وقد دعم هذا العمل جزئيا من قبل مؤسسة العلوم الطبيعية في الصين (أرقام المنحة 31471703، A0201300537 و 31671854 ل جف و ل)، و 100 خطة المواهب الخارجية (منحة رقم JSB2014012 إلى جف).

وقد وافقت اللجنة الأخلاقية لمركز الحيوان التجريبي في جامعة نانجينغ الزراعية وفقا للإجراءات الوطنية لرعاية الحيوان التجريبي (وزارة العلوم والتكنولوجيا، العلاقات العامة في الصين، 2006) مع الحيوانات الموجودة في سف منشأة (رقم التصريح: سيكسك-J-2011-0037). 1. كماه المغلوب خارج الماوس نموذج <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> استخدام البرية من نوع C57Bl / 6 الفئران من مركز الطب المقارن من جامعة يانغتشو (الصين). ملاحظة: تم إنشاؤها كماه تدق الفئران خارج استنادا إلى المعلومات المقدمة من السابق كماه تدق التدريجي الدراسات 17 ، 19 والحصول تجاريا باستخدام استراتيجية كريسبر / Cas9 20 عن طريق إزالة 92 أزواج قاعدة من اكسون 6 من الجينات كماه ، والذي هو أيضا محذوف في الجين البشري كماه 19 . إيجابي F 0 &lt;/ الفرعية&gt; -mice (2 أفراد) عبرت مع الفئران نوع البرية للحصول على متخالف F 1 -mice. بعد عبور متخالف F 1 -mice (5 أفراد)، متماثل Cmah خروج المغلوب F 2 -mice يمكن الحصول عليها بنجاح (3 أفراد). </li><li style=";text-align:right;direction:rtl"> إجراء التنميط الجيني من الفئران باستخدام الحمض النووي الجيني وفقا للطريقة التي أظهرها زانغالا 21 باستخدام مجموعة تنقية الحمض النووي التجارية. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تضخيم المقابلة جزء الحمض النووي للجين Cmah باستخدام البلمرة DNA التجاري والزوج التمهيدي 5&#39;gaaagggctcggctctgtatgaa3 &quot;و5&#39;tttaaaatgtcccgggtgagaagc3. أداء التضخيم الجيني باستخدام 34 دورة ير تتكون من تمسخ في 94 درجة مئوية لمدة 40 ثانية، الصلب عند 63 درجة مئوية لمدة 40 ثانية، واستطالة عند 72 درجة مئوية لمدة 1 دقيقة. </li><li style=";text-align:right;direction:rtl"> تصور المنتجات ير على هلام الاغاروز 1٪. ينبغي للمرء أن يراقب فرقة واحدة (0.5 كيلو بايت) للفرد من نوع البرية، ونطاق مزدوج (0.4 و 0.5 كيلو بايت) لمتفرقة متخالف الفردي، والفرقة واحدة (0.4 كيلو بايت) لفرد متماثل ضرب المغلوب. </li></ol></li></ol> 2. جمع العينات <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> جمع الحليب الماوس باستخدام بروتوكول وصفها ويلينغهام وآخرون. 22- </li><li style=";text-align:right;direction:rtl"> جمع الأنسجة الماوس الكبد باستخدام بروتوكول وصفها غونكالفس وآخرون. 23 وتخزين العينات في -80 درجة مئوية. </li></ol> 3. عزل الأحماض السياليك من الحليب <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد 100 مل من محلول حمض الخليك 2 M عن طريق إضافة 12 مل من حمض الخليك الجليدي إلى 88 مل من المقطر H 2 O. </li><li style=";text-align:right;direction:rtl"> نقل 50 ميكرولتر من الحليب إلى أنبوب الطرد المركزي 1.5 مل وإضافة 1.2 مل من محلول حمض أسيتيك مائي أعدت. </li><li style=";text-align:right;direction:rtl"> احتضان تعليق لمدة 4 ساعات في 80 درجة مئوية وأجهزة الطرد المركزي العينة في 14،000 x ج لمدة 10 دقيقة. </li><li style=";text-align:right;direction:rtl"> نقل أعلى 1000 ميكرولتر من طاف في أنبوب الطرد المركزي 1.5 مل الطازجة و ريمفوق المذيب عن طريق التبخر الطرد المركزي في درجة حرارة الغرفة لاستكمال جفاف (اعتمادا على مضخة فراغ المرفقة هذا وسوف يستغرق 4-20 ساعة). إعادة حل العينة في 500 ميكرولتر من المقطر H 2 O. </li><li style=";text-align:right;direction:rtl"> إعداد عمود الصرف أنيون الصغرى. هذه الخطوة سوف تثري على وجه التحديد المركبات الأيونية وإزالة المركبات الموجبة والمحايدة من عينات الحليب والكبد، وبالتالي يزيد من الانتقائية من وكيل أوبد الفلوروجينيك المسمى وسم مشتقات حمض سياليك. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> نقل لكل عينة 200 ملغ من راتنج التبادل أنيون (داوكس 1X8) إلى أنابيب عمود فارغة 3 مل مع محبس المرفقة. </li><li style=";text-align:right;direction:rtl"> إضافة 2 مل من محلول حمض أسيتيك مائي أعدت في الخطوة 3.1 لاستبدال أيونات الكلوريد في الراتنج مع أيونات خلات. إغلاق محبس في أقرب وقت المذيبات تصل إلى الجزء العلوي من الراتنج. </li><li style=";text-align:right;direction:rtl"> إضافة بلطف 2 مل من H المقطر O 2 ، فتح محبس ووقف تدفق في أقرب وقت معظم المذيبات تصلالجزء العلوي من الراتنج. تأكد من أن الراتنج مغطى دائما مع المذيبات. </li><li style=";text-align:right;direction:rtl"> غسل عمود الراتنج مرتين أكثر مع 2 مل من H المقطر H 2 O لإزالة خلات الزائدة. </li></ol></li><li style=";text-align:right;direction:rtl"> نقل الناتجة ميكرولتر 500 من عينة المذيبات من الخطوة 3.4. على عمود الراتنج وتجاهل تدفق من خلال. غسل بلطف الراتنج مع 2 مل من المقطر H 2 O. أزل العينة الأنيونات من الراتنج باستخدام 1 مل من 50 ملي محلول الأمونيوم خلات (386 ملغ من خلات الأمونيوم الذائبة في 100 مل من المقطر H 2 O) إلى 1.5 مل أنبوب الطرد المركزي. إزالة المذيب عن طريق التبخر الطرد المركزي في درجة حرارة الغرفة إلى جفاف. ملاحظة: يمكن تخزين العينات الجافة في 4-6 درجة مئوية لمدة تصل إلى 12 شهرا. </li></ol> 4. عزل الأحماض السياليك من أنسجة الكبد <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ذوبان الجليد بلطف 20 - 50 ملغ من الكبد الماوس ونقله إلى دونس طاحونة الأنسجة (1 مل أو 2 مل من حجم). إضافة 1.2 مل من محلول حمض أسيتيك مائيأعدت في الخطوة 3.1 وتجانس الأنسجة عن طريق القص لطيف لمدة 10 ثانية. نقل تعليق الناتجة في أنبوب الطرد المركزي 1.5 مل. </li><li style=";text-align:right;direction:rtl"> اتبع الخطوات 3.3. إلى 3.6. ملاحظة: يمكن تخزين العينات الجافة في 4-6 درجة مئوية لمدة تصل إلى 12 شهرا. </li></ol> 5. إعداد معيار حمض سياليك مختلطة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تزن في ما بين 5-8 ملغ من حمض N- أسيتيلنورامينيك على التوازن التحليلي في أنبوب الطرد المركزي 1.5 مل. لاحظ الوزن الدقيق وإضافة 164 ميكرولتر من H المقطر H 2 O لكل ملغ ( أي إذا كان وزن Neu5Ac هو 7.2 ملغ ثم إضافة 7.2 × 164 = 1، 181 ميكرولتر من المقطر H 2 O). هذا يؤدي إلى حل الأسهم 20 ملي Neu5Ac التي يمكن تخزينها في -20 درجة مئوية لمدة تصل إلى 12 شهرا. </li><li style=";text-align:right;direction:rtl"> الحصول على حمض N- جليكولنورامينيك بكميات أصغر بسعر معتدل مثل في 1 ملغ أليكوتس. إضافة 154 ميكرولتر من المقطر H 2 O مباشرة إلى المجمع من أجل الحصول على ~ 20 ملي حل الأسهم NE5Gc. نقلحل في أنبوب الطرد المركزي 1.5 مل. يمكن تخزين هذا الحل في -20 درجة مئوية لمدة تصل إلى 12 شهرا. </li><li style=";text-align:right;direction:rtl"> الجمع بين 5 ميكرولتر من كل حل المخزون من الخطوة 5.1 و 5.2 إلى الطازجة 1.5 مل أنبوب الطرد المركزي وإزالة المذيبات بواسطة التبخر الطرد المركزي في درجة حرارة الغرفة إلى جفاف. ملاحظة: يمكن تخزين معيار حمض السياليك مختلطة في 4-6 درجة مئوية لمدة تصل إلى 12 شهرا. </li></ol> 6. مضان اشتقاق الأحماض السياليك <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد 10 مل من أوبد الحل، ويتألف من 100 ملغ من o- فينيلينديامين و 208 ملغ من كبريتات الهيدروجين الصوديوم في 10 مل من H المقطر H 2 O. </li><li style=";text-align:right;direction:rtl"> إضافة 20 ميكرولتر من حل أوبد لعينات حمض السياليك المستمدة من حليب الماوس (الخطوة 3)، كبد الفأر (الخطوة 4)، أو مختلطة حمض سياليك القياسية (الخطوة 5). دوامة بقوة لمدة 30 ثانية واحتضان عينات لمدة 4 ساعات في 80 درجة مئوية في الظلام ( أي التفاف ميكروتوبس في رقائق الألومنيوم). </li><li style=";text-align:right;direction:rtl"> السماح للعينات يبرد لمدة 5 دقائق، إضافة 80 μ؛ L المقطر H 2 O وأجهزة الطرد المركزي أنابيب في 14،000 x ج لمدة 1 دقيقة. </li><li style=";text-align:right;direction:rtl"> نقل 80 ميكرولتر من طاف في 300 ميكرولتر عالية الانتعاش قارورة هبلك. يمكن تخزين عينات حمض السياليك ديريفاتيزد في 4-6 درجة مئوية لمدة تصل إلى أسبوع واحد. </li></ol> 7. تحليل هبلك من المشتقات حمض سياليك <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تحليل العينات باستخدام نظام هبلك القياسية متصلة كاشف مضان على الانترنت. </li><li style=";text-align:right;direction:rtl"> استخدام عمود المرحلة C18 عكس مع الأبعاد القياسية من 250 مم طول و 4.6 مم قطر للتحليل. </li><li style=";text-align:right;direction:rtl"> إعداد المذيب A عن طريق تمييع 200 مل من محلول المخزون مع 800 مل من المياه لمس الصف (لمس - اللوني السائل الكتلة الطيفية). الحل الأسهم نفسها يمكن إعدادها على النحو التالي: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إضافة 46 غرام من حمض الفورميك إلى 800 مل من LMS- الصف H 2 O. </li><li style=";text-align:right;direction:rtl"> ضبط درجة الحموضة إلى 4.5 بواسطة قطرة قطرة إضافة محلول هيدروكسيد الأمونيوم (بوريس. </li><li style=";text-align:right;direction:rtl"> نقل المذيب إلىقياس اسطوانة وملء ما يصل إلى 1000 مل مع LMS- الصف H 2 O. ويمكن تخزين هذا الحل المخزون في 4-6 درجة مئوية لمدة تصل إلى 3 أشهر. </li></ol></li><li style=";text-align:right;direction:rtl"> بالنسبة للمذيب B، استخدم أسيتونيتريل لمس-غريد. </li><li style=";text-align:right;direction:rtl"> فصل المشتقات الأحماض سياليك بمعدل تدفق 1 مل / دقيقة مع شطف التدرج التالية: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ابدأ بإضافة 10٪ من المذيب B المختلط إلى المذيب A. </li><li style=";text-align:right;direction:rtl"> من 0 دقيقة إلى 15 دقيقة، وزيادة تدريجية في نسبة المذيب B مع التدرج الخطي إلى 60٪. </li><li style=";text-align:right;direction:rtl"> من 15 دقيقة إلى 16 دقيقة، بسرعة زيادة نسبة المذيب B مع التدرج الخطي من 60٪ إلى 90٪. هذا يبدأ غسل العمود هبلك. </li><li style=";text-align:right;direction:rtl"> لمزيد من غسل العمود هبلك، والحفاظ على مستوى المذيب B في 90٪ بين 16 دقيقة و 18 دقيقة قبل الحد تدريجيا من مستوى المذيب B مرة أخرى إلى 10٪ بين 18 دقيقة و 19 دقيقة. </li><li style=";text-align:right;direction:rtl"> إعادة توازن عمود هبلك إلى ظروف انطلاق 10٪ B بين 19 و 24 دقيقة. </li></ol></li><li style=";text-align:right;direction:rtl"> فيجيكت 50 ميكرولتر من العينة في نظام هبلك. </li><li style=";text-align:right;direction:rtl"> رصد خيوط باستخدام مضان كاشف الإثارة / انبعاث موجات من 373/448 نانومتر، والأحماض سياليك ديريفاتيزد يمكن أن يتوقع في أوقات الاحتفاظ التقريبي من 9 دقيقة (ل Neu5Gc-أوبد) و 10 دقيقة (ل Neu5Ac-أوبد). </li><li style=";text-align:right;direction:rtl"> حساب المبلغ النسبي لل Neu5Gc (F Neu5Gc ) من المناطق ذروة مضان من Neu5Ac (A Neu5Ac ) و Neu5Gc (A Neu5Gc ) على النحو التالي: F Neu5Gc [٪] = 100 × و Neu5Gc / (A ne5Ac + A Neu5Gc ). في حالة عينات الحليب والكبد من متماثل متماثلة كماه ضرب المغلوب الماوس F Neu5Gc ينبغي أن يكون 0٪، في حين أن القيم ل F Neu5Gc من متخالف والبرية من نوع الفئران قد تختلف على نطاق واسع اعتمادا على عصر الماوس ونوع الأنسجة (بين 2٪ و&gt; 90٪) مع هوامش الخطأ المتوقعة ± 12٪. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

الكتاب ليس لديهم ما يكشف.

يسمح البروتوكول هنا تقديم التقييم phenotypical من متماثل الفئران خروج المغلوب Cmah من خلال تحليل وقياس كميات النسبية Neu5Gc من الحليب والكبد العينات. تم إجراء التحليل باستخدام إعداد هبلك القياسية مع الكشف مضان. الخطوة الأكثر أهمية من هذا الإجراء هو إعداد الأعمدة تبادل أن?...

N- حمض أسيتيلنورامينيك (Neu5Ac) وحمض N- جليكولنورامينيك (Neu5Gc) هي الأحماض السياليك الأكثر شيوعا في معظم الثدييات 1 . على الرغم من أن قادرة على تصنيع Neu5Ac داخليا، والبشر ليست قادرة على إنتاج Neu5Gc بسبب حذف اكسون الابتدائي على ترميز الجينات سماه ل هيدروكسيلاز سمب-Neu5Ac 2 ، 3 . ومع ذلك، يمكن للمنتجات الغذائية الحيوانية القائمة على مصادر غذائية من Neu5Gc 4 ، 5 ، 6 ، مما يؤدي إلى إنتاج الأجسام المضادة لمكافحة Neu5Gc، وبالتالي تؤدي إلى استجابة مناعية تجاه Neu5Gc 7 . ويشتبه هذا التأثير الغذائي لل Neu5Gc للمساهمة في التهاب مزمن وأمراض أخرى مختلفة 8 ، 9 ، 10 . من أجل فهم شامل لآثار Neu5Gc في حأومانز، نموذج حيواني للدراسة المنهجية لآثار الأحماض السياليك التي تنقلها الأغذية هو مرغوب فيه للغاية. على الرغم من أن البروتوكولات القائمة على البوليميراز سلسلة من ردود الفعل (ير) لتحليل الفئران التدقرج هي راسخة وطريقة مريحة للتقييم الجيني، والتحليل الوظيفي للنمط الظاهري على مستوى التمثيل الغذائي يتطلب أساليب تحليل أكثر تحديدا. يمكن تقييم النمط الظاهري للماوس تدق نموذج الماوس من خلال عزل وتحليل تكوين الأحماض السياليك في عينات الكبد أو الحليب. وقد تم الإبلاغ عن عدة طرق للكشف عن الأحماض السياليك في أنسجة الحيوانات في وقت سابق: رد فعل الأحماض السياليك مع ريسورسنول 11 أو حمض الثيوباربيتوريك 12 يؤدي إلى تشكيل منتج كروموفوريك ويمكن تحليلها ببساطة باستخدام الإعداد بلاتريدر مقرها، ولكن فقط مجموع سياليك قد يتم تحديد محتوى الحمض. بدلا من ذلك، تم وصف تحليل الأحماض السياليك أيضا باستخدام اللوني للغاز13 ، مالدي-توف الطيف الكتلي 14 أو أساليب أمبيروميتريك 15 . ومع ذلك، فإن أساليب تحليل حمض السياليك الأكثر شيوعا تعتمد على الإفراج التحلل، تليها مشتق مضان واللاحقة عالية الأداء اللوني السائل 16 ، 17 ، 18 .

<table><tbody><tr><td>&lt;strong&gt;Chemicals:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>N-acetylneuraminic acid</td><td>Sigma</td><td>A0812</td><td></td></tr><tr><td>N-glycolylneuraminic acid</td><td>Sigma</td><td>50644</td><td>1 mg aliquot should be sufficient</td></tr><tr><td>o-Phenylenediamine</td><td>Sigma</td><td>694975</td><td></td></tr><tr><td>Sodium hydrogen sulfite</td><td>J&amp;amp;K Scientific Ltd</td><td>75234</td><td></td></tr><tr><td>&lt;strong&gt;Tools/Materials:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>3 mL SPE tubes</td><td>Supelco</td><td>Sigma 57024</td><td>empty solid phase extraction columns</td></tr><tr><td>Luer stopcock</td><td>Sigma</td><td>S7396</td><td>to stop the flow of the SPE tube</td></tr><tr><td>Dowex 1X8</td><td>Dow Chemicals</td><td>Sigma 44340</td><td>200 - 400 mesh</td></tr><tr><td>Dounce tissue grinder</td><td>Sigma</td><td>D8938</td><td>tight fit</td></tr><tr><td>&lt;strong&gt;HPLC Analysis:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>High-recovery HPLC vial</td><td>Agilent Technologies</td><td>#5188-2788</td><td></td></tr><tr><td>HPLC System</td><td>Shimadzu</td><td>Nexera</td><td></td></tr><tr><td>Fluorescence Detector for HPLC</td><td>Shimadzu</td><td>RF-20Axs</td><td></td></tr><tr><td>HPLC Column</td><td>Phenomenex</td><td>Hyperclone ODS</td><td>250 x 4.6 mm</td></tr><tr><td>LCMS-grade H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Merck Millipore</td><td>#WX00011</td><td></td></tr><tr><td>LCMS-grade Acetonitrile</td><td>Merck Millipore</td><td>#100029</td><td>Hypergrade</td></tr><tr><td>Ammonium hydroxide solution</td><td>Fluka</td><td>#44273</td><td>puriss. P.a.</td></tr></tbody></table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

كماه (سيتيدين مونوفوسفهات-N-أسيتيلنورامينيك حامض هيدروكسيلاز) هو المسؤول عن أكسدة أحماض سيتيدين أحادي فوسفات - N- أسيتيلنورامينيك في الثدييات. ومع ذلك، لا يمكن للبشر أكسدة حمض السيتيدين مونوفوسفهات-N- أسيتيلنورامينيك إلى حمض سيتيدين مونوفوسفهات-N- جليكولنورامينيك بسبب حذف اكسون الابتدائي للجين كماه . لفهم الآثار والآثار المترتبة على عدم وجود نشاط سماه بمزيد من التفصيل، ونموذج تدق كماه في الفئران هو من اهتمام كبير في البحوث الأساسية والتطبيقية. طريقة التحليل لتحديد النمط الظاهري لهذا النموذج الماوس هو موضح هنا بالتفصيل، ويستند على الكشف عن كل من N- حمض أسيتيلنورامينيك وحمض N- غليكوليلورامينيك في الكبد وحليب البرية من نوع و كماه تدق الفئران. يتم الافراج عن الأحماض السياليك الذاتية و ديريفاتيزد مع o- فينيلينديامين لتوليد المشتقات الفلورية، والتي يمكن تحليلها لاحقا من قبل هبلك. يمكن أن يكون البروتوكول المقدمكما طبقت لتحليل عينات الحليب والأنسجة من مختلف الأصول الأخرى، ويمكن أن تكون مفيدة للتحقيق في الآثار الغذائية والصحية للحمض N-غليكوليلورامينيك.

ويرد نظرة عامة التخطيطي لطريقة تحليل وصفها في الشكل 1 ، ويتضمن عزل الأحماض السياليك من عينات الحليب والكبد من نوع البرية و كماه تدق الطرد الفئران متحولة، ومشتق مضان وتحليل هبلك من هذه المكونات. الشكل 2 <strong cl...

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

نحن تصف طريقة القائم على هبلك لتحديد N- حمض أسيتيلنورامينيك وحمض N- جليكوليلورامينيك في الكبد الماوس والحليب.

تحديد الأحماض السياليك في الكبد وعينات الحليب من البرية من نوع و<em&gt; CMAH</em&gt; خروج المغلوب الفئران.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K Views.  Nanjing Agricultural University.  نحن تصف طريقة القائم على هبلك لتحديد N- حمض أسيتيلنورامينيك وحمض N- جليكوليلورامينيك في الكبد الماوس والحليب. 

Video: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Determining Bile Duct Density in the Mouse Liver

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques are used, including serum chemistry, histological analysis, and immunostaining for specific markers. Although these techniques can provide important information about the biliary system, they often do not present a full picture of bile duct (BD) developmental defects across the whole liver. This is in part due to the robust ability of the mouse liver to drain the bile even in animals with significant impairment in biliary development. Here we present a simple method to calculate the average number of BDs associated with each portal vein (PV) in sections covering all lobes of mutant/transgenic mice. In this method, livers are mounted and sectioned in a stereotypic manner to facilitate comparison among various genotypes and experimental conditions. BDs are identified via light microscopy of cytokeratin-stained cholangiocytes, and then counted and divided by the total number of PVs present in liver section. As an example, we show how this method can clearly distinguish between wild-type mice and a mouse model of Alagille syndrome. The method presented here cannot substitute for techniques that visualize the three-dimensional structure of the biliary tree. However, it offers an easy and direct way to quantitatively assess BD development and the degree of ductular reaction formation in mice.

We present a rather simple and sensitive method for accurate quantification of bile duct density in the mouse liver. This method can aid in determining the effects of genetic and environmental modifiers and the effectiveness of potential therapies in mouse models of biliary diseases.

تحديد كثافة القناة الصفراوية في كبد الفأر

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques ...

Developmental Biology

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing termini of oligo- and polysaccharides, as well as its unique chemical characteristics, sialic acid is involved in a multitude of different receptor-ligand interactions. By modifying the expression of sialic acid on the cell surface, sialic acid-dependent interactions will consequently be influenced. This can be helpful to investigate sialic acid-dependent interactions and has the potential to influence certain diseases in a beneficial way. Via metabolic glycoengineering (MGE), the expression of sialic acid on the cell surface can be modulated. Herein, cells, tissues, or even entire animals are treated with C2-modified derivatives of N-acetylmannosamine (ManNAc). These amino sugars act as sialic acid precursor molecules and therefore are metabolized to the corresponding sialic acid species and expressed on glycoconjugates. Applying this method produces intriguing effects on various biological processes. For example, it can drastically reduce&#160;the expression of polysialic acid (polySia) in treated neuronal cells and thus affects neuronal growth and differentiation. Here, we show the chemical synthesis of two of the most common C2-modified N-acylmannosamine derivatives, N-propionylmannosamine (ManNProp) as well as N-butanoylmannosamine (ManNBut), and further show how these non-natural amino sugars can be applied in cell culture experiments. The expression of modified sialic acid species is quantified by high performance liquid chromatography (HPLC) and further analyzed via mass spectrometry. The effects on polysialic acid expression are elucidated via Western blot using a commercially available polysialic acid antibody.

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid is a typical monosaccharide-unit found in glycoconjugates. It is involved in a plethora of molecular and cellular interactions. Here we present a method to modify cell surface sialic acid expression using metabolic glycoengineering with N-acetylmannosamine derivatives.

جليكونجينيرينج الأيض حمض اللعابي استخدام N-الأسيل-تعديل مانوسامينيس

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing ...

Bioengineering

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible animal models mirror common components of human disease, including the bm12 transfer model. Upon transfer of bm12 splenocytes or purified CD4 T cells, C57BL/6 mice rapidly develop large frequencies of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells followed by high levels of circulating anti-nuclear antibodies. Since this model utilizes mice on a pure C57BL/6 background, researchers can quickly and easily study disease progression in transgenic or knockout mouse strains in a relatively short period of time. Here we describe protocols for the induction of the model and the quantitation Tfh, GC B cells, and plasma cells by multi-color flow cytometry. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells, and plasma cells in other disease models.

The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

ومحرض نموذج bm12 من الذئبة الحمامية الجهازية (SLE) في C57BL / 6 الفئران

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible ...

Medicine

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

طريقة لقياس وظيفة الغدة اللعابية في الفئران

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

Immunology and Infection

Using a Bacterial Pathogen to Probe for Cellular and Organismic-level Host Responses

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' pathogens (Listeria monocytogenes, Shigella flexneri, Burkholderia pseudomallei, Francisella tularensis, and Rickettsia spp.) gain access to the infected cell cytosol by physically and enzymatically degrading the primary vacuolar membrane. Once in the cytosol, these pathogens both proliferate as well as generate sufficient mechanical forces to penetrate the plasma membrane of the host cell in order to infect new cells. Here, we show how this terminal step of the cellular infection cycle of L. monocytogenes (Lm) can be quantified by both colony-forming unit assays and flow cytometry and give examples of how both pathogen- and host-encoded factors impact this process. We also show a close correspondence of Lm infection dynamics of cultured cells infected in vitro and those of hepatic cells derived from mice infected in vivo. These function-based assays are relatively simple and can be readily scaled up for discovery-based high-throughput screens for modulators of eukaryotic cell function.

We describe both in vitro and in vivo infection assays that can be used to analyze the activities of host-encoding factors.

استخدام مسببات الأمراض بكتيرية للتحقيق لاستجابات المضيف الخلوية ومستوى أورجانيسميك

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' ...

Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by goblet cells and the gastric mucosa, provide the scaffold for a micrometers-thick mucus layer that lines the epithelia of the gut and respiratory tract3,4. In addition to mucins, mucus layers also contain antimicrobial peptides, cytokines, and immunoglobulins5-9. The mucus layer is an important part of host innate immunity, and forms the first line of defense against invading microorganisms8,10-12. As such, the mucus is subject to numerous interactions with microbes, both pathogens and symbionts, and secreted mucins form an important interface for these interactions. The study of such biological interactions usually involves histological methods for tissue collection and staining. The two most commonly used histological methods for tissue collection and preservation in the clinic and in research laboratories are: formalin fixation followed by paraffin embedding, and tissue freezing, followed by embedding in cryo-protectant media.
Paraffin-embedded tissue samples produce sections with optimal qualities for histological visualization including clarity and well-defined morphology. However, during the paraffin embedding process a number of epitopes become altered and in order to study these epitopes, tissue sections have to be further processed with one of many epitope retrieval methods13. Secreted mucins and lipids are extracted from the tissue during the paraffin-embedding clearing step, which requires prolong incubation with organic solvents (xylene or Citrisolv). Therefore this approach is sub-optimal for studies focusing on the nature and distribution of mucins and mucus in vivo.
In contrast, freezing tissues in Optimal Cutting Temperature (OCT) embedding medium avoids dehydration and clearing of the sample, and maintains the sample hydration. This allows for better preservation of the hydrated mucus layer, and thus permits the study of the numerous roles of mucins in epithelial biology. As this method requires minimal processing of the tissue, the tissue is preserved in a more natural state. Therefore frozen tissues sections do not require any additional processing prior to staining and can be readily analyzed using immunohistochemistry methods.
We demonstrate the preservation of micrometers-thick secreted mucus layer in frozen colon samples. This layer is drastically reduced when the same tissues are embedded in paraffin. We also demonstrate immunofluorescence staining of glycan epitopes presented on mucins using plant lectins. The advantage of this approach is that it does not require the use of special fixatives and allows utilizing frozen tissues that may already be preserved in the laboratory.

Unfixed frozen tissue samples embedded in Optimal Cutting Temperature medium (OCT) can be used to study natural distribution and glycosylation of secreted mucus. In this approach tissue processing is minimal and the natural presentation of glycolipids, mucins and glycan-epitopes is preserved. Tissue sections can be analyzed by immunohistochemistry using fluorescence or chromogenic detection.

استخدام غير المثبتة، مناديل مجمدة لدراسة التوزيع الطبيعي الميوسين

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by ...

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients with autoimmune hepatitis. The overwhelming majority of patients with DIH are women. The underlying mechanisms of these sex differences in prevalence are unclear because of the paucity of animal models that mimic human disease. Even so, underlying mechanisms are widely believed to be associated with human leukocyte antigen haplotypes and sex hormones. In contrast, using a DIH mouse model, we have uncovered that IL-4 initiated&#160;CD4+ T cells directed against an epitope of cytochrome P450 2E1 induces influx of neutrophils, macrophages and mast cells into the livers of female BALB/c mice. Using this model, we have also shown that IL-33-induced FoxP3+regulatory T cells confer protection against DIH in female and male mice. This DIH model is induced by immunizing mice with an epitope of CYP2E1 that has been covalently altered with a drug metabolite that has been associated with DIH. This epitope is recognized by patients with DIH. Our method induces robust and reproducible hepatitis and autoantibodies that can be utilized to study the pathogenesis of DIH. While in vivo studies can cause undue pain and distress in mice when done improperly, the advantage of an in vivo model is the ability to evaluate the pathogenesis of disease in a large number of mice. Additionally, biological effects of the altered liver proteins can be studied using invasive procedures. The addition of in vitro studies to the experimental design allows rapid repetition and mechanistic analysis at a cellular level. Thus, we will demonstrate our model protocol and how it can be utilized to study in vivo and in vitro mechanisms of DIH.

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

تحريض التهاب الكبد المناعي الذاتي الناجم عن الأدوية في الفئران BALB / c لدراسة آلياته المسببة للأمراض

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

حمل التهاب السحايا السحائي Serogroup C في الفئران عن طريق تسليم إينتراسيستيرنال

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Indirect Immunofluorescence on Frozen Sections of Mouse Mammary Gland

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple method for the immune detection of proteins, the mouse lactating mammary gland being taken as an example. A protocol for the preparation of the tissue samples, especially concerning the dissection of mouse mammary gland, tissue fixation and frozen tissue sectioning, are detailed. A standard protocol to perform indirect immunofluorescence, including an optional antigen retrieval step, is also presented. The observation of the labeled tissue sections as well as image acquisition and post-treatments are also stated. This procedure gives a full overview, from the collection of animal tissue to the cellular localization of a protein. Although this general method can be applied to other tissue samples, it should be adapted to each tissue/primary antibody couple studied.

The indirect immunofluorescence protocol described in this article allows the detection and the localization of proteins in the mouse mammary gland. A complete method is given to prepare mammary gland samples, to perform immunohistochemistry, to image the tissue sections by fluorescence microscopy, and to reconstruct images.

المناعي غير المباشر على أقسام المجمدة من الماوس الغدة الثديية

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple ...

<meta charset="utf8"></head><body>طريقة الشخص الفردي المحسنة لجمع الحليب في دراسات الرضاعة للفئران

An Efficient Single-Person Technique for Milk Sampling from Laboratory Mice

Rodent models have been widely used in biology since the early 20th century to study basic physiology and biochemical mechanisms. In lactation and neonatal development research, there is a need to sample milk to determine the composition and how milk may be affected by experimental manipulations, thereby impacting newborn development. Collecting biofluids in sufficient amounts from small rodents can be difficult. Several studies have demonstrated different techniques to obtain milk from mice. However, these techniques often require at least two trained personnel, which may be challenging in some cases.&#160;
Here, we demonstrate a modified milk sampling technique based on a method published in 2009. With this affordable and easy-to-assemble method, one trained person can routinely obtain 0.1&#8211;0.5 mL of milk from a dam under anesthesia in less than 10 min. Using this method, we collected sufficient milk on post-delivery day 2 (PD2) and post-delivery day 10 (PD10). We measured milk macronutrient components and compared them with the existing literature to validate our collection method.&#160;
We recorded that on PD2, milk protein averaged at 70.1 &#177; 5.2 g/L, milk fat was 174.4 &#177; 7.1 g/L, and milk lactose was 12.3 &#177; 0.6 g/L. On PD10, while milk lactose and protein remained at similar concentrations as on PD2, milk fat was significantly higher (224.4 &#177; 17.1 g/L). We also observed that the relative abundance of individual milk proteins varied between PD2 and PD10. More specifically, &#945;S1-casein and whey acidic protein were higher, while &#946;-casein was lower at PD10 compared with PD2. Overall, we demonstrate an efficient single-person technique for milk sampling from mice using a device that can easily be assembled with commonly used laboratory equipment.

<meta charset="utf8"></head><body>تقنية فعالة لشخص واحد لأخذ عينات من الحليب من فئران المختبر

This article describes how to assemble a device that can be used to collect milk from laboratory mice. This device is affordable, portable, and allows a collection of 0.1&#8211;0.5 mL of milk by one trained person. A detailed milking protocol is also included.&#160;

تحديد الأحماض السياليك في الكبد وعينات الحليب من البرية من نوع و

Summary

Explore More Videos

Chapters in this video