C.U. acknowledges funding from Siam Commercial Bank under VISTEC-Siriraj Frontier Research Center, and from Thailand Science Research and Innovation (TSRI), fundamental fund, fiscal year 2024,&#160;grant number FRB670026/0457. R.K. and M.P. are supported by studentship and research assistantship funds from VISTEC, respectively.

1. Preparation of lyophilized RT-RPA premixed reagents
<ol>
	<li>Equipment preparation
	<ol>
		<li>Prepare a liquid nitrogen dewar or tray for flash-freezing of reactions. Fill the dewar or tray with liquid nitrogen.</li>
		<li>Freeze dryer
		<ol>
			<li>Check for condensed water in draining tubes and the chamber interior; remove the water if needed.</li>
			<li>Clean the chamber interior and the 1.5 mL microcentrifuge tube metal rack with RNase decontamination solution, followed by 70% ethanol.</li>
			<li>Close the chamber door and the vacuum release valve.</li>
			<li>Turn on the freeze dryer.</li>
			<li>Manually set the shelf temperature to -30 &#176;C.</li>
		</ol>
		</li>
		<li>Molecular biology equipment
		<ol>
			<li>Clean the following with RNase decontamination solution: pipettes, pipette tip racks, a vortex mixer, a spin-down minicentrifuge, and a permanent marker.</li>
			<li>Clean the following with tap water, then wipe with cleaning wipe paper: plastic racks for microcentrifuge tubes and a foam box for ice.</li>
			<li>Prepare a heating block (used for dissolving/resolubilizing the triglycine solution) by cleaning it with RNase decontamination solution and 70% ethanol. Then, turn it on and set the temperature to 60 &#176;C.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Preparation of premixed RPA reactions 
	NOTE: This formulation is for 10 reactions (using three RPA pellets).
	<ol>
		<li>Check whether there is any precipitate in the triglycine solution before use. If there are precipitates, dissolve these by incubating at 60 &#176;C and mixing thoroughly before use. Cool the triglycine solution down before adding other heat-sensitive reagents. 
		NOTE: Precipitates can form easily if the tube is left at room temperature for a prolonged period.</li>
		<li>Remove three RPA pellet strip tubes from the freezer; tap the strip tubes by knocking them gently against the lab bench to dislodge the white pellets.</li>
		<li>Transfer all three pellets into a 1.5 mL microcentrifuge tube A.</li>
		<li>Pipette 25 &#181;L of nuclease-free water to rinse any remaining RPA powder in the strip tubes and transfer the rinse solution to a new 1.5 mL microcentrifuge tube B.</li>
		<li>Add 10 &#181;L of the 0.57 M triglycine solution and 10 &#181;L of primer mix (10 &#181;M each) to the mastermix tube B.</li>
		<li>Vortex-mix tube B; then spin down and place the tube on ice.</li>
		<li>Add 28.4 &#181;L of the 5x RPA buffer (prepared from 500 &#181;L of 50% (w/v) PEG20000, 250 &#181;L of 1 M Tris pH 7.4, and 100 &#181;L of 100 mM dithiothreitol (DTT)) to the mastermix tube B and mix thoroughly by strong tapping or shaking multiple times. 
		NOTE: We make the solution in this manner to help dilute/decrease the viscosity of PEG in the mastermix tube, prior to adding everything to solubilize RPA pellets.</li>
		<li>Transfer pellets collected in tube A from Step 1.2.3 into the mastermix tube B and then invert the mastermix tube several times to mix. Observe whether the solution appears homogeneous and monophasic (it will also look slightly opaque) and then, place the tube on ice. 
		NOTE: If mixing is not thorough, PEG can cause the solution/suspension to phase-separate.</li>
		<li>Add 0.71 &#181;L of 200 Unit/&#181;L RT and 2.84 &#181;L of 5 Unit/&#181;L RNase H to the mastermix tube. Gently tap or invert the mastermix tube up and down many times. Spin down and place the tube on ice. 
		NOTE: We add these enzymes after heavy mixing of earlier steps since RT and RNase H are sensitive to shear due to mixing; no more vortexing after RT/RNase H addition.</li>
		<li>Aliquot 8.4 &#181;L of the mastermix solution to 10 precooled 1.5 mL tubes and place the tubes on ice. To do this, plunge the pipette tip into the mastermix solution and draw the mastermix solution into the tip slowly and steadily to prevent air bubbles from forming and to ensure accurate volume measurement. Dispense the mastermix solution into a precooled 1.5 ml tube. 
		NOTE: With 8.4 &#181;L aliquoted, in our experience, there will be ~1-2 &#181;L suspension left in the mastermix tube. The experimenter can adjust the aliquoting volume down slightly to ensure enough reagents for all 10 reactions. Use proper pipetting techniques when handling viscous solutions.</li>
		<li>After aliquoting is completed, place the tubes in a metal rack submerged in liquid nitrogen to prepare them for lyophilization. Allow the tubes to be submerged in liquid nitrogen for 5 min. 
		NOTE: As lyophilization removes excess solution, it allows us to add more DNA/RNA input, which helps increase sensitivity. Freeze-dried premixed RPA reactions can be stored at -20 &#176;C for 8 months. Lyophilization helps with reproducibility if a given experiment is performed using RPA mastermixes prepared in the same batch, so making a larger batch also helps.</li>
	</ol>
	</li>
	<li>Lyophilization
	<ol>
		<li>At the freeze dryer, check collector and shelf temperatures. If necessary, wait until the collector temperature reaches -75 &#177; 5 &#176;C and the shelf temperature reaches -30 &#177; 1 &#176;C.</li>
		<li>Cover open tubes in the metal rack with a sheet of cleaning wipe paper, place the metal rack along with the open tubes in the freeze dryer shelf, and close the shelf door.</li>
		<li>Select the program shown in Table 1 and press start. After 30 min of the secondary drying step (20 &#176;C, &#60;0.1 mbar; temperature is held infinitely by setting the time of the step to &#34;infinite&#34;), press stop the program. 
		NOTE: We let the tubes warm up in the freeze dryer to prevent water condensation.</li>
		<li>Release the pressure by opening the vacuum release valve, then remove the rack from the shelf. Cap the tubes immediately and store the lyophilized reactions at -20 &#176;C. 
		NOTE: Lyophilized RPA and CRISPR-Cas13a premixed reactions can be stored at -20 &#176;C for 8 months.</li>
	</ol>
	</li>
</ol>
2. Preparation of lyophilized CRISPR-Cas13a premixed detection reagents
NOTE: Follow step 1.1 for equipment preparation.
<ol>
	<li>CRISPR-Cas13a premixed reaction preparation (10 reactions)
	<ol>
		<li>Remove the following items from storage and place them on ice: 10 &#181;L of LwaCas13a (produced in-house7,8,14) (2 mg/mL), Cas storage buffer, 10 ng/&#181;L (225 nM) crRNA, 25 mM rNTP, 50 Unit/&#181;L T7 RNA polymerase, 2&#160;&#181;M of FAM fluorescence reporter.</li>
		<li>Prepare a working solution of LwaCas13a at 126 &#181;g/mL (900 nM) by adding 148.8 &#181;L of Cas storage buffer (50 mM Tris-HCl pH 7.4, 0.6 M NaCl, 5% Glycerol, 2 mM DTT) to 10 &#181;L of 2 mg/mL LwaCas13a.</li>
		<li>Prepare the CRISPR-Cas13a mastermix reaction as follows: 71 &#181;L of RNase-free water, 20 &#181;L of 400 mM Tris pH 7.4, 20 &#181;L of 60% (w/v) trehalose, 10 &#181;L of 10 ng/&#181;L (225 nM) crRNA (here, targeting the s and n genes of SARS-CoV-2), 8 &#181;L of 100 mM rNTP mix (25 mM each), 6 &#181;L of 50 Unit/&#181;L T7 RNA polymerase, 25 &#181;L of 2 &#181;M FAM fluorescence reporter, and 10 &#181;L of 126 &#181;g/mL (900 nM) LwaCas13a. Mix well by inverting the mastermix tube; then, spin down.</li>
		<li>Aliquot 17 &#181;L of the mastermix into 10 1.5 mL tubes placed on ice. Place the tubes in a rack submerged in liquid nitrogen and allow the tubes to be submerged in liquid nitrogen for 5 min.</li>
	</ol>
	</li>
	<li>Lyophilization
	<ol>
		<li>At the freeze dryer, check collector and shelf temperatures and wait until the collector temperature reaches -75 &#177; 5 &#176;C and the shelf temperature reaches -30 &#177; 1 &#176;C.</li>
		<li>Place the tubes in the freeze-dryer. Select the program shown in Table 1 and press start. After 30 min of the secondary drying step (25 &#176;C, &#60;0.1 mbar; temperature is held infinitely by setting the time of the step to &#34;infinite&#34;), stop the program.</li>
		<li>Release the pressure by opening the vacuum release valve and remove the rack from the shelf. Cap the tubes immediately and store the lyophilized reactions at -20 &#176;C. 
		NOTE: Lyophilized RPA and CRISPR-Cas13a premixed reagents can be stored at -20 &#176;C for 8 months.</li>
	</ol>
	</li>
</ol>
3. RT-RPA nucleic acid amplification
NOTE: To prevent cross-contamination, workplace areas and pipettors should be separated for pre amplification, sample addition, and post amplification. We recommend using filtered pipette tips.
<ol>
	<li>Prewarm a thermal shaking incubator at 42 &#176;C.</li>
	<li>Add 1 &#181;L of magnesium acetate (Mg(OAc)2) and potassium acetate (KOAc) solution mix (composed of 196 mM Mg(OAc)2 and 1.5 M KOAc) to the side of the tube containing the lyophilized, premixed RT-RPA pellet (from section 1). 
	NOTE: A trick to add the Mg(OAc)2 and KOAc mix: the drop should be placed at around the 1 mL volume mark of the tube. Here, the drop will be clearly visible and is not likely to be lost from tube closing or other actions. The amplification will start after spinning down to collect the drop at the tube bottom. When processing more than one reaction at a time the amplification can be initiated simultaneously.</li>
	<li>Resuspend the RT-RPA pellet by adding 12.4 &#181;L of the RNA sample (or the control samples). 
	NOTE: The sequence of addition is negative sample/negative control, RNA/DNA to be tested, positive sample/positive control.</li>
	<li>To initiate the RT-RPA reaction, briefly spin down the added solution from steps 3.2 and 3.3 using a spin-down minicentrifuge at room temperature for 3 s.</li>
	<li>Mix by carefully tapping the tube and then do another brief spin-down for 3 s.</li>
	<li>Incubate the reaction at 42 &#176;C for 60 min by placing it in a preheated heating block or a thermal shaking incubator.</li>
	<li>After the end of the reaction, take out the reaction tubes and place them on ice before proceeding to the CRISPR-Cas detection step (section 4). 
	NOTE: The RPA-amplified product can be used in the detection reaction immediately or can be stored at 4 &#176;C for several days or at -20 &#176;C for several months.</li>
</ol>
4. CRISPR-Cas13 nucleic acid detection
<ol>
	<li>Turn on a fluorescence microplate reader, set and preheat the heating temperature to 37 &#176;C, and select the program shown in Table 2.</li>
	<li>Place a 384-well plate on ice.</li>
	<li>Resuspend the lyophilized CRISPR-Cas premixed detection reaction (from section 2) by adding 17 &#181;L of 8 mM magnesium chloride solution. Mix by carefully tapping the tube; then briefly spin down for 3 s and place the tube on ice.</li>
	<li>Transfer 18 &#181;L of the resuspended reaction mix to each well of the precooled 384-well plate on ice.</li>
	<li>Add 2 &#181;L of the RPA product prepared in section 3 to each reaction well.</li>
	<li>Remove the plate from the ice, quickly place it into a preheated fluorescence microplate reader, and press start. 
	NOTE: A 384-well plate was placed on ice to allow synchronization of reaction initiation when the 384-well plate is transferred into a preheated fluorescence microplate reader.</li>
</ol>

Optimized CRISPR-Based Molecular Diagnostics Protocol for Point-of-Care Use

<ol>
	<li>Gootenberg, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleic+acid+detection+with+CRISPR-Cas13a/C2c2.">Nucleic acid detection with CRISPR-Cas13a/C2c2.</a> Science. 356 (6336), 438-442 (2017).</li><li>Kaminski, M. M., Abudayyeh, O. O., Gootenberg, J. S., Zhang, F., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-based+diagnostics.">CRISPR-based diagnostics.</a> Nat Biomed Eng. 5 (7), 643-656 (2021).</li><li>Makarova, K. S., Koonin, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotation+and+classification+of+CRISPR-Cas+systems.">Annotation and classification of CRISPR-Cas systems.</a> Methods Mol Biol. (1311), 47-75 (2015).</li><li>Chen, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas12a+target+binding+unleashes+indiscriminate+single-stranded+DNase+activity.">CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity.</a> Science. 360 (6387), 436-439 (2018).</li><li>Arizti-Sanz, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simplified+Cas13-based+assays+for+the+fast+identification+of+SARS-CoV-2+and+its+variants.">Simplified Cas13-based assays for the fast identification of SARS-CoV-2 and its variants.</a> Nat Biomed Eng. 6 (8), 932-943 (2022).</li><li>Broughton, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas12-based+detection+of+SARS-CoV-2.">CRISPR-Cas12-based detection of SARS-CoV-2.</a> Nat Biotechnol. 38 (7), 870-874 (2020).</li><li>Patchsung, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multiplexed+Cas13-based+assay+with+point-of-care+attributes+for+simultaneous+COVID-19+diagnosis+and+variant+surveillance.">A multiplexed Cas13-based assay with point-of-care attributes for simultaneous COVID-19 diagnosis and variant surveillance.</a> CRISPR J. 6 (2), 99-115 (2023).</li><li>Patchsung, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+validation+of+a+Cas13-based+assay+for+the+detection+of+SARS-CoV-2+RNA.">Clinical validation of a Cas13-based assay for the detection of SARS-CoV-2 RNA.</a> Nat Biomed Eng. 4 (12), 1140-1149 (2020).</li><li>Gootenberg, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+and+portable+nucleic+acid+detection+platform+with+Cas13,+Cas12a,+and+Csm6.">Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6.</a> Science. 360 (6387), 439-444 (2018).</li><li>Lee, R. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+CRISPR-based+diagnostic+for+field-applicable+detection+of+Plasmodium+species+in+symptomatic+and+asymptomatic+malaria.">Ultrasensitive CRISPR-based diagnostic for field-applicable detection of Plasmodium species in symptomatic and asymptomatic malaria.</a> Proc Natl Acad Sci U S A. 117 (41), 25722-25731 (2020).</li><li>Myhrvold, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Field-deployable+viral+diagnostics+using+CRISPR-Cas13.">Field-deployable viral diagnostics using CRISPR-Cas13.</a> Science. 360 (6387), 444-448 (2018).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Versatile+detection+with+CRISPR/Cas+system+from+applications+to+challenges.">Versatile detection with CRISPR/Cas system from applications to challenges.</a> Trends Analyt Chem. 135, 116150 (2021).</li><li>Yao, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas13a-based+detection+for+bovine+viral+diarrhea+virus.">CRISPR-Cas13a-based detection for bovine viral diarrhea virus.</a> Front Vet Sci. 8, 603919 (2021).</li><li>Kellner, M. J., Koob, J. G., Gootenberg, J. S., Abudayyeh, O. O., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SHERLOCK:+nucleic+acid+detection+with+CRISPR+nucleases.">SHERLOCK: nucleic acid detection with CRISPR nucleases.</a> Nat Protoc. 14 (10), 2986-3012 (2019).</li><li>Selvam, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-LAMP+CRISPR-Cas12/13-based+SARS-CoV-2+detection+methods.">RT-LAMP CRISPR-Cas12/13-based SARS-CoV-2 detection methods.</a> Diagnostics (Basel). 11 (9), 1646 (2021).</li><li>Carter, C., Akrami, K., Hall, D., Smith, D., Aronoff-Spencer, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lyophilized+visually+readable+loop-mediated+isothermal+reverse+transcriptase+nucleic+acid+amplification+test+for+detection+Ebola+Zaire+RNA.">Lyophilized visually readable loop-mediated isothermal reverse transcriptase nucleic acid amplification test for detection Ebola Zaire RNA.</a> J Virol Methods. 244, 32-38 (2017).</li><li>Bhardwaj, P., Kant, R., Behera, S. P., Dwivedi, G. R., Singh, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+diagnostic+with+CRISPR/Cas:+Beyond+nucleic+acid+detection.">Next-generation diagnostic with CRISPR/Cas: Beyond nucleic acid detection.</a> Int J Mol Sci. 23 (11), 6052 (2022).</li><li>Twistamp. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Twistamp&#174; assay design manual. , (2023).</li><li>Qian, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+isothermal+amplification+assay+for+viral+detection.">An enhanced isothermal amplification assay for viral detection.</a> Nat Commun. 11 (1), 5920 (2020).</li><li>Ghouneimy, A., Mahas, A., Marsic, T., Aman, R., Mahfouz, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-based+diagnostics:+Challenges+and+toward+point-of-care+applications.">CRISPR-based diagnostics: Challenges and toward point-of-care applications.</a> ACSSynth Biol. 12 (1), 1-16 (2023).</li><li>Jones, K. L., Drane, D., Gowans, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+storage+of+DNA-free+RNA+for+use+in+vaccine+studies.">Long-term storage of DNA-free RNA for use in vaccine studies.</a> Biotechniques. 43 (5), 675-681 (2007).</li><li>Fang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+strand-displacement+DNA+amplification+by+a+contactless+electrochemical+microsystem+using+interdigitated+electrodes.">Real-time monitoring of strand-displacement DNA amplification by a contactless electrochemical microsystem using interdigitated electrodes.</a> Lab Chip. 12 (17), 3190-3196 (2012).</li><li>Mok, E., Wee, E., Wang, Y., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+evaluation+of+molecular+enhancers+of+the+isothermal+exponential+amplification+reaction.">Comprehensive evaluation of molecular enhancers of the isothermal exponential amplification reaction.</a> Sci Rep. 6 (1), 37837 (2016).</li><li>Wan, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+test+kit+for+visual+loop-mediated+isothermal+amplification+of+Salmonella+in+spiked+ready-to-eat+fruits+and+vegetables.">Development of a test kit for visual loop-mediated isothermal amplification of Salmonella in spiked ready-to-eat fruits and vegetables.</a> J Microbiol Methods. 169, 105830 (2020).</li><li>Curti, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+a+lyophilized+CRISPR-Cas12+assay+for+a+ensitive,+specific,+and+rapid+detection+of+SARS-CoV-2.">Evaluation of a lyophilized CRISPR-Cas12 assay for a ensitive, specific, and rapid detection of SARS-CoV-2.</a> Viruses. 13 (3), 420 (2021).</li><li>Joung, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+SARS-CoV-2+with+SHERLOCK+one-pot+testing.">Detection of SARS-CoV-2 with SHERLOCK one-pot testing.</a> N Engl J Med. 383 (15), 1492-1494 (2020).</li></ol>

M.P. and C.U. have filed a patent in Thailand on the formulations for multiplexed detection of SARS-CoV-2 RNA. R.K. declares no competing interests.

There are critical steps in this protocol. For area segregation, it is recommended to use separate spaces for nucleic acid extraction, mastermix preparation (pre amplification area), sample addition, and amplicon detection (post amplification area). Each area should be set by using a separate set of tools and equipment. Do not bring tools from one area into another area, especially from the post amplification area into the pre amplification area. Cleaning of working areas is necessary: one should clean working areas, pip...

CRISPR-based diagnostics for the detection of nucleic acid biomarkers was first reported in 20171,2,3,4, and since then, has been proven as next-generation diagnostics with Food and Drug Administration (FDA)-approved tests, particularly for the detection of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) RNA, in multiple countries5,6,7,8. Beyond coronavirus disease 2019 (COVID-19), the technologies have been demonstrated as effective for detecting diverse viruses and bacteria9,10,11,12,13, genetic disease mutations and deletions, and can be engineered to detect protein and small molecule biomarkers2,12. CRISPR-based diagnostics often combine isothermal amplification methods-such as recombinase polymerase amplification (RPA) or loop-mediated isothermal amplification (LAMP)14,15-with CRISPR-based detection using RNA-guided CRISPR-associated (Cas) enzymes with &#34;collateral&#34; endonuclease activity after target recognition3. The dual use of isothermal amplification and CRISPR-based detection confers several desirable attributes to the technologies, particularly high diagnostic accuracy approaching that of the gold-standard polymerase chain reaction (PCR), and capability to multiplex and detect small sequence differences, including single-nucleotide polymorphisms1,9.
The most accurate versions of CRISPR-based diagnostics, however, contain multiple components and steps and can be complicated to perform with non-experts or at the point of care (POC). To address this challenge of extending the use of highly accurate CRISPR-based diagnostics to POC settings, we have developed protocols to prepare premixed, lyophilized, recombinase-based isothermal amplification and CRISPR-based detection reactions, which are easy to use and store7. These protocols should complement existing excellent protocols on CRISPR-based diagnostics14, which contain additional information on the production of biochemical components needed for CRISPR-based diagnostics7, design guidelines1, and formulations using alternative isothermal amplification techniques2,14,15,16 and Cas enzymes12. Ultimately, we hope that CRISPR-based diagnostics can help realize rapid, inexpensive, and sensitive nucleic detection in settings where portable and instrumental-free analyses are required1,9,17.
We primarily use the combination of RPA and Cas13-based detection in our protocols. RPA functions at near-ambient temperatures (37-42 &#176;C), and therefore, has low energy and equipment requirements. Other isothermal amplification reactions require higher temperatures (LAMP, 60-65 &#176;C; strand-displacement amplification (SDA), 60 &#176;C; exponential amplification reaction (EXPAR), 55 &#176;C; and helicase-dependent amplification (HDA), 65 &#176;C)2. The design of RPA primers is also not complex, unlike LAMP primers, and can be extended to multiplexed amplification7,9,14. Even though multiplexing beyond two targets with RPA is difficult in practice, there are clear guidelines on how to design multiplexed RPA primers to minimize interference18.
While carryover contamination remains a big issue in the two-step workflow, the generated amplicons of RPA are small in size and less likely to cause carryover contamination compared to large concatemeric amplicons from LAMP14. RPA primers can be designed according to standard guidelines14: they are generally 25-35 nucleotide-long with melting temperatures of 54 to 67 &#176;C. The amplicon size should be smaller than 200 base pairs. The reverse transcriptase enzyme (RT) can be added to RPA to enable amplification from RNA, and in reverse transcription-RPA (RT-RPA), another enzyme Ribonuclease H (RNase H) is typically added in small amounts to help resolve the resulting RNA: DNA hybrid and promote the amplification reaction5,19. To allow T7 transcription for Cas13-based detection, the T7 RNA polymerase promoter can be placed at the 5&#39; end of the forward RPA primer.
After amplicons are generated from RPA, they can be detected with crRNA-programmed Cas enzymes. Among various Cas enzymes that can be used for amplicon detection, we prefer RNA-targeting Cas13 variants due to their high cleavage activity1 and well-characterized polynucleotide cleavage preferences7,9, the latter of which can be used for multiplexed detection. The crRNA sequence for Cas13 is designed to be complementary (reverse complement) to the target site in the produced RNA with spacer and direct repeat (DR) sequences. The crRNA sequence and RPA primers should not overlap, to avoid undesired Cas-based detection of off-target amplification products, which increases background and false positives14.
Cas-based detection relies on different detection modalities to monitor the cleavage of reporter nucleic acid molecules (RNA reporters for Cas13-based reactions)1,2,14. Different detection modalities include colorimetry, electrochemical readouts, fluorescence, sequencing readouts, and lateral flow strips2. We focus on the fluorescence readout given a variety of fluorophores and reporters such as cyanine 5 (Cy5), rhodamine X (ROX), and carboxyfluorescein (FAM), which can be effectively excited using a single blue LED light source, and their fluorescence analyzed by a microplate reader or a real-time thermal cycler7,14. In addition, fluorescence readout is easy to set up and allows continuous monitoring, which enables real-time quantitation. Multiplexed RPA preamplification and multiplexed Cas13-based detection using Cas enzymes can be combined with multicolor fluorescence readouts for the simultaneous detection of multiple genetic targets2,7.
In our protocols, we first isothermally amplify RNA with RT-RPA by adding the RNA sample to the lyophilized form of the RT-RPA reagent (Figure 1). During RT-RPA, the T7 promoter is added to the generated double-stranded DNA amplicon. Thereafter, the RPA products are transferred to the lyophilized Cas13-based detection, which also contains T7 RNA polymerase. This detection reaction will convert DNA amplicons into RNA (via T7 RNA polymerase), which can be readily detected with crRNA-programmed Cas13. Target-activated Cas13 will cleave reporter molecules to produce detectable fluorescence signal2,7,14. While the protocols here pertain to detection by Leptotrichia wadei (LwaCas13a), they can be extended to simultaneous, multiplexed detection of up to four targets using orthogonal Cas13 and Cas12 enzymes7,9. RPA and Cas-based detection reactions can also be combined into a single tube, albeit at a loss of sensitivity14.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/66703/66703fig01v2.jpg" /> 
Figure 1: CRISPR-based detection workflow. The workflow illustrates the detection of two target genes. First, regions of interest within the DNA target are isothermally amplified with RPA; the reaction can be performed with reverse transcription (RT-RPA) when detecting RNA targets. Thereafter, T7 transcription converts dsDNA amplicons to RNAs, which in turn are recognized by Cas13-crRNA complexes capable of eliciting collateral RNase activity upon target binding. Cleavage of quenched fluorescence reporters produces fluorescence signals that can be monitored using a microplate reader, visualized by an LED transilluminator, or used with a real-time thermal cycler. Abbreviations: CRISPR = Clustered Regularly Interspaced Short Palindromic Repeats; RT = reverse transcription; RPA = recombinase polymerase amplification; Cas = CRISPR-associated protein; LED = light-emitting diode. <a href="https://www.jove.com/files/ftp_upload/66703/66703fig01largev2.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
The key features of the protocols presented here are the premixing formulations for lyophilization. Premixing simplifies the reaction use and enhances reproducibility, but many components within RPA and Cas-based detection-particularly reverse transcription and some labile cofactors such as ATP are not stable in solution. Therefore, we formulate the premixed solutions such that they can be freeze-dried for long-term storage and easy transport and deployment1,9,20. Premixed, freeze-dried reagents also help improve the detection sensitivity, as higher sample volume (and therefore, higher DNA/RNA input) can be added to reconstitute the reaction10. In our formulations, we primarily use trehalose21 as the cryoprotectant in lyophilized RPA and Cas-based detection reactions7. In addition to reagent preservation, trehalose also promotes the reactions via increasing enzyme stabilization16,22,23,24 and decreasing melting temperatures of dsDNA23. Explorations of other stabilizers5,7,21,25,26 beyond trehalose may yield even more optimal formulations for different use scenarios.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Material</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Betaine solution</td>
			<td>Sigma-Aldrich</td>
			<td>B0300-1VL</td>
			<td></td>
		</tr>
		<tr>
			<td>DEPC-Treated water</td>
			<td>Invitrogen</td>
			<td>AM9915G</td>
			<td></td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>Merck</td>
			<td>3870-25GM</td>
			<td></td>
		</tr>
		<tr>
			<td>EpiScript reverse transcriptase</td>
			<td>Lucigen</td>
			<td>ERT12925K</td>
			<td></td>
		</tr>
		<tr>
			<td>Gly-Gly-Gly&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>SIA-50239-1G</td>
			<td></td>
		</tr>
		<tr>
			<td>LwaCas13a</td>
			<td>Producing in-house</td>
			<td></td>
			<td>Strain name:Leptotrichia wadei, Abbreviation: Lwa, Protein name: LwaCas13a</td>
		</tr>
		<tr>
			<td>Magnesium chloride solution, 1M</td>
			<td>Sigma-Aldrich</td>
			<td>M1028-10X1ML</td>
			<td></td>
		</tr>
		<tr>
			<td>NxGenT7 RNA polymerase</td>
			<td>Lucigen</td>
			<td>30223-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Poly(ethylene glycol)</td>
			<td>Sigma-Aldrich</td>
			<td>81300-1KG</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium acetate solution, 5M</td>
			<td>Sigma-Aldrich</td>
			<td>95843-100ML-F</td>
			<td></td>
		</tr>
		<tr>
			<td>Riobnucleotide Solution Mix</td>
			<td>NEB</td>
			<td>N0466L</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase H</td>
			<td>NEB</td>
			<td>M0297L</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>TCI</td>
			<td>TCI-S0111-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>Trehalose Dihydrate</td>
			<td>Sigma-Aldrich</td>
			<td>SIA-90210-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>Trizma hydrochloride solution, 1M, pH 7.4</td>
			<td>Sigma-Aldrich</td>
			<td>T2194-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>TwistAmp Basic kit</td>
			<td>TwistDx</td>
			<td>TABAS03KIT</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BluPAD Dual LED Blue/White light transilluminator</td>
			<td>Bio-Helix</td>
			<td>BP001CU</td>
			<td></td>
		</tr>
		<tr>
			<td>Dry Bath Dual Block</td>
			<td>ELITE</td>
			<td>4-2-EL-02-220</td>
			<td>Model: EL-02</td>
		</tr>
		<tr>
			<td>Fluorescence microplate reader</td>
			<td>Tecan</td>
			<td>30050303</td>
			<td>Model: Infinite 200 Pro</td>
		</tr>
		<tr>
			<td>Freeze dryer</td>
			<td>LABCONCO</td>
			<td>794001030</td>
			<td>FreeZone Triad Benchtop Freeze Dryer</td>
		</tr>
		<tr>
			<td>Microplate 384-well</td>
			<td>Greiner</td>
			<td>GDE0784076</td>
			<td>F-Bottom, small volume, Hibase, Med. Binding, Black</td>
		</tr>
		<tr>
			<td>Real-time thermal cycler (CFX Connect Real-Time PCR System)</td>
			<td>Bio-Rad</td>
			<td>185-5201</td>
			<td>Model: CFX Connect Optics Module</td>
		</tr>
		<tr>
			<td>Oligonucleotide</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>s-gene forward RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>GAAATTAATACGACTCAC 
			TATAGGGAGGTTTCAAAC 
			TTTACTTGCTTTACATAGA</td>
		</tr>
		<tr>
			<td>s-gene reverse RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>TCCTAGGTTGAAGA 
			TAACCCACATAATAAG</td>
		</tr>
		<tr>
			<td>n-gene forward RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>GAAATTAATACGACTC 
			ACTATAGGAACTTCTC 
			CTGCTAGAATGGCTG</td>
		</tr>
		<tr>
			<td>n-gene reverse RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>CAGACATTTTGCTCTC 
			AAGCTGGTTCAATC</td>
		</tr>
		<tr>
			<td>LwaCas13a-crRNA for the s gene</td>
			<td>Synthego</td>
			<td></td>
			<td>GAUUUAGACUACCCCAAAAAC 
			GAAGGGGACUAAAACGCAGCA 
			CCAGCUGUCCAACCUGAAGAAG</td>
		</tr>
		<tr>
			<td>LwaCas13a-crRNA for the n gene</td>
			<td>Synthego</td>
			<td></td>
			<td>GAUUUAGACUACCCCAAAAACG 
			AAGGGGACUAAAACAAAGCAAG 
			AGCAGCAUCACCGCCAUUGC</td>
		</tr>
		<tr>
			<td>FAM-polyU-IABkFQ reporter</td>
			<td>IDT</td>
			<td></td>
			<td>56-FAM/rUrUrUrUrU/3IABkFQ</td>
		</tr>
		<tr>
			<td>O-hannah_cytb_F RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>GAAATTAATACGACTCACTA 
			TAGGGTACGGATGAACCATA 
			CAAAACCTTCACGCAATCG</td>
		</tr>
		<tr>
			<td>O-hannah_cytb_R RPA primer</td>
			<td>IDT</td>
			<td></td>
			<td>AAGATCCATAGTAGATTC 
			CTCGTGCGATGTGGATA</td>
		</tr>
		<tr>
			<td>synT7crRNA13a_ O_hannah&#160;</td>
			<td>IDT</td>
			<td></td>
			<td>GCGCATCCATATTCTTCAT 
			CTGCATTTAGTTTTAGTCC 
			CCTTCGTTTTTGGGGTA 
			GTCTAAATCCCCTATAGT 
			GAGTCGTATTAATTTC</td>
		</tr>
	</tbody>
</table>

point-of-care crispr-based diagnostics with premixed and freeze-dried reagents

Molecular diagnostics by Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based detection have high diagnostic accuracy and attributes that are suitable for use at point-of-care settings such as fast turnaround times for results, convenient simple readouts, and no requirement of complicated instruments. However, the reactions can be cumbersome to perform at the point of care due to their many components and manual handling steps. Herein, we provide a step-by-step, optimized protocol for the robust detection of disease pathogens and genetic markers with recombinase-based isothermal amplification and CRISPR-based reagents, which are premixed and then freeze-dried in easily stored and ready-to-use formats. Premixed, freeze-dried reagents can be rehydrated for immediate use and retain high amplification and detection efficiencies. We also provide a troubleshooting guide for commonly found problems upon preparing and using premixed, freeze-dried reagents for CRISPR-based diagnostics, to make the detection platform more accessible to the wider diagnostic/genetic testing communities.

We highlight the kinetics of FAM fluorescence signal generation from the combined detection of s and n genes of SARS-CoV-2, and how the information was used to determine optimal conditions for lyophilized, premixed reaction formulations. In all cases, we included samples with Ct values well within the determined detection limit (LoD) (Ct ~31-33), as well as those with Ct at the LoD (Ct ~35-37)7, to allow differentiation of protocols wit...

Author Spotlight: Development of Simplified CRISPR-Based Tests for Rapid Detection of Infectious Diseases

Here, we present the step-by-step preparation of premixed, lyophilized recombinase-based isothermal amplification and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based reactions, which can be used for the detection of nucleic acid biomarkers of infectious disease pathogens or other genetic markers of interest.

Point-of-care CRISPR-based Diagnostics with Premixed and Freeze-dried Reagents

Molecular diagnostics by Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based detection have high diagnostic accuracy and attributes ...

point-care-crispr-based-diagnostics-with-premixed-freeze-dried

Research

JoVE Journal

Bioengineering

951 Views.  Vidyasirimedhi Institute of Science and Technology (VISTEC). Here, we present the step-by-step preparation of premixed, lyophilized recombinase-based isothermal amplification and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-based reactions, which can be used for the detection of nucleic acid biomarkers of infectious disease pathogens or other genetic markers of interest. 

Video: Author Spotlight: Development of Simplified CRISPR-Based Tests for Rapid Detection of Infectious Diseases

Bridging the Bio-Electronic Interface with Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and higher throughput. The incorporation of biological components onto biological microelectromechanical systems (bioMEMS) has shown great potential for achieving these goals. Microfabricated electronic chips allow for micrometer-scale features as well as an electrical connection for sensing and actuation. Functional biological components give the system the capacity for specific detection of analytes, enzymatic functions, and whole-cell capabilities. Standard microfabrication processes and bio-analytical techniques have been successfully utilized for decades in the computer and biological industries, respectively. Their combination and interfacing in a lab-on-a-chip environment, however, brings forth new challenges. There is a call for techniques that can build an interface between the electrode and biological component that is mild and is easy to fabricate and pattern.
Biofabrication, described here, is one such approach that has shown great promise for its easy-to-assemble incorporation of biological components with versatility in the on-chip functions that are enabled. Biofabrication uses biological materials and biological mechanisms (self-assembly, enzymatic assembly) for bottom-up hierarchical assembly. While our labs have demonstrated these concepts in many formats 1,2,3, here we demonstrate the assembly process based on electrodeposition followed by multiple applications of signal-based interactions. The assembly process consists of the electrodeposition of biocompatible stimuli-responsive polymer films on electrodes and their subsequent functionalization with biological components such as DNA, enzymes, or live cells 4,5. Electrodeposition takes advantage of the pH gradient created at the surface of a biased electrode from the electrolysis of water 6,7,. Chitosan and alginate are stimuli-responsive biological polymers that can be triggered to self-assemble into hydrogel films in response to imposed electrical signals 8. The thickness of these hydrogels is determined by the extent to which the pH gradient extends from the electrode. This can be modified using varying current densities and deposition times 6,7. This protocol will describe how chitosan films are deposited and functionalized by covalently attaching biological components to the abundant primary amine groups present on the film through either enzymatic or electrochemical methods 9,10. Alginate films and their entrapment of live cells will also be addressed 11. Finally, the utility of biofabrication is demonstrated through examples of signal-based interaction, including chemical-to-electrical, cell-to-cell, and also enzyme-to-cell signal transmission. 
Both the electrodeposition and functionalization can be performed under near-physiological conditions without the need for reagents and thus spare labile biological components from harsh conditions. Additionally, both chitosan and alginate have long been used for biologically-relevant purposes 12,13. Overall, biofabrication, a rapid technique that can be simply performed on a benchtop, can be used for creating micron scale patterns of functional biological components on electrodes and can be used for a variety of lab-on-a-chip applications.

This article describes a biofabrication approach: deposition of stimuli-responsive polysaccharides in the presence of biased electrodes to create biocompatible films which can be functionalized with cells or proteins. We demonstrate a bench-top strategy for the generation of the films as well as their basic uses for creating interactive biofunctionalized surfaces for lab-on-a-chip applications.

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and ...

Microfluidic Fabrication of Polymeric and Biohybrid Fibers with Predesigned Size and Shape

A &#8220;sheath&#8221; fluid passing through a microfluidic channel at low Reynolds number can be directed around another &#8220;core&#8221; stream and used to dictate the shape as well as the diameter of a core stream.&#160;Grooves in the top and bottom of a microfluidic channel were designed to direct the sheath fluid and shape the core fluid.&#160;By matching the viscosity and hydrophilicity of the sheath and core fluids, the interfacial effects are minimized and complex fluid shapes can be formed.&#160;Controlling the relative flow rates of the sheath and core fluids determines the cross-sectional area of the core fluid.&#160;Fibers have been produced with sizes ranging from 300 nm to ~1 mm, and fiber cross-sections can be round, flat, square, or complex as in the case with double anchor fibers. Polymerization of the core fluid downstream from the shaping region solidifies the fibers.&#160;Photoinitiated click chemistries are well suited for rapid polymerization of the core fluid by irradiation with ultraviolet light.&#160;Fibers with a wide variety of shapes have been produced from a list of polymers including liquid crystals, poly(methylmethacrylate), thiol-ene and thiol-yne resins, polyethylene glycol, and hydrogel derivatives. Minimal shear during the shaping process and mild polymerization conditions also makes the fabrication process well suited for encapsulation of cells and other biological components.

Two adjacent fluids passing through a grooved microfluidic channel can be directed to form a sheath around a prepolymer core; thereby&#160;determining both shape and cross-section. Photoinitiated polymerization, such as thiol click chemistry, is well suited for rapidly solidifying the core fluid into a microfiber with predetermined size and shape.

A &#8220;sheath&#8221; fluid passing through a microfluidic channel at low Reynolds number can be directed around another &#8220;core&#8221; stream and ...

Flying Insect Detection and Classification with Inexpensive Sensors

An inexpensive, noninvasive system that could accurately classify flying insects would have important implications for entomological research, and allow for the development of many useful applications in vector and pest control for both medical and agricultural entomology. Given this, the last sixty years have seen many research efforts devoted to this task. To date, however, none of this research has had a lasting impact. In this work, we show that pseudo-acoustic optical sensors can produce superior data; that additional features, both intrinsic and extrinsic to the insect&#8217;s flight behavior, can be exploited to improve insect classification; that a Bayesian classification approach allows to efficiently learn classification models that are very robust to over-fitting, and a general classification framework allows to easily incorporate arbitrary number of features. We demonstrate the findings with large-scale experiments that dwarf all previous works combined, as measured by the number of insects and the number of species considered.

We proposed a system that uses inexpensive, noninvasive pseudo-acoustic optical sensors to automatically and accurately detect, count, and classify flying insects based on their flying sound.

An inexpensive, noninvasive system that could accurately classify flying insects would have important implications for entomological research, and allow ...

Novel Atomic Force Microscopy Based Biopanning for Isolation of Morphology Specific Reagents against TDP-43 Variants in Amyotrophic Lateral Sclerosis

Because protein variants play critical roles in many diseases including TDP-43 in Amyotrophic Lateral Sclerosis (ALS), alpha-synuclein in Parkinson&#8217;s disease and beta-amyloid and tau in Alzheimer&#8217;s disease, it is critically important to develop morphology specific reagents that can selectively target these disease-specific protein variants to study the role of these variants in disease pathology and for potential diagnostic and therapeutic applications. We have developed novel atomic force microscopy (AFM) based biopanning techniques that enable isolation of reagents that selectively recognize disease-specific protein variants. There are two key phases involved in the process, the negative and positive panning phases. During the negative panning phase, phages that are reactive to off-target antigens are eliminated through multiple rounds of subtractive panning utilizing a series of carefully selected off-target antigens. A key feature in the negative panning phase is utilizing AFM imaging to monitor the process and confirm that all undesired phage particles are removed. For the positive panning phase, the target antigen of interest is fixed on a mica surface and bound phages are eluted and screened to identify phages that selectively bind the target antigen. The target protein variant does not need to be purified providing the appropriate negative panning controls have been used. Even target protein variants that are only present at very low concentrations in complex biological material can be utilized in the positive panning step. Through application of this technology, we acquired antibodies to protein variants of TDP-43 that are selectively found in human ALS brain tissue. We expect that this protocol should be applicable to generating reagents that selectively bind protein variants present in a wide variety of different biological processes and diseases.

Using atomic force microscopy in combination with biopanning technology we created a negative and positive biopanning system to acquire antibodies against disease-specific protein variants present in any biological material, even at low concentrations. We were successful in obtaining antibodies to TDP-43 protein variants involved in Amyotrophic Lateral Sclerosis.

Because protein variants play critical roles in many diseases including TDP-43 in Amyotrophic Lateral Sclerosis (ALS), alpha-synuclein in ...

Cell Labeling and Targeting with Superparamagnetic Iron Oxide Nanoparticles

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the target site while minimizing deleterious effects to off-target sites. Magnetic cell targeting is an efficient, safe, and straightforward delivery technique. Superparamagnetic iron oxide nanoparticles (SPION) are biodegradable, biocompatible, and can be endocytosed into cells to render them responsive to magnetic fields. The synthesis process involves creating magnetite (Fe3O4) nanoparticles followed by high-speed emulsification to form a poly(lactic-co-glycolic acid) (PLGA) coating. The PLGA-magnetite SPIONs are approximately 120 nm in diameter including the approximately 10 nm diameter magnetite core. When placed in culture medium, SPIONs are naturally endocytosed by cells and stored as small clusters within cytoplasmic endosomes. These particles impart sufficient magnetic mass to the cells to allow for targeting within magnetic fields. Numerous cell sorting and targeting applications are enabled by rendering various cell types responsive to magnetic fields. SPIONs have a variety of other biomedical applications as well including use as a medical imaging contrast agent, targeted drug or gene delivery, diagnostic assays, and generation of local hyperthermia for tumor therapy or tissue soldering.

Targeted cell delivery is useful in a variety of biomedical applications. The goal of this protocol is to use superparamagnetic iron oxide nanoparticles (SPION) to label cells and thereby enable magnetic cell targeting approaches for a high degree of control over cell delivery and localization.

Targeted delivery of cells and therapeutic agents would benefit a wide range of biomedical applications by concentrating the therapeutic effect at the ...

Magnetic Levitation Coupled with Portable Imaging and Analysis for Disease Diagnostics

Currently, many clinical diagnostic procedures are complex, costly, inefficient, and inaccessible to a large population in the world. The requirements for specialized equipment and trained personnel require that many diagnostic tests be performed at remote, centralized clinical laboratories. Magnetic levitation is a simple yet powerful technique and can be applied to levitate cells, which are suspended in a paramagnetic solution and placed in a magnetic field, at a position determined by equilibrium between a magnetic force and a buoyancy force. Here, we present a versatile platform technology designed for point-of-care diagnostics which uses magnetic levitation coupled to microscopic imaging and automated analysis to determine the density distribution of a patient's cells as a useful diagnostic indicator. We present two platforms operating on this principle: (i) a smartphone-compatible version of the technology, where the built-in smartphone camera is used to image cells in the magnetic field and a smartphone application processes the images and to measures the density distribution of the cells and (ii) a self-contained version where a camera board is used to capture images and an embedded processing unit with attached thin-film-transistor (TFT) screen measures and displays the results. Demonstrated applications include: (i) measuring the altered distribution of a cell population with a disease phenotype compared to a healthy phenotype, which is applied to sickle cell disease diagnosis, and (ii) separation of different cell types based on their characteristic densities, which is applied to separate white blood cells from red blood cells for white blood cell cytometry. These applications, as well as future extensions of the essential density-based measurements enabled by this portable, user-friendly platform technology, will significantly enhance disease diagnostic capabilities at the point of care.

We present a magnetic levitation technique coupled with automated imaging and analysis in both a smartphone-compatible device and a device with embedded imaging and processing. This is applied to measure the density distribution of cells with two demonstrated biomedical applications: sickle cell disease diagnosis and separating white and red blood cells.

Currently, many clinical diagnostic procedures are complex, costly, inefficient, and inaccessible to a large population in the world. The requirements for ...

Nanosensors to Detect Protease Activity In Vivo for Noninvasive Diagnostics

Proteases are multi-functional enzymes that specialize in the hydrolysis of peptide-bonds and control broad biological processes including homeostasis and allostasis. Moreover, dysregulated protease activity drives pathogenesis and is a functional biomarker of diseases such as cancer; therefore, the ability to detect protease activity in vivo may provide clinically relevant information for biomedical diagnostics. The goal of this protocol is to create nanosensors that probe for protease activity in vivo by producing a quantifiable signal in urine. These protease nanosensors consist of two components: a nanoparticle and substrate. The nanoparticle functions to increase circulation half-life and substrate delivery to target disease sites. The substrate is a short peptide sequence (6-8 AA), which is designed to be specific to a target protease or group of proteases. The substrate is conjugated to the surface of the nanoparticle and is terminated by a reporter, such as a fluorescent marker, for detection. As dysregulated proteases cleave the peptide substrate, the reporter is filtered into urine for quantification as a biomarker of protease activity. Herein we describe construction of a nanosensor for matrix metalloproteinase 9 (MMP9), which is associated with tumor progression and metastasis, for detection of colorectal cancer in a mouse model.

Nanosensors to Detect Protease Activity In Vivo for Noninvasive Diagnostics

Proteases are tightly regulated enzymes involved in fundamental biological processes, and dysregulated protease activity drives progression of complex diseases such as cancer. This method&#39;s goal is to create nanosensors that measure protease activity in vivo by producing a cleavage signal that is detectable from host urine and discriminates disease.

Proteases are multi-functional enzymes that specialize in the hydrolysis of peptide-bonds and control broad biological processes including homeostasis and ...

Quantifying Intermembrane Distances with Serial Image Dilations

A recently-described extracellular nanodomain, termed the perinexus, has been implicated in ephaptic coupling, which is an alternative mechanism for electrical conduction between cardiomyocytes. The current method for quantifying this space by manual segmentation is slow and has low spatial resolution.We developed an algorithm that uses serial image dilations of a binary outline to count the number of pixels between two opposing 2 dimensional edges.This algorithm requires fewer man hours and has a higher spatial resolution than the manual method while preserving the reproducibility of the manual process.In fact, experienced and novice investigators were able to recapitulate the results of a previous study with this new algorithm.The algorithm is limited by the human input needed to manually outline the perinexus and computational power mainly encumbered by a pre-existing pathfinding algorithm.However, the algorithm&#39;s high-throughput capabilities, high spatial resolution and reproducibility make it a versatile and robust measurement tool for use across a variety of applications requiring the measurement of the distance between any 2-dimensional (2D) edges.

The purpose of this algorithm is to continuously measure the distance between two 2-dimensional edges using serial image dilations and pathfinding. This algorithm can be applied to a variety of fields such as cardiac structural biology, vascular biology, and civil engineering.

A recently-described extracellular nanodomain, termed the perinexus, has been implicated in ephaptic coupling, which is an alternative mechanism for ...

Using Nanoplasmon-Enhanced Scattering and Low-Magnification Microscope Imaging to Quantify Tumor-Derived Exosomes

Infected or malignant cells frequently secrete more exosomes, leading to elevated levels of disease-associated exosomes in the circulation. These exosomes have the potential to serve as biomarkers for disease diagnosis and to monitor disease progression and treatment response. However, most exosome analysis procedures require exosome isolation and purification steps, which are usually time-consuming and labor-intensive, and thus of limited utility in clinical settings. This report describes a rapid procedure to analyze specific biomarkers on the outer membrane of exosomes without requiring separate isolation and purification steps. In this method, exosomes are captured on the surface of a slide by exosome-specific antibodies and then hybridized with nanoparticle-conjugated antibody probes specific to a disease. After hybridization, the abundance of the target exosome population is determined by analyzing low-magnification dark-field microscope (LMDFM) images of the bound nanoparticles. This approach can be easily adopted for research and clinical use to analyze membrane-associated exosome biomarkers linked to disease.

Clinical translation of exosome-derived biomarkers for diseased and malignant cells is hindered by the lack of rapid and accurate quantification methods. This report describes the use of low-magnification dark-field microscope images to quantify specific exosome subtypes in small volume serum or plasma samples.

Infected or malignant cells frequently secrete more exosomes, leading to elevated levels of disease-associated exosomes in the circulation. These exosomes ...

Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases

The lack of relevant in vitro neural models is an important obstacle on medical progress for neuropathologies. Establishment of relevant cellular models is crucial both to better understand the pathological mechanisms of these diseases and identify new therapeutic targets and strategies. To be pertinent, an in vitro model must reproduce the pathological features of a human disease. However, in the context of neurodegenerative disease, a relevant in vitro model should provide neural cell replacement as a valuable therapeutic opportunity. 
Such a model would not only allow screening of therapeutic molecules but also can be used to optimize neural protocol differentiation [for example, in the context of transplantation in Parkinson's disease (PD)]. This study describes two in vitro protocols of 1) human glioblastoma development within a human neural organoids (NO) and 2) neuron dopaminergic (DA) differentiation generating a three-dimensional (3D) organoid. For this purpose, a well-standardized protocol was established that allows the production of size-calibrated neurospheres derived from human embryonic stem cell (hESC) differentiation. The first model can be used to reveal molecular and cellular events occurring during in glioblastoma development within the neural organoid, while the DA organoid not only represents a suitable source of DA neurons for cell therapy in Parkinson's disease but also can be used for drug testing.

This study introduces and describes protocols to derive two specific human neural organoids&#160;as a relevant and accurate model for studying 1) human glioblastoma development within human neural organoids exclusively in humans and 2) neuron dopaminergic differentiation generating a three-dimensional organoid.

The lack of relevant in vitro neural models is an important obstacle on medical progress for neuropathologies. Establishment of relevant cellular models ...

Point-of-care CRISPR-based Diagnostics with Premixed and Freeze-dried Reagents

Summary

Explore More Videos

Chapters in this video

Bridging the Bio-Electronic Interface with Biofabrication

Microfluidic Fabrication of Polymeric and Biohybrid Fibers with Predesigned Size and Shape

Flying Insect Detection and Classification with Inexpensive Sensors

Novel Atomic Force Microscopy Based Biopanning for Isolation of Morphology Specific Reagents against TDP-43 Variants in Amyotrophic Lateral Sclerosis

Cell Labeling and Targeting with Superparamagnetic Iron Oxide Nanoparticles

Magnetic Levitation Coupled with Portable Imaging and Analysis for Disease Diagnostics

Nanosensors to Detect Protease Activity In Vivo for Noninvasive Diagnostics

Quantifying Intermembrane Distances with Serial Image Dilations

Using Nanoplasmon-Enhanced Scattering and Low-Magnification Microscope Imaging to Quantify Tumor-Derived Exosomes

Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases