Figure 1). During RT-RPA, the T7 promoter is added to the generated double-stranded DNA amplicon. Thereafter, the RPA products are transferred to the lyophilized Cas13-based detection, which also contains T7 RNA polymerase. This detection reaction will convert DNA amplicons into RNA (via T7 RNA polymerase), which can be readily detected with crRNA-programmed Cas13. Target-activated Cas13 will cleave reporter molecules to produce detectable fluorescence signal2,7,14. While the protocols here pertain to detection by Leptotrichia wadei (LwaCas13a), they can be extended to simultaneous, multiplexed detection of up to four targets using orthogonal Cas13 and Cas12 enzymes7,9. RPA and Cas-based detection reactions can also be combined into a single tube, albeit at a loss of sensitivity14.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/66703/66703fig01v2.jpg" /> 
Figure 1: CRISPR-based detection workflow. The workflow illustrates the detection of two target genes. First, regions of interest within the DNA target are isothermally amplified with RPA; the reaction can be performed with reverse transcription (RT-RPA) when detecting RNA targets. Thereafter, T7 transcription converts dsDNA amplicons to RNAs, which in turn are recognized by Cas13-crRNA complexes capable of eliciting collateral RNase activity upon target binding. Cleavage of quenched fluorescence reporters produces fluorescence signals that can be monitored using a microplate reader, visualized by an LED transilluminator, or used with a real-time thermal cycler. Abbreviations: CRISPR = Clustered Regularly Interspaced Short Palindromic Repeats; RT = reverse transcription; RPA = recombinase polymerase amplification; Cas = CRISPR-associated protein; LED = light-emitting diode. <a href="https://www.jove.com/files/ftp_upload/66703/66703fig01largev2.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
The key features of the protocols presented here are the premixing formulations for lyophilization. Premixing simplifies the reaction use and enhances reproducibility, but many components within RPA and Cas-based detection-particularly reverse transcription and some labile cofactors such as ATP are not stable in solution. Therefore, we formulate the premixed solutions such that they can be freeze-dried for long-term storage and easy transport and deployment1,9,20. Premixed, freeze-dried reagents also help improve the detection sensitivity, as higher sample volume (and therefore, higher DNA/RNA input) can be added to reconstitute the reaction10. In our formulations, we primarily use trehalose21 as the cryoprotectant in lyophilized RPA and Cas-based detection reactions7. In addition to reagent preservation, trehalose also promotes the reactions via increasing enzyme stabilization16,22,23,24 and decreasing melting temperatures of dsDNA23. Explorations of other stabilizers5,7,21,25,26 beyond trehalose may yield even more optimal formulations for different use scenarios.

<table><tbody><tr><td>&lt;strong&gt;Material&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Betaine solution</td><td>Sigma-Aldrich</td><td>B0300-1VL</td><td></td></tr><tr><td>DEPC-Treated water</td><td>Invitrogen</td><td>AM9915G</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>Merck</td><td>3870-25GM</td><td></td></tr><tr><td>EpiScript reverse transcriptase</td><td>Lucigen</td><td>ERT12925K</td><td></td></tr><tr><td>Gly-Gly-Gly&amp;nbsp;</td><td>Sigma-Aldrich</td><td>SIA-50239-1G</td><td></td></tr><tr><td>LwaCas13a</td><td>Producing in-house</td><td></td><td>Strain name:Leptotrichia wadei, Abbreviation: Lwa, Protein name: LwaCas13a</td></tr><tr><td>Magnesium chloride solution, 1M</td><td>Sigma-Aldrich</td><td>M1028-10X1ML</td><td></td></tr><tr><td>NxGenT7 RNA polymerase</td><td>Lucigen</td><td>30223-2</td><td></td></tr><tr><td>Poly(ethylene glycol)</td><td>Sigma-Aldrich</td><td>81300-1KG</td><td></td></tr><tr><td>Potassium acetate solution, 5M</td><td>Sigma-Aldrich</td><td>95843-100ML-F</td><td></td></tr><tr><td>Riobnucleotide Solution Mix</td><td>NEB</td><td>N0466L</td><td></td></tr><tr><td>RNase H</td><td>NEB</td><td>M0297L</td><td></td></tr><tr><td>Sucrose</td><td>TCI</td><td>TCI-S0111-500G</td><td></td></tr><tr><td>Trehalose Dihydrate</td><td>Sigma-Aldrich</td><td>SIA-90210-50G</td><td></td></tr><tr><td>Trizma hydrochloride solution, 1M, pH 7.4</td><td>Sigma-Aldrich</td><td>T2194-100ML</td><td></td></tr><tr><td>TwistAmp Basic kit</td><td>TwistDx</td><td>TABAS03KIT</td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>BluPAD Dual LED Blue/White light transilluminator</td><td>Bio-Helix</td><td>BP001CU</td><td></td></tr><tr><td>Dry Bath Dual Block</td><td>ELITE</td><td>4-2-EL-02-220</td><td>Model: EL-02</td></tr><tr><td>Fluorescence microplate reader</td><td>Tecan</td><td>30050303</td><td>Model: Infinite 200 Pro</td></tr><tr><td>Freeze dryer</td><td>LABCONCO</td><td>794001030</td><td>FreeZone Triad Benchtop Freeze Dryer</td></tr><tr><td>Microplate 384-well</td><td>Greiner</td><td>GDE0784076</td><td>F-Bottom, small volume, Hibase, Med. Binding, Black</td></tr><tr><td>Real-time thermal cycler (CFX Connect Real-Time PCR System)</td><td>Bio-Rad</td><td>185-5201</td><td>Model: CFX Connect Optics Module</td></tr><tr><td>&lt;strong&gt;Oligonucleotide&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>s-gene forward RPA primer</td><td>IDT</td><td></td><td>GAAATTAATACGACTCAC&lt;br/&gt; TATAGGGAGGTTTCAAAC&lt;br/&gt; TTTACTTGCTTTACATAGA</td></tr><tr><td>s-gene reverse RPA primer</td><td>IDT</td><td></td><td>TCCTAGGTTGAAGA&lt;br/&gt; TAACCCACATAATAAG</td></tr><tr><td>n-gene forward RPA primer</td><td>IDT</td><td></td><td>GAAATTAATACGACTC&lt;br/&gt; ACTATAGGAACTTCTC&lt;br/&gt; CTGCTAGAATGGCTG</td></tr><tr><td>n-gene reverse RPA primer</td><td>IDT</td><td></td><td>CAGACATTTTGCTCTC&lt;br/&gt; AAGCTGGTTCAATC</td></tr><tr><td>LwaCas13a-crRNA for the s gene</td><td>Synthego</td><td></td><td>GAUUUAGACUACCCCAAAAAC&lt;br/&gt; GAAGGGGACUAAAACGCAGCA&lt;br/&gt; CCAGCUGUCCAACCUGAAGAAG</td></tr><tr><td>LwaCas13a-crRNA for the n gene</td><td>Synthego</td><td></td><td>GAUUUAGACUACCCCAAAAACG&lt;br/&gt; AAGGGGACUAAAACAAAGCAAG&lt;br/&gt; AGCAGCAUCACCGCCAUUGC</td></tr><tr><td>FAM-polyU-IABkFQ reporter</td><td>IDT</td><td></td><td>56-FAM/rUrUrUrUrU/3IABkFQ</td></tr><tr><td>O-hannah_cytb_F RPA primer</td><td>IDT</td><td></td><td>GAAATTAATACGACTCACTA&lt;br/&gt; TAGGGTACGGATGAACCATA&lt;br/&gt; CAAAACCTTCACGCAATCG</td></tr><tr><td>O-hannah_cytb_R RPA primer</td><td>IDT</td><td></td><td>AAGATCCATAGTAGATTC&lt;br/&gt; CTCGTGCGATGTGGATA</td></tr><tr><td>synT7crRNA13a_ O_hannah&amp;nbsp;</td><td>IDT</td><td></td><td>GCGCATCCATATTCTTCAT&lt;br/&gt; CTGCATTTAGTTTTAGTCC&lt;br/&gt; CCTTCGTTTTTGGGGTA&lt;br/&gt; GTCTAAATCCCCTATAGT&lt;br/&gt; GAGTCGTATTAATTTC</td></tr></tbody></table>

point-of-care crispr-based diagnostics with premixed and freeze-dried reagents

Molecular diagnostics by Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based detection have high diagnostic accuracy and attributes that are suitable for use at point-of-care settings such as fast turnaround times for results, convenient simple readouts, and no requirement of complicated instruments. However, the reactions can be cumbersome to perform at the point of care due to their many components and manual handling steps. Herein, we provide a step-by-step, optimized protocol for the robust detection of disease pathogens and genetic markers with recombinase-based isothermal amplification and CRISPR-based reagents, which are premixed and then freeze-dried in easily stored and ready-to-use formats. Premixed, freeze-dried reagents can be rehydrated for immediate use and retain high amplification and detection efficiencies. We also provide a troubleshooting guide for commonly found problems upon preparing and using premixed, freeze-dried reagents for CRISPR-based diagnostics, to make the detection platform more accessible to the wider diagnostic/genetic testing communities.

We highlight the kinetics of FAM fluorescence signal generation from the combined detection of s and n genes of SARS-CoV-2, and how the information was used to determine optimal conditions for lyophilized, premixed reaction formulations. In all cases, we included samples with Ct values well within the determined detection limit (LoD) (Ct ~31-33), as well as those with Ct at the LoD (Ct ~35-37)7, to allow differentiation of protocols wit...

Author Spotlight: Development of Simplified CRISPR-Based Tests for Rapid Detection of Infectious Diseases

Here, we present the step-by-step preparation of premixed, lyophilized recombinase-based isothermal amplification and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based reactions, which can be used for the detection of nucleic acid biomarkers of infectious disease pathogens or other genetic markers of interest.

Point-of-care CRISPR-based Diagnostics with Premixed and Freeze-dried Reagents

Molecular diagnostics by Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based detection have high diagnostic accuracy and attributes ...

point-care-crispr-based-diagnostics-with-premixed-freeze-dried

Research

JoVE Journal

Bioengineering

1.0K Views.  Vidyasirimedhi Institute of Science and Technology (VISTEC). Here, we present the step-by-step preparation of premixed, lyophilized recombinase-based isothermal amplification and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based reactions, which can be used for the detection of nucleic acid biomarkers of infectious disease pathogens or other genetic markers of interest. 

Video: Author Spotlight: Development of Simplified CRISPR-Based Tests for Rapid Detection of Infectious Diseases

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different downstream patient-to-patient transmission potentials, and require very different patient treatments. Thus, recent Zika outbreaks make it urgent to develop tools that rapidly discriminate these viruses in patients and trapped mosquitoes, to select the correct patient treatment, and to understand and manage their epidemiology in real time.
Unfortunately, current diagnostic tests, including those receiving 2016 emergency use authorizations and fast-track status, detect viral RNA by reverse transcription polymerase chain reaction (RT-PCR), which requires instrumentation, trained users, and considerable sample preparation. Thus, they must be sent to &#34;approved&#34; reference laboratories, requiring time. Indeed, in August 2016, the Center for Disease Control (CDC) was asking pregnant women who had been bitten by a mosquito and developed a Zika-indicating rash to wait an unacceptable 2 to 4 weeks before learning whether they were infected. We very much need tests that can be done on site, with few resources, and by trained but not necessarily licensed personnel.
This video demonstrates an assay that meets these specifications, working with urine or serum (for patients) or crushed mosquito carcasses (for environmental surveillance), all without much sample preparation. Mosquito carcasses are captured on paper carrying quaternary ammonium groups (Q-paper) followed by ammonia treatment to manage biohazards. These are then directly, without RNA isolation, put into assay tubes containing freeze-dried reagents that need no chain of refrigeration. A modified form of reverse transcription loop-mediated isothermal amplification with target-specific fluorescently tagged displaceable probes produces readout, in 30 min, as a three-color fluorescence signal. This is visualized with a handheld, battery-powered device with an orange filter. Forward contamination is prevented with sealed tubes, and the use of thermolabile uracil DNA glycosylase (UDG) in the presence of dUTP in the amplification mixture.

Current multiplexed diagnostics to detect Zika, chikungunya, and dengue viruses require complex sample preparation and expensive instrumentation, and are difficult to use in low resource environments. We show a diagnostic that uses isothermal amplification with target-specific strand displaceable probes to detect and differentiate these viruses with high sensitivity and specificity.

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different ...

Biochemistry

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation into thousands of nano-sized water-in-oil individual reactions. Recently, ddPCR has become one of the most accurate and sensitive tools for circulating tumor DNA (ctDNA) detection. One of the major limitations of the standard ddPCR technique is the restricted number of mutations that can be screened per reaction, as specific hydrolysis probes recognizing each possible allelic version are required. An alternative methodology, the drop-off ddPCR, increases throughput, since it requires only a single pair of probes to detect and quantify potentially all genetic alterations in the targeted region. Drop-off ddPCR displays comparable sensitivity to conventional ddPCR assays with the advantage of detecting a greater number of mutations in a single reaction. It is cost-effective, conserves precious sample material, and can also be used as a discovery tool when mutations are not known a priori.

Here, we present a protocol to accurately quantify multiple genetic alterations of a target region in a single reaction using drop-off ddPCR and a unique pair of hydrolysis probes.

Droplet digital polymerase chain reaction (ddPCR) is a highly sensitive quantitative polymerase chain reaction (PCR) method based on sample fractionation ...

Genetics

Ready-To-Use qPCR for Detection of DNA from Trypanosoma cruzi or Other Pathogenic Organisms

Real-time PCR (qPCR) is a remarkably sensitive and precise technique&#160;that allows for amplifying&#160;minute amounts of nucleic acid targets from a multitude of samples. It has been extensively used in many research areas and achieved industrial application in fields such as human diagnostics and trait selection in crops of genetically modified organisms (GMO) crops. However, qPCR is not an error-proof technique. Mixing all reagents into a single master mix subsequently distributed onto 96 wells of a regular qPCR plate might lead to operator mistakes such as incorrect mixing of reagents or inaccurate dispensing into the wells. Here, a technique called gelification is presented, whereby most of the water present in the master mix is substituted by reagents that form a sol-gel mixture when submitted to a vacuum. As a result, qPCR reagents are effectively preserved for a few weeks at room temperature or a few months at 2-8 oC. Details of preparing each solution are shown here along with the expected aspect of a gelified reaction designed to detect&#160;T. cruzi satellite DNA (satDNA). A similar procedure can be applied to detect other organisms. Starting a gelified qPCR run is as simple as removing the plate from the refrigerator, adding the samples to their respective wells, and starting the run, thus decreasing the setup time of a full-plate reaction to the time it takes to load the samples. Additionally, gelified PCR reactions can be produced and controlled for quality in batches, saving time and avoiding common operator mistakes while running routine PCR reactions.

Ready-To-Use qPCR for Detection of DNA from Trypanosoma cruzi or Other Pathogenic Organisms

The present work describes the steps for producing ready-to-use qPCR for T. cruzi DNA detection that can be pre-loaded on the reaction vessel and stored in the refrigerator for several months.

Real-time PCR (qPCR) is a remarkably sensitive and precise technique&#160;that allows for amplifying&#160;minute amounts of nucleic acid targets from a ...

Visual Detection of Multiple Nucleic Acids in a Capillary Array

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently needed in disease diagnosis, microbial monitoring, genetically modified organism (GMO) detection, and forensic analysis. We have previously described the platform called CALM (Capillary Array-based Loop-mediated isothermal amplification for Multiplex visual detection of nucleic acids). Herein, we describe improved fabrication and performance processes for this platform. Here, we apply a small, ready-to-use cassette assembled by capillary array for multiplex visual detection of nucleic acids. The capillary array is pre-treated into a hydrophobic and hydrophilic pattern before fixing loop-mediated isothermal amplification (LAMP) primer sets in capillaries. After assembly of the loading adaptor, LAMP reaction mixture is loaded and isolated into each capillary, due to capillary force by a single pipetting step. The LAMP reactions are performed in parallel in the capillaries. The results are visually read out by illumination with a hand-held UV flashlight. Using this platform, we demonstrate monitoring of 8 frequently appearing elements and genes in GMO samples with high specificity and sensitivity. In summary, the platform described herein is intended to facilitate the detection of multiple nucleic acids. We believe it will be widely applicable in fields where high-throughput nucleic acid analysis is required.

This protocol describes the fabrication of a small, ready-to-use cassette that can be applied for visual detection of multiple nucleic acids in a single, test that is easy to operate. In this approach, a capillary array was used for multiplex and highly efficient detection of GMO targets.

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently ...

High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of combining reactions together. We designed and evaluated a panel based on this principle to rapidly identify the presence of common disease agents in dogs and horses with acute respiratory illness. This manuscript describes a nanoscale diagnostic PCR workflow for sample preparation, amplification, and analysis of target pathogen sequences, focusing on procedures that are different from microliter scale reactions. In the respiratory panel presented, 18 assays were each set up in triplicate, accommodating up to 48 samples per plate. A universal extraction and pre-amplification workflow was optimized for high-throughput sample preparation to accommodate multiple matrices and DNA and RNA based pathogens. Representative data are presented for one RNA target (influenza A matrix) and one DNA target (equine herpesvirus 1). The ability to quickly and accurately test for a comprehensive, syndrome-based group of pathogens is a valuable tool for improving efficiency and ergonomics of diagnostic testing and for acute respiratory disease diagnosis and management.

High-throughput testing of DNA and RNA based pathogens by nanoscale PCR is described using a syndromic canine and equine respiratory PCR panel.

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of ...

Immunology and Infection

Design to Implementation Study for Development and Patient Validation of Paper-Based Toehold Switch Diagnostics

Access to low-burden molecular diagnostics that can be deployed into the community for testing is increasingly important and has meaningful wider implications for the well-being of societies and economic stability. Recent years have seen several new isothermal diagnostic modalities emerge to meet the need for rapid, low-cost molecular diagnostics. We have contributed to this effort through the development and patient validation of toehold switch-based diagnostics, including diagnostics for the mosquito-borne Zika and chikungunya viruses, which provided performance comparable to gold-standard reverse transcription-quantitative polymerase chain reaction (RT-qPCR) based assays. These diagnostics are inexpensive to develop and manufacture, and they have the potential to provide diagnostic capacity to low-resource environments. Here the protocol provides all the steps necessary for the development of a switch-based assay for Zika virus detection. The article takes readers through the stepwise diagnostic development process. First, genomic sequences of Zika virus serve as inputs for the computational design of candidate switches using open-source software. Next, the assembly of the sensors for empirical screening with synthetic RNA sequences and optimization of diagnostic sensitivity is shown. Once complete, validation is performed with patient samples in parallel with RT-qPCR, and a purpose-built optical reader, PLUM. This work provides a technical roadmap to researchers for the development of low-cost toehold switch-based sensors for applications in human health, agriculture, and environmental monitoring.

Access to decentralized, low-cost, and high-capacity diagnostics that can be deployed into the community for decentralized testing is critical for combating global health crises. This manuscript describes how to build paper-based diagnostics for viral RNA sequences that can be detected with a portable optical reader.

Access to low-burden molecular diagnostics that can be deployed into the community for testing is increasingly important and has meaningful wider ...

Gene Digital Circuits Based on CRISPR-Cas Systems and Anti-CRISPR Proteins

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the CRISPR-Cas systems and their natural inhibitors-the anti-CRISPR proteins (Acrs)-provides a new tool to design and implement in vivo gene digital circuits. Here, we describe a protocol that follows the idea of the "Design-Build-Test-Learn" biological engineering cycle and makes use of dCas9/dCas12a together with their corresponding Acrs to establish small transcriptional networks, some of which behave like Boolean gates, in Saccharomyces cerevisiae. These results point out the properties of dCas9/dCas12a as transcription factors. In particular, to achieve maximal activation of gene expression, dSpCas9 needs to interact with an engineered scaffold RNA that collects multiple copies of the VP64 activation domain (AD). In contrast, dCas12a shall be fused, at the C terminus, with the strong VP64-p65-Rta (VPR) AD. Furthermore, the activity of both Cas proteins is not enhanced by increasing the amount of sgRNA/crRNA in the cell. This article also explains how to build Boolean gates based on the CRISPR-dCas-Acr interaction. The AcrIIA4 fused hormone-binding domain of the human estrogen receptor is the core of a NOT gate responsive to &#946;-estradiol, whereas AcrVAs synthesized by the inducible GAL1 promoter permits to mimic both YES and NOT gates with galactose as an input. In the latter circuits, AcrVA5, together with dLbCas12a, showed the best logic behavior.

CRISPR-Cas systems and anti-CRISPR proteins were integrated into the scheme of Boolean gates in Saccharomyces cerevisiae. The new small logic circuits showed good performance and deepened the understanding of both dCas9/dCas12a-based transcription factors and the properties of anti-CRISPR proteins.

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the ...

CRISPR-Cas Synthetic Urine Biomarker Test for Cancer Diagnostics

CRISPR-Cas-mediated Multianalyte Synthetic Urine Biomarker Test for Portable Diagnostics

Creating synthetic biomarkers for the development of precision diagnostics has enabled detection of disease through pathways beyond those used for traditional biofluid measurements. Synthetic biomarkers generally make use of reporters that provide readable signals in the biofluid to reflect the biochemical alterations in the local disease microenvironment during disease incidence and progression. The pharmacokinetic concentration of the reporters and biochemical amplification of the disease signal are paramount to achieving high sensitivity and specificity in a diagnostic test. Here, a cancer diagnostic platform is built using one format of synthetic biomarkers: activity-based nanosensors carrying chemically stabilized DNA reporters that can be liberated by aberrant proteolytic signatures in the tumor microenvironment. Synthetic DNA as a disease reporter affords multiplexing capability through its use as a barcode, allowing for the readout of multiple proteolytic signatures at once. DNA reporters released into the urine are detected using CRISPR nucleases via hybridization with CRISPR RNAs, which in turn produce a fluorescent or colorimetric signal upon enzyme activation. In this protocol, DNA-barcoded, activity-based nanosensors are constructed and their application is exemplified in a preclinical mouse model of metastatic colorectal cancer. This system is highly modifiable according to disease biology and generates multiple disease signals simultaneously, affording a comprehensive understanding of the disease characteristics through a minimally invasive process requiring only nanosensor administration, urine collection, and a paper test which enables point-of-care diagnostics.

Author Spotlight: Engineering Molecular Tools for Disease Detection and Imaging

This protocol describes a CRISPR-Cas-mediated, multianalyte synthetic urine biomarker test that enables point-of-care cancer diagnostics through the ex vivo analysis of tumor-associated protease activities.

Creating synthetic biomarkers for the development of precision diagnostics has enabled detection of disease through pathways beyond those used for ...

Development of a Quantitative Recombinase Polymerase Amplification Assay with an Internal Positive Control

It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest.

Provided is a protocol for developing a real-time recombinase polymerase amplification assay to quantify initial concentration of DNA samples using either a thermal cycler or a microscope and stage heater. Also described is the development of an internal positive control. Scripts are provided for processing raw real-time fluorescence data.

It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to ...

Biology

Field-Deployable Candidatus Liberibacter asiaticus Detection Using Recombinase Polymerase Amplification Combined with CRISPR-Cas12a

The early detection of Candidatus Liberibacter asiaticus (CLas) by citrus growers facilitates early intervention and prevents the spread of disease. A simple method for rapid and portable Huanglongbing (HLB) diagnosis is presented here that combines recombinase polymerase amplification and a fluorescent reporter utilizing the nuclease activity of the clustered regularly interspaced short palindromic repeats/CRISPR-associated 12a (CRISPR-Cas12a) system. The sensitivity of this technique is much higher than PCR. Furthermore, this method showed similar results to qPCR when leaf samples were used. Compared with conventional CLas detection methods, the detection method presented here can be completed in 90 min and works in an isothermal condition that does not require the use of PCR machines. In addition, the results can be visualized through a handheld fluorescent detection device in the field.

Field-Deployable Candidatus Liberibacter asiaticus Detection Using Recombinase Polymerase Amplification Combined with CRISPR-Cas12a

In this work, a rapid, sensitive, and portable detection method for Candidatus Liberibacter asiaticus based on recombinase polymerase amplification combined with CRISPR-Cas12a was developed.

The early detection of Candidatus Liberibacter asiaticus (CLas) by citrus growers facilitates early intervention and prevents the spread of disease. A ...

Point-of-care CRISPR-based Diagnostics with Premixed and Freeze-dried Reagents

Summary

Explore More Videos

Chapters in this video

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

Single Droplet Digital Polymerase Chain Reaction for Comprehensive and Simultaneous Detection of Mutations in Hotspot Regions

Ready-To-Use qPCR for Detection of DNA from Trypanosoma cruzi or Other Pathogenic Organisms

Visual Detection of Multiple Nucleic Acids in a Capillary Array

High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR

Design to Implementation Study for Development and Patient Validation of Paper-Based Toehold Switch Diagnostics

Gene Digital Circuits Based on CRISPR-Cas Systems and Anti-CRISPR Proteins

CRISPR-Cas-mediated Multianalyte Synthetic Urine Biomarker Test for Portable Diagnostics

Development of a Quantitative Recombinase Polymerase Amplification Assay with an Internal Positive Control

Field-Deployable Candidatus Liberibacter asiaticus Detection Using Recombinase Polymerase Amplification Combined with CRISPR-Cas12a