Name: determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.
Uploaded: 2017-07-14T15:00:00.000+00:00
Duration: 8 min 4 s
Description: Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

עבודה זו נתמכה בחלקו על ידי הקרן למדעי הטבע של סין (מענק מספרים 31471703, A0201300537 ו 31671854 ל JV ו LL), ואת 100 תוכנית כשרונות זרים (מענק מספר JSB2014012 ל JV).

נהלים הקשורים בבעלי חיים אושרו על ידי הוועדה האתית של המרכז החינוכי הניסויי של נאנג &#39;ינג האוניברסיטה החקלאית בהתאם להנחיות הלאומיות לרווחת בעלי חיים ניסיוני (משרד המדע והטכנולוגיה, יחסי ציבור של סין, 2006) עם בעלי החיים השוכן SPF מתקן (מזהה הרשאה: SYXK-J-2011-0037). 1. Cmah לדפוק את העכבר דגם <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש wild-type C57Bl / 6 עכברים מהמרכז הרפואי השוואתי של אוניברסיטת יאנגז &#39;ו (סין). הערה: Cmah לדפוק את העכברים נוצרו על סמך המידע שסופק מן Cmah הקודם לדפוק- out מחקרים 17 , 19 ו שהושגו מסחרית באמצעות אסטרטגיה CRISPR / Cas9 20 על ידי הסרת 92 זוגות זוג מן אקסון 6 של הגן Cmah , שהוא גם נמחק בגן CMAH האנושי 19 . חיובי F 0/ Sub&gt; -mice (2 אנשים) חצו עם עכברים מסוג בר כדי להשיג heterozygous F- 1 עכבר. לאחר חציית F הטרוזיגוטיים F- 1 (5 אנשים), הומוזיגיים Cmah לדפוק- F 2- עכברים ניתן להשיג בהצלחה (3 אנשים). </li><li style=";text-align:right;direction:rtl"> בצע genotyping של עכברים באמצעות DNA גנומי על פי השיטה המוצגת על ידי Zangala 21 באמצעות ערכת טיהור DNA מסחרי. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להגביר את קטע ה- DNA המקביל של הגן Cmah באמצעות פולימראז דנ&quot;א מסחרי ואת זוג primer 5&#39;gaaagggctcggctctgtatgaa3 &#39;ו 5&#39;tttaaaatgtcccgggtgagaagc3&#39;. בצע את הגברה הגן באמצעות 34 מחזורים PCR המורכב denaturation ב 94 מעלות צלזיוס במשך 40 s, חישול ב 63 מעלות צלזיוס במשך 40 שניות, התארכות ב 72 מעלות צלזיוס למשך 1 דקות. </li><li style=";text-align:right;direction:rtl"> דמיינו מוצרים PCR על ג&#39;ל agarose 1%. יש לצפות בלהקה בודדת (0.5 קילו-בייט) עבור האדם מסוג wild wild, פס כפול (0.4 ו -0.5 קילו-בייט) עבורהטרוזיגוסית, ולהקה בודדת (0.4 קילו-בייט) לאדם ההומו-ציגי. </li></ol></li></ol> 2. אוסף דוגמאות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> איסוף חלב עכבר באמצעות פרוטוקול המתואר על ידי Willingham et al. 22 . </li><li style=";text-align:right;direction:rtl"> איסוף רקמת הכבד העכבר באמצעות פרוטוקול המתואר על ידי Gonçalves et al. 23 ו חנות דגימות ב -80 ° C. </li></ol> 3. בידוד של חומצות סיאליות מחלב <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן 100 מ&quot;ל של פתרון 2 חומצה אצטית M על ידי הוספת 12 מ&quot;ל של חומצה אצטית קרחוני לתוך 88 מ&quot;ל של מזוקק H 2 O. </li><li style=";text-align:right;direction:rtl"> העברת 50 μL של חלב לתוך צינור 1.5 מ&quot;ל צנטריפוגה להוסיף 1.2 מ&quot;ל של תמיסת חומצה מימית מוכן. </li><li style=";text-align:right;direction:rtl"> לדגור את ההשעיה במשך 4 שעות ב 80 מעלות צלזיוס ו צנטריפוגה המדגם ב XG 14,000 במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> מעבירים את μL 1000 העליון של supernatant לתוך צינור צנטריפוגות טרי 1.5 מ&quot;ל רםOve ממס על ידי אידוי צנטריפוגלי בטמפרטורת החדר כדי להשלים יובש (בהתאם משאבת ואקום המצורפת זה ייקח 4-20 שעות). Re- להמיס את המדגם μL 500 של מזוקקים H 2 O. </li><li style=";text-align:right;direction:rtl"> הכן טור חילופי מיקרו אניון. שלב זה יהיה להעשיר תרכובות anionic במיוחד ולהסיר תרכובות קטיוני וניטרלי מן דגימות חלב וכבד, ולכן מגביר את הסלקטיביות של fluorogenic OPD סוכן תיוג עבור derivatization חומצה sialic. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> העברה עבור כל מדגם 200 מ&quot;ג של שרף חילופי אניון (Dowex 1X8) לתוך צינורות ריק 3 מ&quot;ל טור עם שסתום המצורפת. </li><li style=";text-align:right;direction:rtl"> הוסף 2 מ&quot;ל של תמיסת חומצה אצטית מימית מוכן בשלב 3.1 כדי להחליף את יוני כלור שרף עם יונים אצטט. סגור את שסתום ברגע ממס מגיע לראש שרף. </li><li style=";text-align:right;direction:rtl"> בעדינות להוסיף 2 מ&quot;ל של מזוקק H 2 O, לפתוח את שסתום לעצור את הזרימה ברגע שרוב הממס מגיעהחלק העליון של השרף. ודא כי שרף תמיד מכוסה ממס. </li><li style=";text-align:right;direction:rtl"> שטפו את שרף טור פעמיים נוספות עם 2 מ&quot;ל של מזוקק H 2 O להסרת עודף אצטט. </li></ol></li><li style=";text-align:right;direction:rtl"> מעבירים את μL 500 וכתוצאה מכך ממס מדגם משלב 3.4. על העמוד שרף וזורקים את הזרימה דרך. בעדינות לשטוף את שרף עם 2 מ&quot;ל של מזוקקים H 2 O. Elute אניונים מדגם מן שרף באמצעות 1 מ&quot;ל של פתרון 50 מ&quot;מ אמוניום אצטט (386 מ&quot;ג של אצטט אמוניום מומס 100 מ&quot;ל של מזוקק H 2 O) לתוך 1.5 מ&quot;ל צינור צנטריפוגה. הסר את הממס על ידי אידוי צנטריפוגלי בטמפרטורת החדר ליובש. הערה: דגימות יבשות ניתן לאחסן על 4-6 מעלות צלזיוס למשך עד 12 חודשים. </li></ol> 4. בידוד של חומצות סיאליות מ רקמת כבד <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בעדינות להפשיר 20 - 50 מ&quot;ג של הכבד העכבר ולהעביר אותו לתוך מטחנת רקמה Dounce (1 מ&quot;ל או 2 מ&quot;ל של נפח). הוסף 1.2 מ&quot;ל של תמיסת חומצה אצטית מימיתמוכן בשלב 3.1 ו homogenize הרקמה על ידי גז עדין במשך 10 s. מעבירים את ההשעיה וכתוצאה מכך צינור צנטריפוגות 1.5 מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> בצע את השלבים 3.3. Solid הערה: דגימות יבשות ניתן לאחסן על 4-6 מעלות צלזיוס למשך עד 12 חודשים. </li></ol> 5. הכנת תקן חומצה Sialic מעורב <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> שוקלים בין 5 - 8 מ&quot;ג של חומצה N-acetylneuraminic על איזון אנליטית לתוך צינור 1.5 צנטריפוגות מ&quot;ל. שים לב למשקל המדויק ולהוסיף 164 μL של H 2 מזוקק עבור כל מ&quot;ג ( כלומר אם המשקל של Neu5Ac הוא 7.2 מ&quot;ג ואז להוסיף 7.2 x 164 = 1, 181 μL של מזוקק H 2 O). התוצאה היא פתרון 20 מ&quot;מ Neu5Ac המניות אשר ניתן לאחסן ב -20 מעלות צלזיוס למשך 12 חודשים. </li><li style=";text-align:right;direction:rtl"> השג N-glycolylneuraminic חומצה בכמויות קטנות במחיר מתון כגון 1 מ&quot;ג aliquots. הוסף 154 μL של מזוקק H 2 O ישירות למתחם על מנת להשיג ~ 20 מ&quot;מ Neu5Gc פתרון המניות. להעביר אתפתרון לתוך צינור צנטריפוגה 1.5 מ&quot;ל. פתרון זה ניתן לאחסן ב -20 מעלות צלזיוס למשך 12 חודשים. </li><li style=";text-align:right;direction:rtl"> שלב 5 μL מהפתרון כל המניות משלב 5.1 ו 5.2 לתוך צינור צנטריפוגה טרי 1.5 מ&quot;ל ולהסיר את הממס על ידי אידוי צנטריפוגלי בטמפרטורת החדר ליובש. הערה: תקן חומצה sialic מעורב יכול להיות מאוחסן על 4 - 6 מעלות צלזיוס למשך עד 12 חודשים. </li></ol> 6. הקרינה Derivatization של חומצות Sialic <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן 10 מ&quot;ל של OPD פתרון, בהיקף של 100 מ&quot;ג של o-phenylenediamine o ו 208 מ&quot;ג של מימן sulfite נתרן 10 מ&quot;ל של מזוקק H 2 O. </li><li style=";text-align:right;direction:rtl"> הוסף 20 μL של OPD פתרון לדגימות חומצה sialic נגזר חלב העכבר (שלב 3), כבד העכבר (שלב 4), או תקן חומצה sialic מעורבת (שלב 5). וורטקס במרץ עבור 30 ד ו דגירה דגימות במשך 4 שעות ב 80 ° C בחושך ( כלומר לעטוף את microtubes רדיד אלומיניום). </li><li style=";text-align:right;direction:rtl"> בואו הדגימות להתקרר במשך 5 דקות, להוסיף 80 μ, L מזוקקים H 2 O ו צנטריפוגה צינורות ב XG 14,000 במשך 1 דקות. </li><li style=";text-align:right;direction:rtl"> העברת 80 μL מן supernatant לתוך בקבוקון 300 μL גבוהה התאוששות HPLC. הדגימות חומצה sialic derivatized ניתן לאחסן 4 - 6 מעלות צלזיוס למשך עד שבוע אחד. </li></ol> 7. HPLC ניתוח של Sialic חומצה נגזרים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ניתוח הדגימות באמצעות מערכת HPLC סטנדרטי מחובר גלאי פלואורסצנטי באינטרנט. </li><li style=";text-align:right;direction:rtl"> השתמש טור שלב C18 הפוך עם ממדים סטנדרטיים של 250 מ&quot;מ אורך ו 4.6 מ&quot;מ קוטר לניתוח. </li><li style=";text-align:right;direction:rtl"> הכן ממס על ידי דילול 200 מ&quot;ל של פתרון המניות עם 800 מ&quot;ל של מים כיתה LCMS (LCMS - כרומטוגרפיה כרומטוגרפית נוזלית מסה). פתרון המניות עצמו יכול להיות מוכן כדלקמן: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף 46 גרם של חומצה פורמית ל 800 מ&quot;ל של LCMS כיתה H 2 O. </li><li style=";text-align:right;direction:rtl"> התאם את pH 4.5 על ידי הוספת drop הוספת hydroxide אמוניום פתרון (purissa הרשות). </li><li style=";text-align:right;direction:rtl"> מעבירים את הממס למדידת גליל ולמלא עד 1000 מ&quot;ל עם LCMS כיתה H 2 O. פתרון זה המניות ניתן לאחסן 4 - 6 מעלות צלזיוס למשך עד 3 חודשים. </li></ol></li><li style=";text-align:right;direction:rtl"> עבור ממס B, השתמש אצטוניטריל LCMS בכיתה. </li><li style=";text-align:right;direction:rtl"> להפריד את חומצות sialic נגזרים בקצב 1 מ&quot;ל / דקות הזרימה עם elution הבאות gradient: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> התחל על ידי הוספת 10% של ממס ב &#39;מעורב א ממס א. </li><li style=";text-align:right;direction:rtl"> מ 0 דקות עד 15 דקות, להגדיל בהדרגה את שיעור ממס B עם שיפוע ליניארי ל 60%. </li><li style=";text-align:right;direction:rtl"> מ 15 דקות עד 16 דקות, להגדיל במהירות את שיעור ממס B עם שיפוע ליניארי מ 60% ל 90%. זה יוזם את הכביסה של העמוד HPLC. </li><li style=";text-align:right;direction:rtl"> כדי לשטוף עוד את העמודה HPLC, לשמור על רמת ממס ב 90% בין 16 דקות ו 18 דקות לפני הפחתת בהדרגה את רמת ממס ממס שוב 10% בין 18 דקות ו 19 דקות. </li><li style=";text-align:right;direction:rtl"> Re-equilibrate עמודות HPLC לתנאי ההתחלה של 10% B בין 19 ו 24 דקות. </li></ol></li><li style=";text-align:right;direction:rtl"> בJect 50 μL של המדגם לתוך מערכת HPLC. </li><li style=";text-align:right;direction:rtl"> צג eluents באמצעות גלאי פלואורסצנטי עירור / פליטת גלים של 373/448 ננומטר, ואת חומצות sialic derivatized ניתן לצפות בשעה משוער פעמים של 9 דקות (עבור Neu5Gc-OPD) ו 10 דקות (עבור Neu5Ac-OPD). </li><li style=";text-align:right;direction:rtl"> לחשב את הסכום היחסי של Neu5Gc (F Neu5Gc) מאזורי השיא הקרינה של Neu5Ac (א Neu5Ac) ו Neu5Gc (א Neu5Gc) כדלקמן: F Neu5Gc [%] = 100 × Neu5Gc / (א Neu5Gc Neu5Ac + A). במקרה של דגימות חלב וכבד מן העכבר Cmah לדפוק החוצה עכבר F Neu5Gc צריך להיות 0%, ואילו הערכים עבור F Neu5Gc של העכברים הטרוזיגיים wild-type עשוי להשתנות במידה רבה בהתאם לגיל העכבר ואת סוג הרקמה (בין 2% ו - 90%) עם שולי שגיאה צפויים של ± 12%. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

למחברים אין מה לגלות.

הפרוטוקול המוצג כאן מאפשר הערכה פנוטיפית של הומוזיגוס Cmah לדפוק את העכברים על ידי ניתוח וכימות כמויות יחסית של Neu5Gc של חלב ודגימות כבד. הניתוח בוצע באמצעות התקנה סטנדרטית HPLC עם זיהוי פלואורסצנטי. השלב הקריטי ביותר של הליך זה הוא הכנת העמודות חילופי אניון וביצוע כ?...

N-Acetylneuraminic חומצה (Neu5Ac) ו- N-glycolylneuraminic חומצה (Neu5Gc) הם חומצות sialic הנפוצים ביותר יונקים 1 . למרות יכולת סינתזה Neu5Ac endogenously, בני אדם אינם מסוגלים לייצר Neu5Gc בשל מחיקת אקסון העיקרי על קידוד הגן CMAH עבור הידרוקסילאז CMP-Neu5Ac 2 , 3 . עם זאת, מוצרי מזון המבוססים על בעלי חיים יכולים להיות מקורות תזונתיים של Neu5Gc 4 , 5 , 6 , המוביל לייצור נוגדנים נוגדי Neu5Gc ולכן מפעיל תגובה חיסונית כלפי Neu5Gc 7 . השפעה זו תזונתית של Neu5Gc חשוד לתרום דלקת כרונית ומחלות שונות 8 , 9 , 10 . על מנת להבין את ההשפעות של Neu5Gc ב חUmans, מודל חיה עבור המחקר השיטתי של ההשפעות של חומצות סיאליות במזון הוא רצוי מאוד. למרות פרוטוקולים המבוססים על תגובת שרשרת פולימראז (PCR) לניתוח של נוק- out עכברים מבוססים היטב דרך נוחה להערכה genotypical, ניתוח פונקציונלי של פנוטיפ ברמה המטבולית דורש שיטות ניתוח ספציפי יותר. פנוטיפ של מודל Cmah לדפוק את העכבר ניתן להעריך על ידי בידוד וניתוח הרכב של חומצות sialic בדגימות כבד או חלב. מספר שיטות לאיתור חומצות סיאליות ברקמות בעלי חיים דווחו בעבר: תגובה של חומצות סיאליות עם רסורצינול 11 או חומצה thiobarbituric 12 לגרום להיווצרות של מוצר chromophoric וניתן פשוט ניתח באמצעות ההתקנה מבוסס platereader, אבל רק את סך sialic ניתן לקבוע תוכן חומצי. לחלופין, ניתוח של חומצות sialic תוארה גם באמצעות כרומטוגרפיה גז13 , MALDI-ToF ספקטרומטריית מסה 14 או שיטות אמפומטריות 15 . עם זאת, הנפוץ ביותר sialic החלים שיטות ניתוח מבוססים על שחרור hydrolytic, ואחריו derivatization פלואורסצנטי ואחריו ביצועים גבוהים כרומטוגרפיה נוזלית 16 , 17 , 18 .

<table><tbody><tr><td>&lt;strong&gt;Chemicals:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>N-acetylneuraminic acid</td><td>Sigma</td><td>A0812</td><td></td></tr><tr><td>N-glycolylneuraminic acid</td><td>Sigma</td><td>50644</td><td>1 mg aliquot should be sufficient</td></tr><tr><td>o-Phenylenediamine</td><td>Sigma</td><td>694975</td><td></td></tr><tr><td>Sodium hydrogen sulfite</td><td>J&amp;amp;K Scientific Ltd</td><td>75234</td><td></td></tr><tr><td>&lt;strong&gt;Tools/Materials:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>3 mL SPE tubes</td><td>Supelco</td><td>Sigma 57024</td><td>empty solid phase extraction columns</td></tr><tr><td>Luer stopcock</td><td>Sigma</td><td>S7396</td><td>to stop the flow of the SPE tube</td></tr><tr><td>Dowex 1X8</td><td>Dow Chemicals</td><td>Sigma 44340</td><td>200 - 400 mesh</td></tr><tr><td>Dounce tissue grinder</td><td>Sigma</td><td>D8938</td><td>tight fit</td></tr><tr><td>&lt;strong&gt;HPLC Analysis:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>High-recovery HPLC vial</td><td>Agilent Technologies</td><td>#5188-2788</td><td></td></tr><tr><td>HPLC System</td><td>Shimadzu</td><td>Nexera</td><td></td></tr><tr><td>Fluorescence Detector for HPLC</td><td>Shimadzu</td><td>RF-20Axs</td><td></td></tr><tr><td>HPLC Column</td><td>Phenomenex</td><td>Hyperclone ODS</td><td>250 x 4.6 mm</td></tr><tr><td>LCMS-grade H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Merck Millipore</td><td>#WX00011</td><td></td></tr><tr><td>LCMS-grade Acetonitrile</td><td>Merck Millipore</td><td>#100029</td><td>Hypergrade</td></tr><tr><td>Ammonium hydroxide solution</td><td>Fluka</td><td>#44273</td><td>puriss. P.a.</td></tr></tbody></table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

CMAH (cytidine monophosphate-N-Acetylneuraminic acid hydroxylase) הוא אחראי על החמצון של חומצות cytidine monophosphate-N- אצטילנורמין ב יונקים. עם זאת, בני אדם לא יכולים לחמצן cytidine monophosphate-N- חומצה אצטילנוראמית כדי cytidine monophosphate-N- חומצה glycolylneuraminic בשל מחיקת אקסון העיקרי של הגן CMAH . כדי להבין את ההשפעות ואת ההשלכות של חוסר פעילות CMAH בפירוט רב יותר, מודל Cmah לדפוק את העכברים הוא עניין רב במחקר בסיסי ויישומי. שיטת ניתוח כדי לקבוע את הפנוטיפ של מודל העכבר כאן הוא תיאר בפירוט, והוא מבוסס על זיהוי של שניהם חומצה N-acetylneuraminic ו- N-glycolylenuraminic חומצה בכבד וחלב של wild-type ו- Cmah לדפוק את העכברים. חומצות sialic אנדוגניים משתחררים ו derivatized עם o-phenylenediamine לייצר נגזרות fluorogenic, אשר ניתן לנתח לאחר מכן על ידי HPLC. הפרוטוקול המוצג יכול להיותחל גם על ניתוח של דגימות חלב ורקמות ממקורות שונים אחרים, והוא עשוי להיות שימוש כדי לחקור את התזונתיים ואת ההשפעות הבריאותיות של N-glycolylneuraminic חומצה.

סקירה סכמטית של שיטת הניתוח המתואר מוצג באיור 1 וכולל את הבידוד של חומצות sialic מדגימות חלב וכבד של wild-type ו- Cmah לדפוק- out עכברים מוטציה, ו derivatization פלואורסצנטי וניתוח HPLC של רכיבים אלה. איור 2 איור 3 להרא...

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

אנו מתארים שיטה מבוססת HPLC לקביעת חומצה N-acetylneuraminic ו- N-glycolylenuraminic חומצה בכבד העכבר חלב.

קביעת חומצות סיאליות בדגימות כבד וחלב של סוג הבר<em&gt; CMAH</em&gt; נוק- out עכברים.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K Views.  Nanjing Agricultural University.  אנו מתארים שיטה מבוססת HPLC לקביעת חומצה N-acetylneuraminic ו- N-glycolylenuraminic חומצה בכבד העכבר חלב. 

Video: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Determining Bile Duct Density in the Mouse Liver

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques are used, including serum chemistry, histological analysis, and immunostaining for specific markers. Although these techniques can provide important information about the biliary system, they often do not present a full picture of bile duct (BD) developmental defects across the whole liver. This is in part due to the robust ability of the mouse liver to drain the bile even in animals with significant impairment in biliary development. Here we present a simple method to calculate the average number of BDs associated with each portal vein (PV) in sections covering all lobes of mutant/transgenic mice. In this method, livers are mounted and sectioned in a stereotypic manner to facilitate comparison among various genotypes and experimental conditions. BDs are identified via light microscopy of cytokeratin-stained cholangiocytes, and then counted and divided by the total number of PVs present in liver section. As an example, we show how this method can clearly distinguish between wild-type mice and a mouse model of Alagille syndrome. The method presented here cannot substitute for techniques that visualize the three-dimensional structure of the biliary tree. However, it offers an easy and direct way to quantitatively assess BD development and the degree of ductular reaction formation in mice.

We present a rather simple and sensitive method for accurate quantification of bile duct density in the mouse liver. This method can aid in determining the effects of genetic and environmental modifiers and the effectiveness of potential therapies in mouse models of biliary diseases.

קביעת צפיפות צינור המרה בכבד העכבר

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques ...

Developmental Biology

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing termini of oligo- and polysaccharides, as well as its unique chemical characteristics, sialic acid is involved in a multitude of different receptor-ligand interactions. By modifying the expression of sialic acid on the cell surface, sialic acid-dependent interactions will consequently be influenced. This can be helpful to investigate sialic acid-dependent interactions and has the potential to influence certain diseases in a beneficial way. Via metabolic glycoengineering (MGE), the expression of sialic acid on the cell surface can be modulated. Herein, cells, tissues, or even entire animals are treated with C2-modified derivatives of N-acetylmannosamine (ManNAc). These amino sugars act as sialic acid precursor molecules and therefore are metabolized to the corresponding sialic acid species and expressed on glycoconjugates. Applying this method produces intriguing effects on various biological processes. For example, it can drastically reduce&#160;the expression of polysialic acid (polySia) in treated neuronal cells and thus affects neuronal growth and differentiation. Here, we show the chemical synthesis of two of the most common C2-modified N-acylmannosamine derivatives, N-propionylmannosamine (ManNProp) as well as N-butanoylmannosamine (ManNBut), and further show how these non-natural amino sugars can be applied in cell culture experiments. The expression of modified sialic acid species is quantified by high performance liquid chromatography (HPLC) and further analyzed via mass spectrometry. The effects on polysialic acid expression are elucidated via Western blot using a commercially available polysialic acid antibody.

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid is a typical monosaccharide-unit found in glycoconjugates. It is involved in a plethora of molecular and cellular interactions. Here we present a method to modify cell surface sialic acid expression using metabolic glycoengineering with N-acetylmannosamine derivatives.

Glycoengineering מטבולית של חומצה Sialic באמצעות N-acyl השומן-שונה Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing ...

Bioengineering

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible animal models mirror common components of human disease, including the bm12 transfer model. Upon transfer of bm12 splenocytes or purified CD4 T cells, C57BL/6 mice rapidly develop large frequencies of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells followed by high levels of circulating anti-nuclear antibodies. Since this model utilizes mice on a pure C57BL/6 background, researchers can quickly and easily study disease progression in transgenic or knockout mouse strains in a relatively short period of time. Here we describe protocols for the induction of the model and the quantitation Tfh, GC B cells, and plasma cells by multi-color flow cytometry. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells, and plasma cells in other disease models.

The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

דגם bm12 העין מתנהל של זאבת אדמנתית המערכתית (לופוס) בC57BL עכברים / 6

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible ...

Medicine

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

שיטת המדידה של תפקוד בלוטת הרוק בעכברים

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

Immunology and Infection

Using a Bacterial Pathogen to Probe for Cellular and Organismic-level Host Responses

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' pathogens (Listeria monocytogenes, Shigella flexneri, Burkholderia pseudomallei, Francisella tularensis, and Rickettsia spp.) gain access to the infected cell cytosol by physically and enzymatically degrading the primary vacuolar membrane. Once in the cytosol, these pathogens both proliferate as well as generate sufficient mechanical forces to penetrate the plasma membrane of the host cell in order to infect new cells. Here, we show how this terminal step of the cellular infection cycle of L. monocytogenes (Lm) can be quantified by both colony-forming unit assays and flow cytometry and give examples of how both pathogen- and host-encoded factors impact this process. We also show a close correspondence of Lm infection dynamics of cultured cells infected in vitro and those of hepatic cells derived from mice infected in vivo. These function-based assays are relatively simple and can be readily scaled up for discovery-based high-throughput screens for modulators of eukaryotic cell function.

We describe both in vitro and in vivo infection assays that can be used to analyze the activities of host-encoding factors.

שימוש פתוגן חיידקי כדי בדיקה עבור הסלולר והמארח אורגניזם ברמת התגובות

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' ...

Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by goblet cells and the gastric mucosa, provide the scaffold for a micrometers-thick mucus layer that lines the epithelia of the gut and respiratory tract3,4. In addition to mucins, mucus layers also contain antimicrobial peptides, cytokines, and immunoglobulins5-9. The mucus layer is an important part of host innate immunity, and forms the first line of defense against invading microorganisms8,10-12. As such, the mucus is subject to numerous interactions with microbes, both pathogens and symbionts, and secreted mucins form an important interface for these interactions. The study of such biological interactions usually involves histological methods for tissue collection and staining. The two most commonly used histological methods for tissue collection and preservation in the clinic and in research laboratories are: formalin fixation followed by paraffin embedding, and tissue freezing, followed by embedding in cryo-protectant media.
Paraffin-embedded tissue samples produce sections with optimal qualities for histological visualization including clarity and well-defined morphology. However, during the paraffin embedding process a number of epitopes become altered and in order to study these epitopes, tissue sections have to be further processed with one of many epitope retrieval methods13. Secreted mucins and lipids are extracted from the tissue during the paraffin-embedding clearing step, which requires prolong incubation with organic solvents (xylene or Citrisolv). Therefore this approach is sub-optimal for studies focusing on the nature and distribution of mucins and mucus in vivo.
In contrast, freezing tissues in Optimal Cutting Temperature (OCT) embedding medium avoids dehydration and clearing of the sample, and maintains the sample hydration. This allows for better preservation of the hydrated mucus layer, and thus permits the study of the numerous roles of mucins in epithelial biology. As this method requires minimal processing of the tissue, the tissue is preserved in a more natural state. Therefore frozen tissues sections do not require any additional processing prior to staining and can be readily analyzed using immunohistochemistry methods.
We demonstrate the preservation of micrometers-thick secreted mucus layer in frozen colon samples. This layer is drastically reduced when the same tissues are embedded in paraffin. We also demonstrate immunofluorescence staining of glycan epitopes presented on mucins using plant lectins. The advantage of this approach is that it does not require the use of special fixatives and allows utilizing frozen tissues that may already be preserved in the laboratory.

Unfixed frozen tissue samples embedded in Optimal Cutting Temperature medium (OCT) can be used to study natural distribution and glycosylation of secreted mucus. In this approach tissue processing is minimal and the natural presentation of glycolipids, mucins and glycan-epitopes is preserved. Tissue sections can be analyzed by immunohistochemistry using fluorescence or chromogenic detection.

שימוש ברקמות תתבטלנה, קפואות ללמוד הפצת mucin טבעית

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by ...

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients with autoimmune hepatitis. The overwhelming majority of patients with DIH are women. The underlying mechanisms of these sex differences in prevalence are unclear because of the paucity of animal models that mimic human disease. Even so, underlying mechanisms are widely believed to be associated with human leukocyte antigen haplotypes and sex hormones. In contrast, using a DIH mouse model, we have uncovered that IL-4 initiated&#160;CD4+ T cells directed against an epitope of cytochrome P450 2E1 induces influx of neutrophils, macrophages and mast cells into the livers of female BALB/c mice. Using this model, we have also shown that IL-33-induced FoxP3+regulatory T cells confer protection against DIH in female and male mice. This DIH model is induced by immunizing mice with an epitope of CYP2E1 that has been covalently altered with a drug metabolite that has been associated with DIH. This epitope is recognized by patients with DIH. Our method induces robust and reproducible hepatitis and autoantibodies that can be utilized to study the pathogenesis of DIH. While in vivo studies can cause undue pain and distress in mice when done improperly, the advantage of an in vivo model is the ability to evaluate the pathogenesis of disease in a large number of mice. Additionally, biological effects of the altered liver proteins can be studied using invasive procedures. The addition of in vitro studies to the experimental design allows rapid repetition and mechanistic analysis at a cellular level. Thus, we will demonstrate our model protocol and how it can be utilized to study in vivo and in vitro mechanisms of DIH.

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

אינדוקציה של הפטיטיס אוטואימונית הנגרמת על ידי תרופות בעכברי BALB/c לחקר המנגנונים הפתוגניים שלה

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

גרימת דלקת קרום הגרון הקבוצה C בעכברים באמצעות משלוח התאיים

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Indirect Immunofluorescence on Frozen Sections of Mouse Mammary Gland

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple method for the immune detection of proteins, the mouse lactating mammary gland being taken as an example. A protocol for the preparation of the tissue samples, especially concerning the dissection of mouse mammary gland, tissue fixation and frozen tissue sectioning, are detailed. A standard protocol to perform indirect immunofluorescence, including an optional antigen retrieval step, is also presented. The observation of the labeled tissue sections as well as image acquisition and post-treatments are also stated. This procedure gives a full overview, from the collection of animal tissue to the cellular localization of a protein. Although this general method can be applied to other tissue samples, it should be adapted to each tissue/primary antibody couple studied.

The indirect immunofluorescence protocol described in this article allows the detection and the localization of proteins in the mouse mammary gland. A complete method is given to prepare mammary gland samples, to perform immunohistochemistry, to image the tissue sections by fluorescence microscopy, and to reconstruct images.

Immunofluorescence עקיף על סעיפים קפואים של עכבר בלוטת החלב

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple ...

<meta charset="utf8"></head><body>שיטה אופטימלית לאדם יחיד לאיסוף חלב במחקרי הנקה של עכברים

An Efficient Single-Person Technique for Milk Sampling from Laboratory Mice

Rodent models have been widely used in biology since the early 20th century to study basic physiology and biochemical mechanisms. In lactation and neonatal development research, there is a need to sample milk to determine the composition and how milk may be affected by experimental manipulations, thereby impacting newborn development. Collecting biofluids in sufficient amounts from small rodents can be difficult. Several studies have demonstrated different techniques to obtain milk from mice. However, these techniques often require at least two trained personnel, which may be challenging in some cases.&#160;
Here, we demonstrate a modified milk sampling technique based on a method published in 2009. With this affordable and easy-to-assemble method, one trained person can routinely obtain 0.1&#8211;0.5 mL of milk from a dam under anesthesia in less than 10 min. Using this method, we collected sufficient milk on post-delivery day 2 (PD2) and post-delivery day 10 (PD10). We measured milk macronutrient components and compared them with the existing literature to validate our collection method.&#160;
We recorded that on PD2, milk protein averaged at 70.1 &#177; 5.2 g/L, milk fat was 174.4 &#177; 7.1 g/L, and milk lactose was 12.3 &#177; 0.6 g/L. On PD10, while milk lactose and protein remained at similar concentrations as on PD2, milk fat was significantly higher (224.4 &#177; 17.1 g/L). We also observed that the relative abundance of individual milk proteins varied between PD2 and PD10. More specifically, &#945;S1-casein and whey acidic protein were higher, while &#946;-casein was lower at PD10 compared with PD2. Overall, we demonstrate an efficient single-person technique for milk sampling from mice using a device that can easily be assembled with commonly used laboratory equipment.

<meta charset="utf8"></head><body>טכניקה יעילה של אדם יחיד לדגימת חלב מעכברי מעבדה

This article describes how to assemble a device that can be used to collect milk from laboratory mice. This device is affordable, portable, and allows a collection of 0.1&#8211;0.5 mL of milk by one trained person. A detailed milking protocol is also included.&#160;

קביעת חומצות סיאליות בדגימות כבד וחלב של סוג הבר

Summary

Explore More Videos

Chapters in this video