ويدعم عمل في المختبر، ولاستون بوكانان على التنميط المرحلة خلية من نوع والتنموية المحددة من قبل المشروع أغرون-OMICS (منحة # LSHG-CT-2006-037704) في إطار أولى برنامج ال 6 من المفوضية الأوروبية. ويدعم عمل في المختبر على خلايا جيفورد من نوع التنميط محددة من منحة BBSRC محقق جديد (BB/H019502/1). تم الحصول على خطوط KC274 KC464 ول arabidopsis من AAR ويب (جامعة كامبردج).

1. البروتوبلازم الجيل <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> حصاد الأوراق والمواد مقطعة إلى شرائح 1 مم واسعة (الشكل 1) مع شفرة حلاقة. يمكن للأن العينات التي تحتوي على أكثر من ورقة واحدة تصل إلى 15 ورقة مكدسة بسهولة قبل القطع. </li><li style=";text-align:right;direction:rtl"> نقل على الفور الشرائط ورقة في طبق بتري الجولة 9 سم تحتوي على 20 مل محلول A (400 ملي مانيتول، 20 هيدرات MES ملي، 20 ملي بوكل، 10 ملي CaCl 2، 2 ملم MgCl 2، 0.1٪ و 2.5 ملي BSA β-المركابتويثانول، درجة الحموضة 5.7) بما في ذلك الإنزيمات protoplasting (1.2٪ السليلوز R-10، 0.6٪ و 0.4 RS السليلوز٪ macerozyme R-10) ومثبطات ريبونوكلياز والنسخي (1 × ProtectRNA و 10 ميكروغرام / مل الاكيتنوميسين D)؛ فصل بلطف ورقة وشرائط فراغ التسلل ل2 × 5 دقائق. </li><li style=";text-align:right;direction:rtl"> تعيين مكان طبق بتري على شاكر المداري إلى 90 دورة في الدقيقة في درجة حرارة الغرفة والبروتوبلازم للساعة 3-4. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> يجب أن الحضانة خلال فصل شرائط ورقة عن بعضها البعض، عن طريق استخداممجموعة من ملاقط شقة، في نصف ساعة فترات. </li></ol></li><li style=";text-align:right;direction:rtl"> وضع الخلية ميكرون 70 مصفاة (فيشر العلمية) في أنبوب 50 مل وتصنف بلطف الحل من خلال protoplasting. سيؤدي هذا إلى إزالة الشرائط ورقة، والتي سيتم الاحتفاظ بها من منخل بينما يسمح للprotoplasts من خلال الذهاب. </li><li style=";text-align:right;direction:rtl"> غسل الشرائط ورقة مع حل مل 4 A وفلتر من خلال غربال بلطف نفسه. </li><li style=";text-align:right;direction:rtl"> نقل protoplasts في أنابيب أسفل الجولة وأجهزة الطرد المركزي الحل البروتوبلازم في 300 x ج لمدة 5 دقائق لprotoplasts بيليه. </li><li style=";text-align:right;direction:rtl"> نضح بلطف أكبر قدر من طاف ممكن من دون إزعاج protoplasts. </li><li style=";text-align:right;direction:rtl"> غسل protoplasts مع الحل 5 مل A وأجهزة الطرد المركزي في 300 x ج لمدة 5 دقائق. إزالة طاف </li><li style=";text-align:right;direction:rtl"> إعادة تعليق على protoplasts في حجم مناسب لإيجاد حل، وذلك باستخدام ماصة باستور أو تلميح P1000 قطع. </li></ol> 2. FACS من Protoplasts ليف </p&gt; <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> مباشرة قبل الفرز، وإعادة تعليق protoplasts باستخدام (غير قطع) P1000 تلميح لتجنب تراكمها protoplasts معا. </li><li style=";text-align:right;direction:rtl"> نقل إلى أنبوب protoplasts الفرز من خلال مرشح ميكرومتر filcon 50 (BD العلوم البيولوجية) وتمييع حسب الاقتضاء لتجنب انسداد فوهة من فارز الخلية. يتم فرز protoplasts باستخدام فوهة ميكرومتر 100 في ضغط من 20 رطل لكل بوصة مربعة (غمد) و21-21،5 PSI (العينة)، تردد قدرها 39.2 كيلو هرتز ومعدل حالة &lt;4000 (هذه الإعدادات هي الأمثل على خلية تدفق BD فارز قد دينار بحريني (العلوم البيولوجية). الأمثل على غيرها من آلات الفرز الخلية تحتاج تعديلات على هذه الإعدادات). </li><li style=";text-align:right;direction:rtl"> يتم تحديد protoplasts GFP إيجابية باستخدام الليزر 488 نانومتر الأرجون والتآمر على الإخراج من ممر الموجة مرشح 580/30 (البرتقال) مقابل تصفية 530/40 ممر الموجة (الخضراء). سوف تكون إيجابية protoplasts GFP في السكانية العالية 580 530/low، مع المنظمات غير GFP protoplasts في عدد السكان منخفضة 580 530 / منخفضة والأموات / protoplasts الموت والحطام في الشعبية التي عالية 580lation (الشكل 2). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> عندما يكون الترتيب protoplasts التي سيتم استخراج الحمض النووي الريبي، ينبغي فرزها protoplasts مباشرة إلى ما لا يقل عن 4 مجلدات للتحلل تحتوي على مخزن مؤقت عامل مختزل (مثل β-المركابتويثانول). وبالإضافة إلى ذلك، ينبغي أن يقتصر ذلك الوقت نوعا من عينة واحدة ل20-30 دقيقة، وبحد أقصى من سنتين إلى ثلاث عينات معالجتها في وقت واحد. </li><li style=";text-align:right;direction:rtl"> لرؤية protoplasts مصنفة، ينبغي فرز protoplasts مباشرة إلى ما لا يقل عن 8 مجلدات عن حل وجمعها في وقت لاحق عن طريق الطرد المركزي لتركيز protoplasts. </li></ol></li></ol> 3. ممثل النتائج يصف هذا البروتوكول طريقة للحصول على protoplasts من أوراق arabidopsis، والتي تستخدم لتنشيط الخلايا الفرز مضان (الشكل 1). الجيل البروتوبلازم في وجود مثبطات ريبونوكلياز والنسخي يمنع الخلايا وROM تصاعد استجابة النسخي. هذا لا يكون نتيجة لمما أدى إلى العديد من القتلى وprotoplasts الموت، التي لديها قدر كبير من تألق ذاتي. عندما يكون الترتيب على استعداد protoplasts مع هذا الأسلوب هو بالتالي الشائع جدا أن نرى العديد من السكان متميزة في الرسوم البيانية من 580 نانومتر مقابل 530 نانومتر مضان المستخدمة في الفرز. وترد أمثلة على هذا، جنبا إلى جنب مع بوابات الفرز المستخدمة في هذا البروتوكول في الشكل 3. يمكن فرز Protoplasts إلى 8 مجلدات من حل وجمعها لتصور للتحقق من تخصيب اليورانيوم. 2G يوضح الشكل مثالا على ذلك باستخدام خط TP382، الذي يعبر عن GFP في خلايا الحرس. وترد أمثلة على العوائد التي تم الحصول عليها باستخدام هذه الطريقة، قبل وبعد التضخيم، في الجدول 1. المبالغ التي تم الحصول عليها كافية لتضخيم باستخدام نظام WTA الحفاوة بيكو (500 خريج-50 نانوغرام)، وبالتالي ليالي<html> ubsequent التحليل من قبل أي من qPCR (الشكل 4)، بجانب جيل أو التسلسل ميكروأري. <img alt="الشكل 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> الشكل 1. سير العمل الإجمالي للتجربة. 1) حصاد أوراق الفائدة من GFP التعبير عن خط ل arabidopsis. 2) بسرعة إلى قطع شرائح 1 ~ واسعة ونقل على الفور مم في حل هذه protoplasting والفراغ التسلل. 3) احتضان لمدة ساعة 3-4. 4) حل بلطف البروتوبلازم الترشيح من خلال غربال ميكرومتر 70، نقل لجولة أنابيب أسفل وprotoplasts بيليه بواسطة الطرد المركزي. 5) مباشرة قبل الفرز، protoplasts إعادة تعليق ونقل إلى أنبوب الفرز من خلال ميكرومتر 50 مرشح. 6) ترتيب GFP إيجابية وسلبية protoplasts GFP قابلة للحياة. يمكن 7) الآن Protoplasts يتم تحليلها إما بصريا أو باستخدام تقنيات مثل qPCR، بجانب جيل أو التسلسل ميكروأري. together.within صفحة = &quot;دائما&quot;&gt; <img alt="الشكل 2" src="/files/ftp_upload/4214/4214fig2.jpg" /> الشكل 2. خطوط KC464، KC274 وTP382 المستخدمة في هذه الدراسة. A) قسم عرضية من ورقة تظهر التعبير GFP KC464 في البشرة متجه نحو المحور. B) Protoplasts المستمدة من KC464 الأوراق. C) قسم عرضية من ورقة تظهر التعبير GFP KC274 في الأوعية الدموية. D) Protoplasts المستمدة من KC274 الأوراق. E) ورقة تبين TP382 التعبير GFP في خلايا الحرس. F) Protoplasts المستمدة من TP382 الأوراق. G) مثال للتخصيب التي حصلت عليها من FACS GFP التعبير عن خلايا الحرس في الخلفية المعقدة من الخلايا ورقة، والتي تبين GFP تحتوي على protoplasts من 580 530/low السكانية العالية من protoplasts المستمدة من TP382 الأوراق. AF: صور المجهر متحد البؤر، G: الإسفار صورة المجهر. على نطاق والحانات داخل الصور هي 50 ميكرومتر. <img alt="الشكل 3" src="/files/ftp_upload/4214/4214fig3.jpg" /><html> الشكل 3. نموذجي نقطة اقتناء قطع FACS الإخراج من نانومتر 580/30 (البرتقالي) في مقابل 530/40 نانومتر (الأخضر) مرشحات ممر الموجة (BD فارز الخلية تدفق). أبواب الفرز أظهرت هي تلك التي تستخدم عادة أثناء الفرز. A) نقطة قطعة protoplasts العقيد-4 أوراق المشتقة، protoplasted في غياب مثبطات، مما يدل على انخفاض واحد 530/low 580 السكان. B) نقطة مؤامرة من protoplasts العقيد WT-4 أوراق المشتقة، protoplasted في وجود مثبطات، مما يدل على تحول في مضان 580 بسبب الإجهاد والتلوين من مثبطات. CE) نقطة المؤامرات من أوراق protoplasts المستمدة من خطوط KC74، وKC464 TP382، على التوالي، protoplasted في وجود مثبطات، والتي تبين GFP تحتوي على السكان في 530/low عالية 580 السكان. وبالنظر إلى النسب المئوية للأحداث في السكان (الأعلى 530/low 580) GFP. <a href="http://www.jove.com/files/ftp_upload/4214/4214fig3large.jpg" target="_blank">اضغط هنا لمشاهدتها بشكل اكبر شخصية</a> . e_content &quot;FO: المحافظة على together.within صفحة =&quot; دائما &quot;&gt; <img alt="الشكل 4" src="/files/ftp_upload/4214/4214fig4.jpg" /> الشكل 4. GFP التعبير في الكسور السكان بوابات ممثل كما هو موضح في الشكل 3. تم الحصول على اثنين البيولوجية مكررات لكل نوع الكسر، تضخيم باستخدام الحفاوة بيكو WTA النظام وqPCR باستخدام GFP محددة الاشعال (الجدول 2) تم تنفيذ ذلك الحين. القيم المعروضة هي أعلى (الأحمر)، والقيم النسبية أقل (الخضراء) والمتوسط. وكان عدد السكان 580 عالية في هذه الحالة تقسيم في اثنين، وانخفاض 530/low 580 و 530/low عالية 580، والتي كانت تستخدم لتكرار واحد البيولوجية حتى يظهر فقط قيمة واحدة. وقد استخدم ACT2 (At3g18780) كمعيار لجميع العينات. ورقة: ورقة الجامعة. لم يتم فرزها: protoplasts لم يتم فرزها. GFP1: 530/low عالية 580 و Rest1: 530/low منخفضة 580، GFP2: 530/high عالية 580 و Rest2: 530/high منخفضة 580، كما هو موضح في الشكل (3) وأدخل. النتائج هي يا التحققو التقييمات البصرية من محتوى الخلية GFP في الكسور مصنفة (2G الشكل على سبيل المثال). <a href="http://www.jove.com/files/ftp_upload/4214/4214fig4large.jpg" target="_blank">اضغط هنا لمشاهدتها بشكل اكبر شخصية</a> . <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> عينة </td><td> عدد الأوراق </td><td> عدد الخلايا </td><td> الحمض النووي الريبي العائد (NG) </td><td> الحمض النووي الريبي العائد (تضخيم؛ نانوغرام) </td></tr><tr><td> كلها رقة A كلها أوراق B </td><td> 1 1 </td><td> - - </td><td> 8001 10525 </td><td> 4623 *** 4572 *** </td></tr><tr><td> لم يتم فرزها protoplasts A لم يتم فرزها protoplasts B </td><td> 5 5 </td><td> - - </td><td> 2433 2625 </td><td> 1152 *** 3321 *** </td></tr><tr><td> GFP1 A Rest1 A </td><td> 15 </td><td> 6039 (0.39٪ *) 55389 (6.4* 0٪) </td><td> - ** - ** </td><td> 861 489 </td></tr><tr><td> GFP1 B Rest1 B </td><td> 15 </td><td> 10783 (0.63٪ *) 57040 (7.49٪ *) </td><td> - ** - ** </td><td> 537 420 </td></tr><tr><td> GFP2 Rest2 </td><td> 15 </td><td> 18337 (1.49٪ *) 62405 (73.49٪ *) </td><td> - ** - ** </td><td> 360 411 </td></tr></tbody></table> الجدول 1. عينات التي تم جمعها وتحليلها باستخدام FACS مع qPCR لتحديد أي جزء الواردة الحية، معربا عن GFP protoplasts. وشملت أيضا في هذا الجدول هو العائد الحمض النووي الريبي مجموع نانوغرام في قبل وبعد التضخيم مع نظام بيكو WTA الحفاوة (NuGen). وكما هو مبين GFP1، GFP2، وRest1 Rest2 كسور في إدراج في الشكل 4. * تعطى النسبة المئوية للخلايا على المدى الخلية فرز بين قوسين بجانب إجمالي عدد الخلايا في الكسر. لا ترتبط هذه النسب إلىتم إيقاف بعضهم البعض لكل عينة وهذا النوع FACS يمتد لكسور &#39;الراحة&#39; في وقت سابق من لكسور GFP نظرا لعدد أكبر بكثير من الخلايا الراحة التي تم جمعها. ** 50 نانوغرام تستخدم كمدخل لتفاعلات التضخيم، وفقا بروتوكول الشركة المصنعة. <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> كتاب تمهيدي </td><td> تسلسل </td></tr><tr><td> mGFP5-ER.fw </td><td> GCCTGAGGGATACGTGCAGGAGA </td></tr><tr><td> mGFP5-ER.rv </td><td> TGGCGGGTCTTGAAGTTGGCT </td></tr><tr><td> ACT2.fw </td><td> GCCATCCAAGCTGTTCTCTC </td></tr><tr><td> ACT2.rv </td><td> GCCATCCAAGCTGTTCTCTC </td></tr></tbody></table> الجدول 2. الاشعال qPCR.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

الإعلان عن أي تضارب في المصالح.

وقد وصفت لنا طريقة التي تسمح للاستخدام النباتات معربا عن GFP ل arabidopsis في الأوراق لتوليد البروتوبلازم واللاحقة الفرز الخلية باستخدام FACS. هذه الطريقة تعطي كميات كافية من الحمض النووي الريبي لاستخدامها لتضخيم والتحليل اللاحق لذلك من قبل أي من qPCR أو ميكروأري. والتخصيب في الكسور لفرز الخلايا التي تحتوي على GFP، كما يتبين من qPCR (الشكل 2). لتحقيق عوائد عالية من protoplasts الحية من الأهمية بمكان العمل بسرعة خلال الخطوات الأولية لهذا الإجراء، حتى شرائط ورقة تم الفراغ تسلل مع الحل البروتوبلازم التي تحتوي على مثبط. وبالإضافة إلى ذلك، عند إنشاء شرائح 1 مم ورقة من المهم جدا لشريحة أو قطع الأوراق بدلا من &#39;فرم&#39; أو الهريس لهم، وهذا يؤدي إلى الضرر المفرط وبالتالي تحقيق عائد أقل البروتوبلازم. ووصف الفرق الحاسم بين طريقة أخرى هنا والمنشورهد طرق هو استخدام مثبطات مثبطات ريبونوكلياز والنسخي. يتم تطوير معظم الطرق لجذور arabidopsis، والتي يمكن أن تتولد protoplasts بسهولة أكبر. ومع ذلك، عند العمل مع أوراق، باستثناء نسيج الورقة المتوسط، من الضروري زيادة الوقت الجيل البروتوبلازم. ولذلك من المهم أن تشمل هذه مثبطات للحماية من التغيرات في التعبير الجيني نتيجة للمعاملة نفسها الجيل البروتوبلازم (المعطيات غير معروضة). ومع ذلك، فإن وجود مثبطات يؤدي إلى عدم القدرة على إيجاد رد فعل النسخ، إما عن طريق التحول الجينات أو إيقاف تشغيلها، والتي من المرجح أن تجعل protoplasts أكثر عرضة لأن هذا يؤدي إلى فقدان اللدونة التي لمواجهة الضغوط من protoplasting الداخلي. وقد استخدمنا الطريقة الموضحة هنا بنجاح مع عدد من خطوط، معربا عن GFP ل arabidopsis. الأهم من ذلك، وقد استخدمنا هذا الأسلوب مع خطوط التعبير عن GFP GFP إما بقوة فيالنواة، أو أكثر من ذلك بكثير ضعيفة بطريقة عصاري خلوي non-localized/diffuse، كما هو الحال مع خطوط KC464 KC274 وتستخدم هنا. كلا النوعين من خطوط متوافقة مع أسلوب وتسفر الكسور عالي التخصيب من GFP، معربا عن protoplasts (الشكل 2 و 3). يمكن أن يكون وسيلة تكيف بسهولة مع fluorophores الأخرى، على الرغم من يجب تحديد fluorophore لمضان التي تختلف كثيرا عن تألق ذاتي من الخلايا الميتة / الموت من أجل الحفاظ على القدرة على تحديد الخلايا الحية.

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> اسم كاشف </td><td> شركة </td><td> كتالوج رقم </td></tr><tr><td> سلولاز R-10 </td><td> Melford </td><td> C8001 </td></tr><tr><td> سلولاز RS </td><td> Melford </td><td> C8003 </td></tr><tr><td> Macerozyme R-10 </td><td> Melford </td><td> M8002 </td></tr><tr><td> BSA </td><td> سيغما الدريخ </td><td> A3912 </td></tr><tr><td> ProtectRNA </td><td> سيغما الدريخ </td><td> R7397 </td></tr><tr><td> أكتينوميسين D </td><td> سيغما الدريخ </td><td> A1410 </td></tr><tr><td> 70 ميكرومتر مصفاة الخلية </td><td> الصياد </td><td> FB35181 </td></tr><tr><td> 50 ميكرومتر filcon كأس من نوع المرشحات </td><td> BD العلوم البيولوجية </td><td> 340630 </td></tr></tbody></table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

بعد الشروع في منشم ورقة، يتم التحكم تراكم الكتلة الحيوية بشكل رئيسي من قبل تكاثر الخلايا والتوسع في الأوراق 1. ومع ذلك، فإن ورقة ل arabidopsis هو جهاز معقد يتكون من العديد من أنواع مختلفة من الخلايا والهياكل عدة. في الوقت نفسه، ورقة تحتوي على خلايا النمو في مراحل مختلفة من التنمية، مع خلايا أبعد من كونها أول سويقات لوقف توسيع والخضوع الشيخوخة 1. خلايا مختلفة داخل ورقة يتم تقسيم لذلك، أو التمطيط تمييز؛ بالموقع، وشدد أو ميتا، و / أو الاستجابة للمحفزات في مجموعات فرعية من نوعها الخلوية في أي وقت من الأوقات. هذا يجعل الدراسة الجينومية تحديا للأوراق: على سبيل المثال عند تحليل البيانات من أوراق التعبير كلها، إشارات من شبكات الوراثية العاملة في مناطق متميزة استجابة الخلوية أو أنواع الخلايا سوف يكون مرتبك، مما أدى إلى الملف غير دقيقة التي يتم توليدها. لمعالجة ذلك، قوقد وصفت وسائل everal الدراسات التي تمكن من التعبير الخلية الجينات المحددة. وتشمل هذه الليزر التقاط تسليخ مجهري (LCM) 2 أو النباتات GFP التعبير المستخدم لتوليد البروتوبلازم واللاحقة مضان تنشيط الخلايا الفرز (FACS) 3،4، ونظام وصف مؤخرا INTACT لهطول الأمطار النووية 5 و مناعي من polysomes 6. وقد استخدمت بنجاح لFACS عدد من الدراسات، بما في ذلك تبين أن هوية الخلية والمسافة من قمة الجذر كان لها تأثير كبير على ملامح التعبير من عدد كبير من الجينات 3،7. كما تم FACS GFP من خطوط الخلايا المستخدمة لإثبات محددة خلال تنظيم النسخي الردود النيتروجين الجذر الوحشي والتنمية الجذرية 8، 9 توزيع الملح الإجهاد أوكسين في جذر 10 و لإنشاء خريطة التعبير الجيني من النسيج الإنشائي القمي ل arabidopsis تبادل لاطلاق النار 11. رغم أنوقد سبق FACS تستخدم لفرز أوراق protoplasts ل arabidopsis المستمدة يعتمد على تألق ذاتي 12،13، وقد تم حتى الآن استخدام FACS على خطوط التعبير عن GFP ل arabidopsis في أوراق محدودة جدا 4. في البروتوكول وصفنا التالية طريقة للحصول على ورقة protoplasts ل arabidopsis التي تتوافق مع FACS مع التقليل من تأثير البروتوبلازم نظام الجيل. نحن لشرح طريقة استخدام خط ل arabidopsis KC464، التي ترتبط صريح بناء GFP في البشرة متجه نحو المحور 14، السطر KC274، التي تعبر عن GFP في الأنسجة الوعائية (14) والخط ل arabidopsis TP382، والتي تعبر عن ضعف GFP إلى إشارة توطين النووية في الخلايا حارس (البيانات لا تظهر؛ الشكل 2). نحن نستخدم هذه الطريقة في الوقت الحالي لدراسة كل خلية من نوع التعبير محددة خلال تطوير والإجهاد، فضلا عن السكان غير متجانسة الخلايا في مراحل مختلفة من الشيخوخة.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

وهناك طريقة لإنتاج<em&gt; ل arabidopsis</em&gt; أوراق protoplasts التي تتوافق مع مضان تنشيط الخلايا الفرز (FACS)، مما يسمح للدراسات السكان خلية معينة. هذا الأسلوب هو متوافق مع أي<em&gt; ل arabidopsis</em&gt; الخط الذي يعبر عن GFP في مجموعة فرعية من الخلايا.

تحليل خلية معينة من<em&gt; ل arabidopsis</em&gt; يترك طريق الإسفار خلية المنشط الفرز

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

cell-specific-analysis-arabidopsis-leaves-using-fluorescence

Research

JoVE Journal

Biology

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

15.1K Views.  University of Warwick. وهناك طريقة لإنتاج ل arabidopsis أوراق protoplasts التي تتوافق مع مضان تنشيط الخلايا الفرز (FACS)، مما يسمح للدراسات السكان خلية معينة. هذا الأسلوب هو متوافق مع أي ل arabidopsis الخط الذي يعبر عن GFP في مجموعة فرعية من الخلايا.

Video: Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

مضان الفرز الخلية النباتية المنشط من Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

التحقيق في الأنسجة والجهاز محددة الردود فيتوكروم باستخدام نظام مراقبة الأصول الميدانية بمساعدة خلية من نوع التنميط معينة في التعبير thaliana Arabidopsis</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification procedures. As an alternative, lipids can be coated on flat surfaces as used for lipid ELISA and Plasmon resonance spectroscopy. However, surface coating lipids do not form microdomain structures, which may be important for the lipid binding properties. Further, these methods do not allow for the purification of larger amounts of proteins binding to their target lipids.
 To overcome these limitations of testing lipid protein interaction and to purify lipid binding proteins we developed a novel method termed lipid vesicle-mediated affinity chromatography using magnetic-activated cell sorting (LIMACS). In this method, lipid vesicles are prepared with the target lipid and phosphatidylserine as the anchor lipid for Annexin V MACS. Phosphatidylserine is a ubiquitous cell membrane phospholipid that shows high affinity to the protein Annexin V. Using magnetic beads conjugated to Annexin V the phosphatidylserine-containing lipid vesicles will bind to the magnetic beads. When the lipid vesicles are incubated with a cell lysate the protein binding to the target lipid will also be bound to the beads and can be co-purified using MACS. This method can also be used to test if recombinant proteins reconstitute a protein complex binding to the target lipid. 
 We have used this method to show the interaction of atypical PKC (aPKC) with the sphingolipid ceramide and to co-purify prostate apoptosis response 4 (PAR-4), a protein binding to ceramide-associated aPKC. We have also used this method for the reconstitution of a ceramide-associated complex of recombinant aPKC with the cell polarity-related proteins Par6 and Cdc42. Since lipid vesicles can be prepared with a variety of sphingo- or phospholipids, LIMACS offers a versatile test for lipid-protein interaction in a lipid environment that resembles closely that of the cell membrane. Additional lipid protein complexes can be identified using proteomics analysis of lipid binding protein co-purified with the lipid vesicles.

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

To test the interaction of a protein with its target lipid we used MACS and Annexin V-conjugated magnetic beads and lipid vesicles synthesized from the target lipid and Annexin V-binding phosphatidylserine. Proteins bound to the target lipid are co-purified and analyzed after elution from the beads.

الكروماتوجراف الدهون تقارب الحويصلة بوساطة الفرز المغناطيسي باستخدام خلية المنشط (LIMACS) : طريقة جديدة لتحليل البروتين الدهني التفاعل

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. 
Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Environmental bacterioplankton are incubated with a model dissolved organic carbon (DOC) compound and a DNA labeling reagent, bromodeoxyuridine (BrdU). Afterward, DOC-degrading cells are separated from the bulk community based on their elevated BrdU incorporation using fluorescence activated cell sorting (FACS). These cells are then identified by subsequent molecular analyses.

Bromodeoxyuridine (BrdU) التوسيم والفرز وبعد الإسفار خلية المنشط للتحديد ، ثقافة مستقلة عن العضوية الذائبة الكربون المهينة العوالق البكتيرية

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of different cell types in vitro and in vivo.1-5 Although there are literally thousands of publications using such dyes, some of the most commonly encountered cell tracking applications include monitoring of:
<ol>
	<li>stem and progenitor cell quiescence, proliferation and/or differentiation6-8</li>
	<li>antigen-driven membrane transfer9 and/or precursor cell proliferation3,4,10-18 and</li>
	<li>immune regulatory and effector cell function1,18-21.</li>
</ol>
Commercially available cell tracking dyes vary widely in their chemistries and fluorescence properties but the great majority fall into one of two classes based on their mechanism of cell labeling. "Membrane dyes", typified by PKH26, are highly lipophilic dyes that partition stably but non-covalently into cell membranes1,2,11. "Protein dyes", typified by CFSE, are amino-reactive dyes that form stable covalent bonds with cell proteins4,16,18. Each class has its own advantages and limitations. The key to their successful use, particularly in multicolor studies where multiple dyes are used to track different cell types, is therefore to understand the critical issues enabling optimal use of each class2-4,16,18,24.
The protocols included here highlight three common causes of poor or variable results when using cell-tracking dyes. These are:
<ol>
	<li>Failure to achieve bright, uniform, reproducible labeling. This is a necessary starting point for any cell tracking study but requires attention to different variables when using membrane dyes than when using protein dyes or equilibrium binding reagents such as antibodies.</li>
	<li>Suboptimal fluorochrome combinations and/or failure to include critical compensation controls. Tracking dye fluorescence is typically 102 - 103 times brighter than antibody fluorescence. It is therefore essential to verify that the presence of tracking dye does not compromise the ability to detect other probes being used.</li>
	<li>Failure to obtain a good fit with peak modeling software. Such software allows quantitative comparison of proliferative responses across different populations or stimuli based on precursor frequency or other metrics. Obtaining a good fit, however, requires exclusion of dead/dying cells that can distort dye dilution profiles and matching of the assumptions underlying the model with characteristics of the observed dye dilution profile.</li>
</ol>
Examples given here illustrate how these variables can affect results when using membrane and/or protein dyes to monitor cell proliferation.

Successful use of cell tracking dyes to monitor immune cell function and proliferation involves several critical steps. We describe methods for: 1) obtaining bright, uniform, reproducible label-ing with membrane dyes; 2) selecting fluorochromes and data acquisition conditions; and 3) choosing a model to quantify cell proliferation based on dye dilution.

الأمثل أساليب النمذجة وتلوين لرصد انتشار استخدام الأصباغ انقسام الخلية خلية تتبع

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their prominent presence is often associated with poor prognosis1,2. CAFs are an activated subpopulation of stromal fibroblasts, many of which express the myofibroblast marker &alpha;-SMA3. CAFs originate from local tissue fibroblasts as well as from bone marrow-derived cells recruited into the developing tumor and adopt a CAF phenotype under the influence of the tumor microenvironment4. CAFs were shown to facilitate tumor initiation, growth and progression through signaling that promotes tumor cell proliferation, angiogenesis, and invasion5-8. We demonstrated that CAFs enhance tumor growth by mediating tumor-promoting inflammation, starting at the earliest pre-neoplastic stages9. Despite increasing evidence of the key role CAFs play in facilitating tumor growth, studying CAFs has been an on-going challenge due to the lack of CAF-specific markers and the vast heterogeneity of these cells, with many subtypes co-existing in the tumor microenvironment10. Moreover, studying fibroblasts in vitro is hindered by the fact that their gene expression profile is often altered in tissue culture11,12 . To address this problem and to allow unbiased gene expression profiling of fibroblasts from fresh mouse and human tissues, we developed a method based on previous protocols for Fluorescence-Activated Cell Sorting (FACS)13,14. Our approach relies on utilizing PDGFR&alpha; as a surface marker to isolate fibroblasts from fresh mouse and human tissue. PDGFR&alpha; is abundantly expressed by both normal fibroblasts and CAFs9,15 . This method allows isolation of pure populations of normal fibroblasts and CAFs, including, but not restricted to &alpha;-SMA+ activated myofibroblasts. Isolated fibroblasts can then be used for characterization and comparison of the evolution of gene expression that occurs in CAFs during tumorigenesis. Indeed, we and others reported expression profiling of fibroblasts isolated by cell sorting16. This protocol was successfully performed to isolate and profile highly enriched populations of fibroblasts from skin, mammary, pancreas and lung tissues. Moreover, our method also allows culturing of sorted cells, in order to perform functional experiments and to avoid contamination by tumor cells, which is often a big obstacle when trying to culture CAFs.

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

Cancer Associated Fibroblasts (CAFs) facilitate tumor initiation, growth and progression through signaling that promotes proliferation, angiogenesis, and inflammation. Here we describe a method to isolate pure populations of normal fibroblasts and CAFs from fresh mouse and human tissues by cell sorting, using PDGFR&#x03B1; as a surface marker.

عزل الخلايا الليفية عادي والسرطان يرتبط بها من الأنسجة الطازجة من الإسفار خلية المنشط الفرز (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.

Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.

خليه واحده الطموح الصغير كاستراتيجية بديله لفرز الخلايا المنشطة الفلورية لفصل خليط الفيروسات العملاقة

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...

Fluorescence-Activated Cell Sorting for the Isolation of Scleractinian Cell Populations

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the mechanisms are not well understood. To investigate coral response to stressors, we need tools for analyzing cellular responses. In particular, we need tools that facilitate the application of functional assays to better understand how cell populations are reacting to stress. In the current study, we use fluorescence-activated cell sorting (FACS) to isolate and separate different cell populations in stony corals. This protocol includes: (1) the separation of coral tissues from the skeleton, (2) creation of a single cell suspension, (3) labeling the coral cells using various markers for flow cytometry, and (4) gating and cell sorting strategies. This method will enable researchers to work on corals at the cellular level for analysis, functional assays, and gene expression studies of different cell populations.

Corals create biodiverse ecosystems important for both humans and marine organisms. However, we still do not understand the full potential and function of many coral cells. Here, we present a protocol developed for the isolation, labeling, and separation of stony coral cell populations.

فلورسينس تنشيط فرز الخلايا لعزل سكان الخلايا Scleractinian

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the ...

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.

This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

عزل الحمض النووي الريبي الخاص بنوع الخلية من عينات الأنسجة غير المتجانسة المجمدة بدون فرز الخلايا

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

Fluorescence Lifetime Macro Imager for Biomedical Applications

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ranging from solid-state, O2-sensitive coatings to live animal tissue samples stained with soluble O2-sensitive probes. In particular, the nanoparticle-based near-infrared probe NanO2-IR, which is excitable with a 625 nm light-emitting diode (LED) and emits at 760 nm, was used. The imaging system is based on the Timepix3 camera (Tpx3Cam) and the opto-mechanical adaptor, which also houses an image intensifier. O2 phosphorescence lifetime imaging microscopy (PLIM) is commonly required for various studies, but current platforms have limitations in their accuracy, general flexibility, and usability.
The system presented here is a fast and highly sensitive imager, which is built on an integrated optical sensor and readout chip module, Tpx3Cam. It is shown to produce high-intensity phosphorescence signals and stable lifetime values from surface-stained intestinal tissue samples or intraluminally stained fragments of the large intestine and allows the detailed mapping of tissue O2 levels in about 20 s or less. Initial experiments on the imaging of hypoxia in grafted tumors in unconscious animals are also presented. We also describe how the imager can be re-configured for use with O2-sensitive materials based on Pt-porphyrin dyes using a 390 nm LED for the excitation and a bandpass 650 nm filter for emission. Overall, the PLIM imager was found to produce accurate quantitative measurements of lifetime values for the probes used and respective two-dimensional maps of the O2 concentration. It is also useful for the metabolic imaging of ex vivo tissue models and live animals.

This paper describes the use of a new, fast optical imager for the macroscopic photoluminescence lifetime imaging of long decay emitting samples. The integration, image acquisition, and analysis procedures are described, along with the preparation and characterization of the sensor materials for the imaging and the application of the imager in studying biological samples.

تصوير ماكرو مضان مدى الحياة للتطبيقات الطبية الحيوية

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ...