A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
אוטומטי קיימא ויסות מערכת חיידקים לטיפול של זיהומי נפט תוכנן באמצעות חלקי DNA החלפה סטנדרטיים (BioBricks). מהונדס א coli מתח שמש לבזות אלקאנים באמצעות β-חמצון בסביבות מימיות רעילות. את האנזימים המתאימים ממינים שונים הראו פעילות alkane שפלה. בנוסף, סובלנות מוגברת ל N-הקסאן הושג על ידי החדרת גנים מחיידקי alkane סובלניים.
עבודה זו מעבירה קדימה ערכת כלים המאפשרת את ההמרה של אלקאנים ידי חיידקי Escherichia ומציג הוכחה לעיקרון תחולתו. ערכת הכלים מורכבים ממספר חלקים סטנדרטיים להחלפה (BioBricks) 9 העוסקים בהמרות של אלקאנים, הוויסות של ביטוי גנים וההישרדות בסביבה רעילה פחמימנים עשירות.
מסלול בן שלושת שלבים לפירוק alkane יושם בE. coli כדי לאפשר המרה של טווח הבינוניים וארוך שרשרת אלקאנים לalkanols בהתאמה, alkanals וחומצות alkanoic-סופו של דבר. האחרון היו מפורק דרך מסלול יליד β-חמצון. כדי להקל את החמצון של אלקאנים בינוני שרשרת (C5-C13) וcycloalkanes (C5-C8), ארבעה גנים (alkB2, rubA3, rubA4 וrubB) של מערכת hydroxylase alkane מגורדוניה SP. TF6 8,21 נהפכו E. coli. להמרה שלאלקאנים ארוכי שרשרת (C15-C36), גן LADA מthermodenitrificans Geobacillus יושמו. לצעדים הנוספים הנדרשים בתהליך ההידרדרות, ADH וALDH (שמקורם thermodenitrificans ג') הוכנסו 10,11. הפעילות נמדדה על ידי מבחני תא מנוחה. לכל שלב חמצונים, פעילות אנזים נצפתה.
כדי לייעל את יעילות התהליך, הביטוי היה מושרה רק בתנאי הגלוקוז נמוכים: אמרגן מצע מוסדר, pCaiF, היה בשימוש. pCaiF נוכח בE. coli K12 ומסדיר את הביטוי של הגנים הקשורים בפירוק של מקורות הפחם שאינה גלוקוז.
חלקיו האחרונים של ערכת הכלים - מיקוד הישרדות - יושם באמצעות גני ממס סובלנות, PhPFDα וβ, שני מ furiosus horikoshii הארכת זמן 3. ממסים אורגניים יכולים לגרום למתח תא וירידה בשרידות על ידי שלילי affectinקיפול חלבונים גרם. כמלווים, PhPFDα וβ לשפר את התהליך למשל החלבון מתקפל תחת הנוכחות של אלקאנים. הביטוי של גנים אלה הובילו לסובלנות פחמימנים משופרות שמוצגת על ידי עלייה בשיעור צמיחה (עד 50%) בנוכחות של 10% n-הקסאן במדיום התרבות נצפה.
בסיכום, התוצאות מצביעות על כך שארגז הכלים מאפשר E. coli כדי להמיר ולסבול פחמימנים בסביבות מימיות. ככזה, הוא מהווה צעד ראשון לקראת פתרון בר קיימא ל- משיקום שמן בעזרת גישת ביולוגיה סינטתית.
Oil pollution is among the most serious causes of environmental contamination, and greatly affects ecosystems, businesses and communities 3. Solutions are for example required to battle the continuous oil pollution originating from the oil sands tailing waters in Alberta, Canada. During the process of oil extraction from oil sands, bitumen, a semi-solid oxidized form of oil, is removed using thermal recovery techniques that consume about 3.1 barrels of water per single barrel of oil 1. Oil contaminated process water, mainly originating from a local river, is stored in tailing ponds after bitumen extraction. A more effective recycling of process water in order to reduce the need for freshwater uptake is needed. To facilitate the bitumen extraction and to ensure that downstream sites meet water quality guidelines for the protection of aquatic ecosystems, process water treatments are rapidly evolving 3.
To treat pollution of organic compounds, bioremediation technologies employing microorganisms are presently encouraged 1. Alkanes are the most abundant family of hydrocarbons in crude oil, containing 5 to 40 carbon atoms per molecule 7, 21. Many bacteria are known to degrade alkanes of various lengths via sequential oxidation of the terminal methyl group forming first alcohols, then aldehydes and finally fatty acids 8. Within this iGEM project several enzymes from different organisms were expressed and characterized, and made available via the BioBrick standard and Registry of Standard Biological Parts.
The well-studied alkane hydroxylase system of Gordonia sp. TF6 facilitates the initial oxidation step of C5-C13 alkanes along with that of C5-C8 cycloalkanes using a minimum of four components: alkB2 (alkane 1-monooxygenase), rubA3, rubA4 (two rubredoxins) and RubB (rubredoxin reductase) 8, 21. Oxidation of long-chain alkanes (ranging from C15 up to C36) is reported to be performed by ladA, a flavoprotein alkane monooxygenase from Geobacillus thermodinitrificans NG-80-2 7, 15, 18, 22. LadA forms a catalytic complex with flavin mononucleotide (FMN) that utilizes atomic oxygen for oxidation. This results in the conversion of alkanes into the corresponding primary alkanol. The alcohols are further oxidized by alcohol and aldehyde dehydrogenases to fatty acids, which readily enter the β-oxidation pathway 7, 21. A zinc-independent alcohol dehydrogenase from the thermophillic bacterium Geobacillus thermoleovorans B23 oxidizes medium-chain alkanols into their respective alkanals, using NAD+ as a cofactor 10. Aldehyde dehydrogenase from the same bacterium is able to catalyze the NAD+-dependent final step in the medium-chain oxidation 11.
In order to reduce induction costs and to maintain optimal proliferation of the bacterial system, the promoter pCaiF from E.coli was characterized. This promoter can regulate expression of the hydrocarbon degradation pathway components, and is regulated by cAMP-Crp levels, which in turn depend on glucose levels 6. At high extracellular glucose concentrations in the environment the cellular cAMP (cyclic Adenosine Mononucleotide Phosphate) level was low through the inhibition of adenylyl cyclase as a side effect of PTS mediated glucose transport. Conversely, during limitation (low glucose concentrations) the cAMP level increased and Crp bound to cAMP forming the complex, cAMP-Crp, which bound pCaiF and activated transcription of the downstream components 6, 14.
Wildtype E. coli can only tolerate moderate concentrations of hydrocarbons. To complete the toolkit, tolerance to hydrocarbons had to be addressed. Several organic solvent-tolerant bacteria are known to survive in water-solvent two-phase systems 12. Molecular components known to increase tolerance are chaperones that facilitate the correct folding of proteins. The prefoldin system from Pyrococcus horikoshii OT3, consisting of the proteins phPFDα and phPFDβ, was shown to increase hydrocarbon-tolerance 17.
The alkane conversion toolkit was constructed following the BioBrick principle, which is documented at the Registry of Standard Biological Parts 9. BioBricks are plasmids containing a specific functional insert that is flanked by 4 predefined restriction sites. The BioBrick inserts can be extended flexibly, allowing the construction of biological systems with new functions.
1. BioBrick עצרת
שם | רצף | הערה |
קידומת | 5 'GAATTCGCGGCCGCTTCTAG3' | |
5 'GAATTCGCGGCCGCTTCTAGAG 3' | אם החלק הבא הוא רצף קידוד או כל חלק שמתחיל עם "ATG" | |
סיומת | 5 'TACTAGTAGCGGCCGCTGCAG 3' |
בדיקה זו מתבצעת על בסיס השיטה שתוארה על ידי פוג'י et al. (2004).
3. Assay Alkane המרת אנזים, במבחנה
בדיקה זו בוצעה למעשה על פי השיטה שתוארה על ידי לי אח'. (2008).
4. הפקת אתיל יצטט פחמימנים מדידות ריכוז
קצב | טמפרטורה [° C] | זמן [דקות] |
0 | 50 | 7.5 |
50 | 90 | 1.0 |
50 | 110 | 2.0 |
50 | 130 | 2.0 |
50 | 145 | 2.0 |
50 | 160 | 2.0 |
50 | 170 | 2.0 |
50 | 185 | 2.0 |
50 | 210 | 2.0 |
50 | 250 | 2.0 |
50 | 320 | 2.0 |
5. אלכוהול / Assay הפעילות dehydrogenase אלדהיד
בדיקה זו בוצעה למעשה על פי השיטה שתוארה על ידי קאטו et al.(2010).
6. אפיון pCaiF
7. Assay סובלנות
8. מיפוי אינטראקצית homolog
Alkane conversion
The activity of the three oxidation steps from the alkane to the respective fatty acid was evaluated using resting cell assays and enzyme activity measurements. The results are presented following the pathway reactions (1) alkane hydroxylase, (2) alcohol dehydrogenase and (3) aldehyde dehydrogenase.
For the first step, different plasmids were constructed for medium and long-chain alkanes. The plasmid BBa_...
עיקרון BioBrick משמש לבניית מארז להשפלה של אלקאנים והוכחת עיקרון של הרכיבים הבודדים של ערכת הכלים הושגה. כמה מבחנים מוצעים למדידת in vivo ו במבחנת פעילות של אנזימי מסלול משפיל alkane. העבודה הוצגה מדגימה מספר השיטות שיכולים לשמש כדי לקבוע פעילויות וביטוי אנזים באורג...
אין ניגודי האינטרסים הכריזו.
הניסויים שבוצעו בוידאו מאמר זה פותחו לתחרות המהונדסת גנטי המכונית הבינלאומית 9. המחברים מבקשים להודות לחברי צוות iGEM לוק Bergwerff, פיטר ואן TM Boheemen, Jelmer Cnossen, הוגו פ Cueto רוחאס ורמון ואן דר וולק ל הסיוע במחקר. אנו מודים האן דה Winde, סטפן דה קוק וEsengül ילדרים לדיונים מועילים ואירוח מחקר זה. עבודה זו נתמכה על ידי TU Delft אוניברסיטת המחלקה לביוטכנולוגיה, ביואינפורמטיקה דלפט המעבדה, TU Delft מחלקת Bionanoscience, שמן חולות מנהיגות היוזמה (OSLI), Stud studentenuitzendbureau, יוזמת ג'נומיקס הולנד, Kluyver המרכז, Nederlandse Biotechnologische Vereniging (Stichting ביוטכנולוגיה Nederland) , ה-DSM, Geneart, גריינר ביו האחד וGenencor.
Name | Company | Catalog Number | Comments |
E. coli K12 | New England Biolabs | C2523H | |
Octane | Fluka | 74822 | |
Hexadecane | Fluka | 52209 | |
octanol-1 | Fluka | 95446 | |
dodecanol-1 | Sigma-Aldrich | 126799 | |
Hexane | Sigma-Aldrich | 296090 | |
NADH | Sigma-Aldrich | N4505 | |
FMN | Sigma-Aldrich | F2253 | |
MgSO4 | J.T. Baker Casno | 7487 889 | |
Triton X-100 | Sigma-Aldrich | T8787 | |
T4 ligase | New England Biolabs | M0202L | |
Gas chromatograph | |||
Cell disrupter | LA Biosystems | CD-019 | |
Spectrophotometer | Amersham pharmacia | spec 2000 | |
Plate reader | Tecan Group Ltd. | Magellan v7.0 | |
Incubator | Innova, 44 | ||
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398014 | Alkane Hydroxylase System Resistance: Chloramphenicol |
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398027 | ladA Protein Generator Resistance: Chloramphenicol |
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398018 | ADH generator Resistance: Chloramphenicol |
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398030 | ALDH generator Resistance: Chloramphenicol |
BioBrickTM K398326: pCaiF | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398326 | pCaiF promoter Resistance: Chloramphenicol |
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398331 | pCaiF measurement device Resistance: Chloramphenicol |
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- | Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts | BBa_K398406 | Solvent tolerance cluster Resistance: Chloramphenicol |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved