이 작품은 중국 자연 과학 재단 (JV 및 LL에 부여 번호 31471703, A0201300537 및 31671854) 및 100 개의 외국 재능 계획 (JV에 부여 번호 JSB2014012)으로 부분적으로 지원되었습니다.

동물 피험자에 관한 절차는 SPF에 수납 된 동물들과 실험 동물 복지에 관한 국가 지침 (과학 기술부, 중국 홍보, 2006)에 따라 난징 농업 대학교 실험 동물 센터의 윤리위원회의 승인을 받았다. 시설 (허가 ID : SYXK-J-2011-0037). 1. Cmah 녹아웃 마우스 모델 <ol><li> 양주 대학교 (중국)의 비교 의학 센터에서 야생형 C57Bl / 6 마우스를 사용하십시오. 참고 : Cmah 녹아웃 마우스는 이전 Cmah 녹아웃 연구 17 , 19 에서 제공된 정보를 기반으로 생성되었으며 Cmah 유전자의 엑손 6에서 92 염기쌍을 제거하여 CRISPR / Cas9 20 전략을 사용하여 상업적으로 얻었습니다. 인간 CMAH 유전자에서 결실 19 . 양의 F 0 &lt;/ 서브&gt; 때문이야 - 쥐 (2 개인)의 이형 때문이야 - F 1을 얻었다 야생형 마우스와 교배. 이형 F 1 때문이야 - 쥐 (5 개인)를 횡단 한 후, 동형 접합 Cmah 녹아웃 F 2 때문이야 - 쥐가 성공적으로 (3 개인)을 얻을 수있다. </li><li> 상업적 DNA 정제 키트를 사용하여 Zangala 21 에 제시된 방법에 따라 게놈 DNA를 사용하여 생쥐의 genotyping을 수행하십시오. <ol><li> 시중의 DNA 중합 효소와 프라이머 쌍 5&#39;gaaagggctcggctctgtatgaa3 &#39;및 5&#39;tttaaagtgtcccgggtgagaagc3&#39;를 사용하여 Cmah 유전자의 상응하는 DNA 단편을 증폭시킨다. 94 ℃에서 40 초 동안 변성, 40 초 동안 63 ℃에서 어닐링, 72 분에서 1 분간 연신하는 34 가지 PCR 사이클을 사용하여 유전자 증폭을 수행하십시오. </li><li> PCR 제품을 1 % 아가 로즈 겔에서 시각화하십시오. 야생형 개체에 대해서는 단일 밴드 (0.5kb)를, 야생형 개체에 대해서는 더블 밴드 (0.4 및 0.5kb)를 관찰해야한다.heterozygous knock-out 개체 및 homozygous knock-out 개체에 대한 단일 밴드 (0.4kb)가 포함됩니다. </li></ol></li></ol> 2. 샘플 수집 <ol><li> Willingham 등이 기술 한 프로토콜을 사용하여 마우스 우유를 수집 합니다. 22 . </li><li> Gonçalves 등이 설명한 프로토콜을 사용하여 마우스 간 조직을 수집 합니다. -80 ° C에서 23 개 샘플 저장소. </li></ol> 3. 우유에서 시알 산의 분리 <ol><li> 증류 H 2 O 88 ㎖ 중에 빙초산 12 mL를 첨가하여 2 M 아세트산 용액 100mL를 준비 </li><li> 50 mL의 우유를 1.5 mL 원심 분리 튜브에 넣고 준비된 아세트산 수용액 1.2 mL를 넣는다. </li><li> 80 ° C에서 4 시간 동안 현탁액을 품어 내고 샘플을 14,000 xg에서 10 분간 원심 분리한다. </li><li> 상층 액의 상단 1,000 μL를 새로운 1.5 mL 원심 분리 튜브 및 Rem로 옮긴다.실온에서 원심 증발에 의해 용매를 제거하여 건조시킵니다 (부착 된 진공 펌프에 따라 4 ~ 20 시간이 소요됩니다). 재용 증류 H 2 O. 500 μL의 샘플을 </li><li> 마이크로 음이온 교환 컬럼을 준비하십시오. 이 단계는 음이온 성 화합물을 풍부하게하고 우유 및 간 샘플에서 양이온 및 중성 화합물을 제거하므로 시알 산 유도체 화를위한 형광성 OPD 표지제의 선택성을 증가시킵니다. <ol><li> 각 시료 200mg을 음이온 교환 수지 (Dowex 1X8)를 스톱 콕이 부착 된 빈 3mL 컬럼 튜브에 옮긴다. </li><li> 단계 3.1에서 준비한 아세트산 수용액 2 mL를 첨가하여 수지 내의 염화물 이온을 아세테이트 이온으로 대체한다. 솔벤트가 수지 상단에 도달하면 즉시 스톱 콕을 닫으십시오. </li><li> 조심스럽게 증류 H 2 O 2 ㎖를 추가 콕을 열어 즉시 도달 용매의 대부분 같은 흐름을 중지수지의 상단. 수지가 항상 솔벤트로 덮여 있는지 확인하십시오. </li><li> 과량의 아세트산을 제거하기위한 증류 H 2 O 2 mL로 수지 컬럼을 두 번 더 세척 하였다. </li></ol></li><li> 단계 3.4에서 얻은 500 μL의 샘플 용매를 옮기십시오. 수지 칼럼에 놓고 흐름을 버린다. 부드럽게 1.5 ㎖ 중에 50mM의 아세트산 암모늄 용액 1 ㎖를 사용하여 수지로부터 시료 음이온 (암모늄 아세테이트 386 mg을 증류수 H 2 O 100 mL에 용해) 증류 H 2 O. 용출 2 mL로하여 수지를 씻어 원심 분리기 튜브. 실온에서 건조하여 원심 증발시켜 용매를 제거한다. 참고 : 건조 샘플은 4-6 ° C에서 12 개월까지 보관할 수 있습니다. </li></ol> 4. 간 조직으로부터 시알 산의 분리 <ol><li> 부드럽게 20-50 mg의 마우스 간을 해동시키고 그것을 Dounce 조직 분쇄기 (1 mL 또는 2 mL 용량)로 옮긴다. 1.2 mL의 아세트산 수용액단계 3.1에서 준비하고 10 초 동안 부드러운 전단하여 조직을 균질. 생성 된 현탁액을 1.5 mL 원심 분리 튜브에 옮긴다. </li><li> 3.3 단계를 수행하십시오. 3.6. 참고 : 건조 샘플은 4-6 ° C에서 12 개월까지 보관할 수 있습니다. </li></ol> 5. 혼합 시알 산 표준의 제조 <ol><li> 분석 용 저울에 N- 아세틸 뉴 라민 산 5 - 8 mg을 1.5 mL 원심 분리 관에 넣습니다. 정확한 체중을 주마다 mg을 증류수 H 2 O 164 μL를 추가 (즉 Neu5Ac의 중량을 7.2 ㎎을 다음 7.2 = 1 × 164, H 2 O 증류수 181 μL를 추가 할 경우). 최대 12 개월 동안 -20 ° C에서 보관할 수있는 20 mM Neu5Ac 스톡 용액이 생성됩니다. </li><li> 1mg 분량과 같은 적절한 가격으로 소량의 N- 글리콜 릴 뉴 라민 산을 얻습니다. ~ 20 mM의 Neu5Gc 스톡 용액을 제조하기 위해 화합물 2 O 직접 증류 H 154 μL를 추가한다. 전송1.5 mL 원심 튜브에 넣었다. 이 솔루션은 최대 12 개월 동안 -20 ° C에서 보관할 수 있습니다. </li><li> 단계 5.1 및 5.2의 각 원액에서 5 μL를 신선한 1.5 mL 원심 튜브에 넣고 실온에서 건조하여 원심 증발에 의해 용매를 제거합니다. 참고 : 혼합 시알 산 표준은 최대 12 개월 동안 4 ~ 6 ° C에서 보관할 수 있습니다. </li></ol> 6. 시알 산의 형광 유도체 화 <ol><li> 오르토 페닐 렌 디아민 100㎎을하고 10ml에 아황산 수소 나트륨 208 mg을 구성된 10 ㎖ OPD-용액을 준비하여 H 2 O를 증류 </li><li> 마우스 우유 (3 단계), 마우스 간 (4 단계), 또는 혼합 시알 산 표준 (5 단계)에서 파생 된 시알 산 샘플에 OPD 솔루션 20 μL를 추가합니다. 어두운 곳에서 80 ° C에서 4 시간 동안 시료를 30 초간 격렬히 교반하고 incubate하십시오 ( 즉 , 알루미늄 호일에 마이크로 튜브를 감싸십시오). </li><li> 샘플을 5 분 동안 식히고 80μ; 증류수 H 2 O의 L 1 분 동안 14,000 XG에서 튜브를 원심 분리. </li><li> 상등액에서 80 μL를 300 μL 고 회수 HPLC 바이알로 옮긴다. 유도체 화 된 시알 산 시료는 4 ~ 6 ° C에서 최대 1 주일 동안 보관할 수 있습니다. </li></ol> 7. 시알 산 유도체의 HPLC 분석 <ol><li> 온라인 형광 검출기에 연결된 표준 HPLC 시스템을 사용하여 시료를 분석하십시오. </li><li> 표준 250mm 길이와 4.6mm 직경의 역상 C18 컬럼을 사용하여 분석하십시오. </li><li> 스톡 용액 200 mL를 LCMS 급수 800 mL로 희석하여 용매 A를 준비한다 (LCMS - 액체 크로마토 그래피 질량 분석기). 원액 자체는 다음과 같이 준비 할 수있다 : <ol><li> 46 g의 개미산을 800 mL의 LCMS 등급 H 2 O에 첨가한다. </li><li> 수산화 암모늄 용액 (puriss.pa)을 적가하여 pH를 4.5로 조정한다. </li><li> 솔벤트를실린더를 측정하고 LCMS 등급 H 2 O로 1,000 mL까지 채우십시오.이 저장 용액은 4 ~ 6 ° C에서 3 개월까지 저장할 수 있습니다. </li></ol></li><li> 용매 B의 경우 LCMS 등급의 아세토 니트릴을 사용하십시오. </li><li> 시알 산 유도체를 1 mL / min 유속으로 다음의 농도 구배로 분리하십시오 : <ol><li> 용매 A에 혼합 된 용매 B를 10 % 첨가하여 시작하십시오. </li><li> 0 분에서부터 15 분까지 점차적으로 용매 B의 비율을 60 %까지 선형 그래디언트로 증가시킵니다. </li><li> 15 분에서 16 분 사이에 선형 그라디언트로 용매 B의 비율을 60 %에서 90 %까지 빠르게 증가시킵니다. 이것은 HPLC 칼럼의 세척을 시작한다. </li><li> HPLC 칼럼을 추가로 세척하기 위해 용매 B의 수준을 16 분에서 18 분 사이에 90 %로 유지 한 다음 용매 B의 수준을 18 분에서 19 분 사이에 다시 10 %로 점차 감소시킵니다. </li><li> HPLC 칼럼을 19 ~ 24 분 사이의 10 % B의 시작 조건으로 재 평형시킨다. </li></ol></li><li> 에서시료 50 μL를 HPLC 시스템에 주입하십시오. </li><li> 373/448 nm의 형광 검출기 여기 / 방출 파장을 사용하여 용리액을 모니터링하고 유도체 화 된 시알 산은 대략 9 분 (Neu5Gc-OPD) 및 10 분 (Neu5Ac-OPD)의 예상 유지 시간에서 예상 할 수 있습니다. </li><li> F Neu5Gc [%] = 100 × A Neu5Gc / (A Neu5Ac + A Neu5Gc )와 같이 Neu5Ac (A Neu5Ac )와 Neu5Gc (A Neu5Gc )의 형광 피크 면적으로부터 Neu5Gc (F Neu5Gc )의 상대적 양을 계산 하라 . homozygous Cmah knock-out 마우스의 우유 및 간 샘플의 경우 F Neu5Gc 는 0 %이어야하지만, 이형 접합체 및 야생형 마우스의 F Neu5Gc 값은 마우스 나이와 조직 유형에 따라 크게 다를 수 있습니다 (2 % 및&gt; 90 %)로 예상 오차 여백은 ± 12 %입니다. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

저자는 공개 할 것이 없습니다.

본 명세서에 제시된 프로토콜은 우유 및 간 샘플의 Neu5Gc의 상대적인 양을 분석하고 정량화함으로써 동형 접합성 Cmah 녹아웃 마우스의 표현형 평가를 가능하게한다. 형광 검출을 이용한 표준 HPLC 설정을 사용하여 분석을 수행 하였다. 이 절차의 가장 중요한 단계는 음이온 교환 컬럼을 준비하고 음이온 교환 크로마토 그래피를 수행하는 것입니다. 수지를 적절하게 침전시키고 적절한 세척 ?...

N- 아세틸 뉴 라민 산 (Neu5Ac)과 N- 글리콜 릴 뉴 라민 산 (Neu5Gc)은 대부분의 포유류에서 가장 흔한 시알 산입니다 1 . Neu5Ac를 내생 적으로 합성 할 수는 있지만, 인간은 CMP-Neu5Ac hydroxylase 2 , 3을 암호화하는 CMAH 유전자에서 1 차 엑손 결실로 인해 Neu5Gc를 생산할 수 없습니다. 그러나 동물성 식품은 Neu5Gc 4 , 5 , 6 의식이 공급원 일 수있어 Neu5Gc 항체 생산을 유도하여 Neu5Gc 7에 대한 면역 반응을 유발합니다. Neu5Gc의식이 효과는 만성 염증 및 여러 가지 다른 질병에 기여하는 것으로 의심됩니다 ( 8 , 9 , 10) . Neu5Gc의 효과를 종합적으로 이해하기 위해식용 시알 산의 효과에 대한 체계적인 연구를위한 동물 모델은 매우 바람직하다. 녹아웃 마우스를 분석하기위한 중합 효소 연쇄 반응 (polymerase chain reaction, PCR)을 기반으로 한 프로토콜이 잘 확립되어 있고 유전형 평가를위한 편리한 방법이지만, 대사 수준에서 표현형의 기능 분석에는보다 구체적인 분석 방법이 필요합니다. Cmah knock-out 마우스 모델의 표현형은 간 또는 우유 샘플에서 시알 산의 조성을 분리하고 분석하여 평가할 수 있습니다. 동물 조직에서 시알 산을 검출하는 몇 가지 방법이 이전에보고되었습니다 : 시알 산을 레조 르시 놀 11 또는 티오 바르 비 투산 12 와 반응 시키면 발색 생성물이 형성되고 플레이트 판독기를 사용하여 간단하게 분석 할 수 있지만 시알 산 산 함량이 결정될 수있다. 대안으로, 시알 산의 분석은 가스 크로마토 그래피13 , MALDI-ToF 질량 분광 분석법 14 또는 전류 법 15 . 그러나, 가장 일반적으로 적용되는 시알 산 분석 방법은 가수 분해 릴리스, 형광 유도체 화 및 후속 고성능 액체 크로마토 그래피 16 , 17 , 18에 근거합니다.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:147px;">Chemicals:</td>
			<td style="width:144px;"></td>
			<td style="width:143px;"></td>
			<td style="width:251px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">N-acetylneuraminic acid</td>
			<td>Sigma</td>
			<td>A0812</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">N-glycolylneuraminic acid</td>
			<td>Sigma</td>
			<td align="right">50644</td>
			<td>1 mg aliquot should be sufficient</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">o-Phenylenediamine</td>
			<td>Sigma</td>
			<td align="right">694975</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sodium hydrogen sulfite</td>
			<td>J&#38;K Scientific Ltd</td>
			<td align="right">75234</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tools/Materials:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">3 mL SPE tubes</td>
			<td>Supelco</td>
			<td>Sigma 57024</td>
			<td>empty solid phase extraction columns</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Luer stopcock</td>
			<td>Sigma</td>
			<td>S7396</td>
			<td>to stop the flow of the SPE tube</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dowex 1X8</td>
			<td>Dow Chemicals</td>
			<td>Sigma 44340</td>
			<td>200-400 mesh</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dounce tissue grinder</td>
			<td>Sigma</td>
			<td>D8938</td>
			<td>tight fit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC Analysis:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">High-recovery HPLC vial</td>
			<td>Agilent Technologies</td>
			<td>#5188-2788</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC System</td>
			<td>Shimadzu</td>
			<td>Nexera</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fluorescence Detector for HPLC</td>
			<td>Shimadzu</td>
			<td>RF-20Axs</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC Column</td>
			<td>Phenomenex</td>
			<td>Hyperclone ODS</td>
			<td>250x4.6 mm</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;">LCMS-grade H2O</td>
			<td>Merck Millipore</td>
			<td>#WX00011</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LCMS-grade Acetonitrile</td>
			<td>Merck Millipore</td>
			<td>#100029</td>
			<td>Hypergrade</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ammonium hydroxide solution</td>
			<td>Fluka</td>
			<td>#44273</td>
			<td>puriss. P.a.</td>
		</tr>
	</tbody>
</table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

CMAH (cytidine monophosphate-N- 아세틸 뉴 라민 산 hydroxylase)는 포유류에서 cytidine monophosphate-N- acetylneuraminic acids의 산화를 담당합니다. 그러나, 인간은 CMAH 유전자의 일차 엑손 결실로 인해 시티 딘 모노 포스페이트 -N- 아세틸 뉴 라민 산을 시티 딘 모노 포스페이트 -N- 글리콜 릴 뉴 라민 산으로 산화시킬 수 없다. CMAH 활동의 결핍의 영향과 함축적 의미를보다 자세히 이해하기 위해 마우스에서의 Cmah 녹아웃 모델은 기초 및 응용 연구에 관심이 많습니다 . 이 마우스 모델의 표현형을 결정하기위한 분석 방법은 본원에 상세히 기재되어 있으며, 야생형 및 Cmah 녹아웃 마우스의 간 및 우유에서의 N- 아세틸 뉴 라민 산 및 N- 글리콜로 누 라민 산의 검출에 기초한다. 내인성 시알 산은 방출되고 o- 페닐 렌 디아민으로 유도체 화되어 형광 생성물을 생성하며, 이후에 HPLC로 분석 될 수있다. 제시된 프로토콜은또한 다양한 다른 기원의 우유 및 조직 샘플 분석에 사용되며 N-glycolylneuraminic acid의 영양 및 건강 효과를 조사하는 데 유용 할 수 있습니다.

설명 된 분석 방법의 개략적 인 개요는 그림 1에 표시되어 있으며 야생 형 및 Cmah 녹아웃 돌연변이 마우스의 우유 및 간 샘플에서 시알 산을 분리하고 형광 유도체 화 및 이러한 구성 요소의 HPLC 분석을 포함합니다. 그림 2 와 그림 3 은 homo- 과 heterozygous knock-out Cmah 마우스 (- / -와 +/-)와 ?...

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

우리는 마우스 간의 간과 우유에서 N- 아세틸 뉴 라민 산 (N-acetylneuraminic acid)과 N- 글리콜로 누 라민 산 (N-glycolylenuraminic acid)을 측정하기위한 HPLC 기반 방법을 설명합니다.

야생형과 간암의 시알 산의 결정<em&gt; CMAH</em&gt; 넉 아웃 마우스.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K 조회수.  Nanjing Agricultural University.  우리는 마우스 간의 간과 우유에서 N- 아세틸 뉴 라민 산 (N-acetylneuraminic acid)과 N- 글리콜로 누 라민 산 (N-glycolylenuraminic acid)을 측정하기위한 HPLC 기반 방법을 설명합니다. 

비디오: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Quantitation of &gamma;H2AX Foci in Tissue Samples

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) processes or by exogenous factors, particularly ionizing radiation and radiomimetic compounds. Phosphorylation of the H2A histone variant, H2AX, at the serine-139 residue, in the highly conserved C-terminal SQEY motif, forming &gamma;H2AX, is an early response to DNA double-strand breaks1. This phosphorylation event is mediated by the phosphatidyl-inosito 3-kinase (PI3K) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)2. Overall, DSB induction results in the formation of discrete nuclear &gamma;H2AX foci which can be easily detected and quantitated by immunofluorescence microscopy2. Given the unique specificity and sensitivity of this marker, analysis of &gamma;H2AX foci has led to a wide range of applications in biomedical research, particularly in radiation biology and nuclear medicine. The quantitation of &gamma;H2AX foci has been most widely investigated in cell culture systems in the context of ionizing radiation-induced DSBs. Apart from cellular radiosensitivity, immunofluorescence based assays have also been used to evaluate the efficacy of radiation-modifying compounds. In addition, &gamma;H2AX has been used as a molecular marker to examine the efficacy of various DSB-inducing compounds and is recently being heralded as important marker of ageing and disease, particularly cancer3. Further, immunofluorescence-based methods have been adapted to suit detection and quantitation of &gamma;H2AX foci ex vivo and in vivo4,5. Here, we demonstrate a typical immunofluorescence method for detection and quantitation of &gamma;H2AX foci in mouse tissues.

Quantitation of &#947;H2AX Foci in Tissue Samples

Quantitation of DNA double-strand breaks on the basis of &gamma;H2AX foci has become an invaluable tool, particularly in radiation biology, for the evaluation of tissue radiosensitivity and effects of radiation modifying compounds. Here we demonstrate the use of an immunofluorescence assay for quantitation of &gamma;H2AX foci in tissue samples.

조직 샘플에서 γH2AX Foci의 Quantitation

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) ...

연구

생물학

Identifying the Effects of BRCA1 Mutations on Homologous Recombination using Cells that Express Endogenous Wild-type BRCA1

The functional analysis of missense mutations can be complicated by the presence in the cell of the endogenous protein. Structure-function analyses of the BRCA1 have been complicated by the lack of a robust assay for the full length BRCA1 protein and the difficulties inherent in working with cell lines that express hypomorphic BRCA1 protein1,2,3,4,5. We developed a system whereby the endogenous BRCA1 protein in a cell was acutely depleted by RNAi targeting the 3'-UTR of the BRCA1 mRNA and replaced by co-transfecting a plasmid expressing a BRCA1 variant. One advantage of this procedure is that the acute silencing of BRCA1 and simultaneous replacement allow the cells to grow without secondary mutations or adaptations that might arise over time to compensate for the loss of BRCA1 function. This depletion and add-back procedure was done in a HeLa-derived cell line that was readily assayed for homologous recombination activity. The homologous recombination assay is based on a previously published method whereby a recombination substrate is integrated into the genome (Figure 1)6,7,8,9. This recombination substrate has the rare-cutting I-SceI restriction enzyme site inside an inactive GFP allele, and downstream is a second inactive GFP allele. Transfection of the plasmid that expresses I-SceI results in a double-stranded break, which may be repaired by homologous recombination, and if homologous recombination does repair the break it creates an active GFP allele that is readily scored by flow cytometry for GFP protein expression. Depletion of endogenous BRCA1 resulted in an 8-10-fold reduction in homologous recombination activity, and add-back of wild-type plasmid fully restored homologous recombination function. When specific point mutants of full length BRCA1 were expressed from co-transfected plasmids, the effect of the specific missense mutant could be scored. As an example, the expression of the BRCA1(M18T) protein, a variant of unknown clinical significance10, was expressed in these cells, it failed to restore BRCA1-dependent homologous recombination. By contrast, expression of another variant, also of unknown significance, BRCA1(I21V) fully restored BRCA1-dependent homologous recombination function. This strategy of testing the function of BRCA1 missense mutations has been applied to another biological system assaying for centrosome function (Kais et al, unpublished observations). Overall, this approach is suitable for the analysis of missense mutants in any gene that must be analyzed recessively.

We provide a method for testing BRCA1 variants in a tissue culture based assay for homologous recombination repair of DNA damage by depleting endogenous BRCA1 protein from a cell using RNAi and replacing it with a BRCA1 point mutant that contains a coding change.

내생 와일드 타입 BRCA1을 표현 세포를 사용하는 동종 재조합에 BRCA1 변이의 효과를 확인

The functional analysis of missense mutations can be complicated by the presence in the cell of the endogenous protein. Structure-function analyses of the ...

Concentration Determination of Nucleic Acids and Proteins Using the Micro-volume Bio-spec Nano Spectrophotometer

Nucleic Acid quantitation procedures have advanced significantly in the last three decades. More and more, molecular biologists require consistent small-volume analysis of nucleic acid samples for their experiments. The BioSpec-nano provides a potential solution to the problems of inaccurate, non-reproducible results, inherent in current DNA quantitation methods, via specialized optics and a sensitive PDA detector. The BioSpec-nano also has automated functionality such that mounting, measurement, and cleaning are done by the instrument, thereby eliminating tedious, repetitive, and inconsistent placement of the fiber optic element and manual cleaning.
In this study, data is presented on the quantification of DNA and protein, as well as on measurement reproducibility and accuracy. Automated sample contact and rapid scanning allows measurement in three seconds, resulting in excellent throughput. Data analysis is carried out using the built-in features of the software. The formula used for calculating DNA concentration is:
Sample Concentration = DF &middot; (OD260-OD320)&middot; NACF (1)
Where DF = sample dilution factor and NACF = nucleic acid concentration factor.
The Nucleic Acid concentration factor is set in accordance with the analyte selected1.
Protein concentration results can be expressed as &mu;g/ mL or as moles/L by entering e280 and molecular weight values respectively. When residue values for Tyr, Trp and Cysteine (S-S bond) are entered in the e280Calc tab, the extinction coefficient values are calculated as e280 = 5500 x (Trp residues) + 1490 x (Tyr residues) + 125 x (cysteine S-S bond). The e280 value is used by the software for concentration calculation.
In addition to concentration determination of nucleic acids and protein, the BioSpec-nano can be used as an ultra micro-volume spectrophotometer for many other analytes or as a standard spectrophotometer using 5 mm pathlength cells.

This communication presents data on the accuracy and reproducibility of the BioSpec-nano UV-VIS spectrophotometer for dsDNA and protein quantitation. Even with ultra-small volumes (1 to 2 L), reproducibility is excellent, while the automated wiping function improves throughput and results in minimal carryover for more precise results.

마이크로 볼륨 바이오 사양 나노 분광 광도계를 사용하여 핵산 및 단백질 농도 결정

Nucleic Acid quantitation procedures have advanced significantly in the last three decades.  More and more, molecular biologists require consistent ...

In vivo Liver Endocytosis Followed by Purification of Liver Cells by Liver Perfusion

The liver is the metabolic center of the mammalian body and serves as a filter for the blood. The basic architecture of the liver is illustrated in figure 1 in which more than 85% of the liver mass is composed of hepatocytes and the remaining 15% of the cellular mass is composed of Kupffer cells (KCs), stellate cells (HSCs), and sinusoidal endothelial cells (SECs). SECs form the blood vessel walls within the liver and contain specialized morphology called fenestrae within in the cytoplasm. Fenestration of the cytoplasm is the appearance of holes (&tilde;100 &mu;m) within the cells so that the SECs act as a sieve in which most chylomicrons, chylomicron remnants and macromolecules, but not cells, pass through to the hepatocytes and HSCs 1 (Fig. 1). Due to the lack of a basement membrane, the gap between the SECs and hepatocytes form the Space of Disse. HSCs occupy this space and play a prominent role in regulation and response to injury, storage of retinoic acid and immunoregulation of the liver 2.
SECs are among the most endocytically active cells of the body displaying an array of scavenger receptors on their cell surface 3. These include SR-A, Stabilin-1 and Stabilin-2. Generally, small colloidal particles less than 230 nm and macromolecules in buffer phase are taken up by SECs, whereas, large particles and cellular debris is endocytosed (phagocytosed) by KCs 4. Thus, the bulk clearance of extracellular material such as the glycosaminoglycans from blood is largely dependent on the health and endocytic functions of SECs 5,6. For example, an increase in blood hyaluronan levels is indicative of liver disease ranging from mild to more severe forms 7.
With the exception of one report 8, there are no immortalized SEC cell lines in existence. Even this immortalized cell line is de-differentiated in that it does not express scavenger receptors that are present on primary SECs (our data, not shown). All cell biological studies must be performed on primary cells obtained freshly from the animal. Unfortunately, SECs dedifferentiate under standard culture conditions and must be used within 1 or 2 days upon isolation from the animal. Differentiation of SECs is marked by the expression of Stabilin-2 or HARE receptor 9 , CD31, and the presence of cytoplasmic fenestration 1. Differentiation of SECs can be extended by the addition of VEGF in culture media or by culturing cells in hepatocyte conditioned medium 10,11.
In this report, we will demonstrate the endocytic activity of SECs in the intact organ using radio-labeled heparin for hyaluronan for the SEC-specific Stabilin-2 receptor. We will then purify hepatocytes and SECs from the perfused liver to measure endocytosis.

In vivo Liver Endocytosis Followed by Purification of Liver Cells by Liver Perfusion

The study of liver sinusoidal endothelial cells (SECs) must be performed with primary cells obtained from the animal as no cell lines exist. This method relies on liver digestion and differential centrifugation for SEC purification for subsequent culturing and experimentation.

간 재관류에 의한 간 세포의 정화를 얹는 생체내 간 Endocytosis에서

The liver is the metabolic center of the mammalian body and serves as a filter for the blood.  The basic architecture of the liver is illustrated in ...

A PCR-based Genotyping Method to Distinguish Between Wild-type and Ornamental Varieties of Imperata cylindrica

Wild-type I. cylindrica (cogongrass) is one of the top ten worst invasive plants in the world, negatively impacting agricultural and natural resources in 73 different countries throughout Africa, Asia, Europe, New Zealand, Oceania and the Americas1-2. Cogongrass forms rapidly-spreading, monodominant stands that displace a large variety of native plant species and in turn threaten the native animals that depend on the displaced native plant species for forage and shelter. To add to the problem, an ornamental variety [I. cylindrica var. koenigii (Retzius)] is widely marketed under the names of Imperata cylindrica 'Rubra', Red Baron, and Japanese blood grass (JBG). This variety is putatively sterile and noninvasive and is considered a desirable ornamental for its red-colored leaves. However, under the correct conditions, JBG can produce viable seed (Carol Holko, 2009 personal communication) and can revert to a green invasive form that is often indistinguishable from cogongrass as it takes on the distinguishing characteristics of the wild-type invasive variety4 (Figure 1). This makes identification using morphology a difficult task even for well-trained plant taxonomists. Reversion of JBG to an aggressive green phenotype is also not a rare occurrence. Using sequence comparisons of coding and variable regions in both nuclear and chloroplast DNA, we have confirmed that JBG has reverted to the green invasive within the states of Maryland, South Carolina, and Missouri. JBG has been sold and planted in just about every state in the continental U.S. where there is not an active cogongrass infestation. The extent of the revert problem in not well understood because reverted plants are undocumented and often destroyed.
Application of this molecular protocol provides a method to identify JBG reverts and can help keep these varieties from co-occurring and possibly hybridizing. Cogongrass is an obligate outcrosser and, when crossed with a different genotype, can produce viable wind-dispersed seeds that spread cogongrass over wide distances5-7. JBG has a slightly different genotype than cogongrass and may be able to form viable hybrids with cogongrass. To add to the problem, JBG is more cold and shade tolerant than cogongrass8-10, and gene flow between these two varieties is likely to generate hybrids that are more aggressive, shade tolerant, and cold hardy than wild-type cogongrass. While wild-type cogongrass currently infests over 490 million hectares worldwide, in the Southeast U.S. it infests over 500,000 hectares and is capable of occupying most of the U.S. as it rapidly spreads northward due to its broad niche and geographic potential3,7,11. The potential of a genetic crossing is a serious concern for the USDA-APHIS Federal Noxious Week Program. Currently, the USDA-APHIS prohibits JBG in states where there are major cogongrass infestations (e.g., Florida, Alabama, Mississippi). However, preventing the two varieties from combining can prove more difficult as cogongrass and JBG expand their distributions. Furthermore, the distribution of the JBG revert is currently unknown and without the ability to identify these varieties through morphology, some cogongrass infestations may be the result of JBG reverts. Unfortunately, current molecular methods of identification typically rely on AFLP (Amplified Fragment Length Polymorphisms) and DNA sequencing, both of which are time consuming and costly. Here, we present the first cost-effective and reliable PCR-based molecular genotyping method to accurately distinguish between cogongrass and JBG revert.

A PCR-based Genotyping Method to Distinguish Between Wild-type and Ornamental Varieties of Imperata cylindrica

We provide a cost-effective and rapid molecular genotyping protocol that employs variety-specific PCR primers that target DNA sequence differences within the chloroplast trnL-F spacer region to differentiate between varieties of Imperata cylindrica (cogongrass) that cannot be distinguished by morphology alone. These varieties include the federally listed noxious weed, cogongrass and closely-related, wide-spread ornamental variety, I. cylindrica var. koenigii (Japanese blood grass).

의 야생 - 타입과 장식 품종을 구별하기 PCR 기반 Genotyping 방법 Imperata cylindrica</em

Wild-type I. cylindrica (cogongrass) is one of the top ten worst invasive plants in the world, negatively impacting agricultural and natural resources in ...

Do-It-Yourself Device for Recovery of Cryopreserved Samples Accidentally Dropped into Cryogenic Storage Tanks

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term storage of biological materials such as blood, cells and tissues 1,2. The cryogenic nature of liquid nitrogen, while ideal for sample preservation, can cause rapid freezing of live tissues on contact - known as 'cryogenic burn'2, which may lead to severe frostbite in persons closely involved in storage and retrieval of samples from Dewars. Additionally, as liquid nitrogen evaporates it reduces the oxygen concentration in the air and might cause asphyxia, especially in confined spaces2.
In laboratories, biological samples are often stored in cryovials or cryoboxes stacked in stainless steel racks within the Dewar tanks1. These storage racks are provided with a long shaft to prevent boxes from slipping out from the racks and into the bottom of Dewars during routine handling. All too often, however, boxes or vials with precious samples slip out and sink to the bottom of liquid nitrogen filled tank. In such cases, samples could be tediously retrieved after transferring the liquid nitrogen into a spare container or discarding it. The boxes and vials can then be relatively safely recovered from emptied Dewar. However, the cryogenic nature of liquid nitrogen and its expansion rate makes sunken sample retrieval hazardous. It is commonly recommended by Safety Offices that sample retrieval be never carried out by a single person. Another alternative is to use commercially available cool grabbers or tongs to pull out the vials3. However, limited visibility within the dark liquid filled Dewars poses a major limitation in their use.
In this article, we describe the construction of a Cryotolerant DIY retrieval device, which makes sample retrieval from Dewar containing cryogenic fluids both safe and easy.

Here we present a low cost, durable cryotolerant device for sample retrieval from Dewar tanks filled with liquid nitrogen. The ease of construction and modular design of the device makes the process of sample retrieval from cryogenic tanks safe and easy.

Cryopreserved 샘플 복구를 위해 손수 함 장치 실수로 극저온 저장 탱크 떨어졌고

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term ...

Milk Collection Methods for Mice and Reeves' Muntjac Deer

Animal models are commonly used throughout research laboratories to accomplish what would normally be considered impractical in a pathogen&#8217;s native host. Milk collection from animals allows scientists the opportunity to study many aspects of reproduction including vertical transmission, passive immunity, mammary gland biology, and lactation. Obtaining adequate volumes of milk for these studies is a challenging task, especially from small animal models. Here we illustrate an inexpensive and facile method for milk collection in mice and Reeves&#8217; muntjac deer that does not require specialized equipment or extensive training. This particular method requires two researchers: one to express the milk and to stabilize the animal, and one to collect the milk in an appropriate container from either a Muntjac or mouse model. The mouse model also requires the use of a P-200 pipetman and corresponding pipette tips. While this method is low cost and relatively easy to perform, researchers should be advised that anesthetizing the animal is required for optimal milk collection.

Milk collection from animal models facilitates various research avenues: understanding passive immunity, identifying pathogens responsible for vertical transmission and, through the use of transgenic mice, even commercial production of proteins found in human breast milk. Here we illustrate a simple method for milk collection in mice and Reeves&#8217; muntjac deer.

마우스 및 꿰 문착 사슴 우유 수집 방법

Animal models are commonly used throughout research laboratories to accomplish what would normally be considered impractical in a pathogen&#8217;s native ...

Determination of Fatty Acid Oxidation and Lipogenesis in Mouse Primary Hepatocytes

Lipid metabolism in liver is complex. In addition to importing and exporting lipid via lipoproteins, hepatocytes can oxidize lipid via fatty acid oxidation, or alternatively, synthesize new lipid via de novo lipogenesis. The net sum of these pathways is dictated by a number of factors, which in certain disease states leads to fatty liver disease. Excess hepatic lipid accumulation is associated with whole body insulin resistance and coronary heart disease. Tools to study lipid metabolism in hepatocytes are useful to understand the role of hepatic lipid metabolism in certain metabolic disorders.
In the liver, hepatocytes regulate the breakdown and synthesis of fatty acids via &#946;-fatty oxidation and de novo lipogenesis, respectively. Quantifying metabolism in these pathways provides insight into hepatic lipid handling. Unlike in vitro quantification, using primary hepatocytes, making measurements in vivo is technically challenging and resource intensive. Hence, quantifying &#946;-fatty acid oxidation and de novo lipogenesis in cultured mouse hepatocytes provides a straight forward method to assess hepatocyte lipid handling. 
Here we describe a method for the isolation of primary mouse hepatocytes, and we demonstrate quantification of &#946;-fatty acid oxidation and de novo lipogenesis, using radiolabeled substrates.

De novo lipogenesis and &#946;-fatty acid oxidation constitute key metabolic pathways in hepatocyte, pathways that are perturbed in several metabolic disorders, including fatty liver disease. Here we demonstrate isolation of mouse primary hepatocytes and describe quantification of &#946;-fatty acid oxidation and lipogenesis.

마우스 차 간세포에서 지방산 산화 및 지방 생성의 결정

Lipid metabolism in liver is complex. In addition to importing and exporting lipid via lipoproteins, hepatocytes can oxidize lipid via fatty acid ...

Milk Collection in the Rat Using Capillary Tubes and Estimation of Milk Fat Content by Creamatocrit

Milk, as the sole source of nutrition for the newborn mammal, provides the necessary nutrients and energy for offspring growth and development. It also contains a vast number of bioactive compounds that greatly affect the development of the neonate. The analysis of milk components will help elucidate key factors that link maternal metabolism and health with offspring growth and development. The laboratory rat represents a popular model organism for maternal studies, and rat milk can be used to examine the effect of various maternal physiological, nutritional, and pharmacological interventions on milk components, which may then impact offspring health. Here a simple method of manually collecting milk from the lactating rat that can be performed by a single investigator, does not require specialized vacuum or suction equipment, and provides sufficient milk for subsequent downstream analysis is described. A method for estimating the fat content of milk by measuring the percentage of cream within the milk sample, known as the creamatocrit, is also presented. These methods can ultimately be used to increase insight into maternal-child health and to elucidate maternal factors that are involved in proper growth and development of offspring.

Milk is a primary source of nutrition for the neonate. Analysis of milk components may provide insight into maternal factors that affect offspring health. This protocol describes a manual method of collecting milk samples from the lactating rat, which can then be used for further downstream analysis.

모세관 튜브 및 Creamatocrit에 의한 우유 지방 함량의 평가를 사용하여 쥐의 우유 컬렉션

Milk, as the sole source of nutrition for the newborn mammal, provides the necessary nutrients and energy for offspring growth and development. It also ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

핵산의 여과 분리 : 간단하고 신속한 DNA 추출 방법

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...