A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
تم تصميم نظام السيارات المستدامة تنظم البكتيرية لعلاج التلوث النفطي باستخدام معيار أجزاء DNA للتبادل (BioBricks). وهندسيا E. القولونية للحط من سلالة الألكانات عبر الأكسدة β في البيئات المائية السامة. أظهرت الإنزيمات منها من الأنواع المختلفة ألكان النشاط التدهور. بالإضافة إلى ذلك، لزيادة التسامح ن الهكسان عن طريق إدخال جينات من البكتيريا التي تتحمل ألكان.
هذا العمل يطرح مجموعة أدوات التي تمكن من تحويل الألكانات من الإشريكية القولونية، ويقدم دليلا على مبدأ إمكانية تطبيقه. مجموعة الأدوات يتكون من أجزاء متعددة قابلة للتبديل القياسية (BioBricks) 9 التصدي لتحويل الألكانات، وتنظيم التعبير الجيني والبقاء على قيد الحياة في البيئات الغنية الهيدروكربونية السامة.
تم تنفيذ مسار ثلاث خطوات لتدهور ألكان في E. الإشريكية لتمكين تحويل الألكانات متوسطة وطويلة السلسلة إلى alkanols كل منها، والأحماض alkanals alkanoic-في نهاية المطاف. ويستقلب هذا الأخير عبر مسار β للأكسدة الأصلية. لتسهيل أكسدة المتوسطة سلسلة الألكانات (C5-C13) وcycloalkanes (C5-C8)، وأربعة جينات (alkB2، rubA3، rubA4 والمطاطية) من نظام هيدروكسيلاز ألكان من Gordonia SP. تحولت TF6 8،21 في E. القولونية. لتحويلسلسلة طويلة الألكانات (C15-C36)، تم تنفيذ هذا الجين لادا من thermodenitrificans Geobacillus. لمزيد من الخطوات المطلوبة لعملية التدهور، وأدخلت ADH وALDH (القادمة من thermodenitrificans G.) 10،11. تم قياس النشاط المقايسات الخلية الراحة. لكل خطوة الأكسدة، لوحظ نشاط انزيم.
لتحسين كفاءة عملية، وكان المستحث فقط التعبير في ظل ظروف انخفاض الجلوكوز: تم استخدام الركيزة المروج التنظيم، pCaiF. pCaiF موجود في E. K12 القولونية وينظم التعبير عن الجينات المسؤولة عن تدهور مصادر الكربون غير الجلوكوز.
ونفذ باستخدام الجينات التسامح المذيبات، وPhPFDα β، وكلاهما من Pyrococcus horikoshii OT3 - الجزء الأخير من مجموعة الأدوات - استهداف البقاء. يمكن المذيبات العضوية لحث على الإجهاد وانخفاض الخلايا البقاء على قيد الحياة من قبل affectin سلباغرام من البروتين للطي. كما المحرمين، وPhPFDα β تحسين عملية مثل البروتين للطي في ظل وجود من الألكانات. وقد لوحظت التعبير عن هذه الجينات أدى إلى التسامح الذي أبداه الهيدروكربونية تحسين معدل زيادة النمو (إلى 50٪) في الوجود من 10٪ N-الهكسان في ثقافة المتوسط.
تلخيص، فإن النتائج تشير إلى أن مجموعة أدوات تمكن E. الإشريكية لتحويل وتحمل النفط والغاز في البيئات المائية. على هذا النحو، فإنه يمثل خطوة أولية نحو إيجاد حل مستدام لإصلاح النفطية باستخدام نهج البيولوجيا التركيبية.
Oil pollution is among the most serious causes of environmental contamination, and greatly affects ecosystems, businesses and communities 3. Solutions are for example required to battle the continuous oil pollution originating from the oil sands tailing waters in Alberta, Canada. During the process of oil extraction from oil sands, bitumen, a semi-solid oxidized form of oil, is removed using thermal recovery techniques that consume about 3.1 barrels of water per single barrel of oil 1. Oil contaminated process water, mainly originating from a local river, is stored in tailing ponds after bitumen extraction. A more effective recycling of process water in order to reduce the need for freshwater uptake is needed. To facilitate the bitumen extraction and to ensure that downstream sites meet water quality guidelines for the protection of aquatic ecosystems, process water treatments are rapidly evolving 3.
To treat pollution of organic compounds, bioremediation technologies employing microorganisms are presently encouraged 1. Alkanes are the most abundant family of hydrocarbons in crude oil, containing 5 to 40 carbon atoms per molecule 7, 21. Many bacteria are known to degrade alkanes of various lengths via sequential oxidation of the terminal methyl group forming first alcohols, then aldehydes and finally fatty acids 8. Within this iGEM project several enzymes from different organisms were expressed and characterized, and made available via the BioBrick standard and Registry of Standard Biological Parts.
The well-studied alkane hydroxylase system of Gordonia sp. TF6 facilitates the initial oxidation step of C5-C13 alkanes along with that of C5-C8 cycloalkanes using a minimum of four components: alkB2 (alkane 1-monooxygenase), rubA3, rubA4 (two rubredoxins) and RubB (rubredoxin reductase) 8, 21. Oxidation of long-chain alkanes (ranging from C15 up to C36) is reported to be performed by ladA, a flavoprotein alkane monooxygenase from Geobacillus thermodinitrificans NG-80-2 7, 15, 18, 22. LadA forms a catalytic complex with flavin mononucleotide (FMN) that utilizes atomic oxygen for oxidation. This results in the conversion of alkanes into the corresponding primary alkanol. The alcohols are further oxidized by alcohol and aldehyde dehydrogenases to fatty acids, which readily enter the β-oxidation pathway 7, 21. A zinc-independent alcohol dehydrogenase from the thermophillic bacterium Geobacillus thermoleovorans B23 oxidizes medium-chain alkanols into their respective alkanals, using NAD+ as a cofactor 10. Aldehyde dehydrogenase from the same bacterium is able to catalyze the NAD+-dependent final step in the medium-chain oxidation 11.
In order to reduce induction costs and to maintain optimal proliferation of the bacterial system, the promoter pCaiF from E.coli was characterized. This promoter can regulate expression of the hydrocarbon degradation pathway components, and is regulated by cAMP-Crp levels, which in turn depend on glucose levels 6. At high extracellular glucose concentrations in the environment the cellular cAMP (cyclic Adenosine Mononucleotide Phosphate) level was low through the inhibition of adenylyl cyclase as a side effect of PTS mediated glucose transport. Conversely, during limitation (low glucose concentrations) the cAMP level increased and Crp bound to cAMP forming the complex, cAMP-Crp, which bound pCaiF and activated transcription of the downstream components 6, 14.
Wildtype E. coli can only tolerate moderate concentrations of hydrocarbons. To complete the toolkit, tolerance to hydrocarbons had to be addressed. Several organic solvent-tolerant bacteria are known to survive in water-solvent two-phase systems 12. Molecular components known to increase tolerance are chaperones that facilitate the correct folding of proteins. The prefoldin system from Pyrococcus horikoshii OT3, consisting of the proteins phPFDα and phPFDβ, was shown to increase hydrocarbon-tolerance 17.
The alkane conversion toolkit was constructed following the BioBrick principle, which is documented at the Registry of Standard Biological Parts 9. BioBricks are plasmids containing a specific functional insert that is flanked by 4 predefined restriction sites. The BioBrick inserts can be extended flexibly, allowing the construction of biological systems with new functions.
1. BioBrick الجمعية
اسم | تسلسل | تعليق |
بادئة | 5 'GAATTCGCGGCCGCTTCTAG3' | |
5 'GAATTCGCGGCCGCTTCTAGAG 3' | إذا كان الجزء التالي هو تسلسل الترميز أو أي الجزء الذي يبدأ ب "ATG" | |
لاحقة | 5 'TACTAGTAGCGGCCGCTGCAG 3' |
تم إجراء هذا الاختبار يعتمد على الطريقة الموصوفة من قبل فوجي وآخرون (2004).
3. ألكان الفحص إنزيم تحويل، وفيالمختبر
تم إجراء هذا الفحص بشكل أساسي وفقا لطريقة وصفها لي وآخرون (2008).
4. إيثيل أسيتات استخراج النفط والغاز وقياسات تركيز
معدل | درجة حرارة [° C] | الوقت [دقيقة] |
0 | 50 | 7.5 |
50 | 90 | 1.0 |
50 | 110 | 2.0 |
50 | 130 | 2.0 |
50 | 145 | 2.0 |
50 | 160 | 2.0 |
50 | 170 | 2.0 |
50 | 185 | 2.0 |
50 | 210 | 2.0 |
50 | 250 | 2.0 |
50 | 320 | 2.0 |
5. الكحول / الفحص ألدهيد نشاط إنزيم
تم إجراء هذا الفحص بشكل أساسي وفقا لطريقة وصفها آخرون كاتو.(2010).
6. pCaiF توصيف
7. التسامح الفحص
8. Homolog التفاعل رسم الخرائط
Alkane conversion
The activity of the three oxidation steps from the alkane to the respective fatty acid was evaluated using resting cell assays and enzyme activity measurements. The results are presented following the pathway reactions (1) alkane hydroxylase, (2) alcohol dehydrogenase and (3) aldehyde dehydrogenase.
For the first step, different plasmids were constructed for medium and long-chain alkanes. The plasmid BBa_...
ويستخدم مبدأ BioBrick لبناء هيكل للتدهور الألكانات وتم الحصول على دليل على مبدأ واحد للمكونات مجموعة الأدوات. ويقترح عدة فحوصات لقياس في الجسم الحي والنشاط في المختبر من الانزيمات ألكان مسار المهينة. العمل المقدم يوضح بنجاح عددا من الأساليب التي يمكن استخدامه...
الإعلان عن أي تضارب في المصالح.
وقد وضعت التجارب التي أجريت في هذه المادة عن طريق الفيديو للمسابقة الدولية آلة المعدلة وراثيا 9. والكتاب أود أن أشكر أعضاء الفريق لوقا iGEM Bergwerff، بيتر فان TM Boheemen، Cnossen Jelmer، هوغو F. روخاس كويتو ورامون فان دير فالك ل المساعدة في البحث. نشكر هان دي Winde، ستيفان دي كوك ويلدرم Esengül للمناقشات مفيدة واستضافة هذا البحث. وأيد هذا العمل من قبل وزارة TU جامعة دلفت للتكنولوجيا الحيوية، والمعلوماتية الحيوية مختبر دلفت، TU دلفت إدارة Bionanoscience، زيت ساندز القيادة مبادرة (OSLI)، studentenuitzendbureau مسمار، هولندا مبادرة الجينوم، مركز Kluyver، Nederlandse Vereniging Biotechnologische (مؤسسة Stichting التكنولوجيا الحيوية هولندا) ، DSM، Geneart، غرينر الحيوي واحدة وGenencor.
Name | Company | Catalog Number | Comments |
E. coli K12 | New England Biolabs | C2523H | |
Octane | Fluka | 74822 | |
Hexadecane | Fluka | 52209 | |
octanol-1 | Fluka | 95446 | |
dodecanol-1 | Sigma-Aldrich | 126799 | |
Hexane | Sigma-Aldrich | 296090 | |
NADH | Sigma-Aldrich | N4505 | |
FMN | Sigma-Aldrich | F2253 | |
MgSO4 | J.T. Baker Casno | 7487 889 | |
Triton X-100 | Sigma-Aldrich | T8787 | |
T4 ligase | New England Biolabs | M0202L | |
Gas chromatograph | |||
Cell disrupter | LA Biosystems | CD-019 | |
Spectrophotometer | Amersham pharmacia | spec 2000 | |
Plate reader | Tecan Group Ltd. | Magellan v7.0 | |
Incubator | Innova, 44 | ||
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398014 | Alkane Hydroxylase System Resistance: Chloramphenicol |
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398027 | ladA Protein Generator Resistance: Chloramphenicol |
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398018 | ADH generator Resistance: Chloramphenicol |
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398030 | ALDH generator Resistance: Chloramphenicol |
BioBrickTM K398326: pCaiF | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398326 | pCaiF promoter Resistance: Chloramphenicol |
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398331 | pCaiF measurement device Resistance: Chloramphenicol |
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398406 | Solvent tolerance cluster Resistance: Chloramphenicol |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved