Questo lavoro è stato sostenuto in parte dalla Fondazione della Scienza Naturale della Cina (numeri di sovvenzione 31471703, A0201300537 e 31671854 per JV e LL) e 100 piani di talenti stranieri (numero di sovvenzione JSB2014012 a JV).

Le procedure che coinvolgono soggetti animali sono stati approvati dal comitato etico del Centro sperimentale animale dell&#39;Università agricola di Nanjing in conformità alle linee guida nazionali per il benessere degli animali sperimentali (Ministero della scienza e della tecnologia, PR della Cina, 2006) con gli animali alloggiati in un SPF (ID di autorizzazione: SYXK-J-2011-0037). 1. Modello del mouse di Knock-out Cmah <ol><li> Usa i topi selvatici C57Bl / 6 dal Centro di Medicina Comparativa dell&#39;Università di Yangzhou (Cina). NOTA: CMAH topi knock-out sono stati generati sulla base delle informazioni fornite dai precedenti CMAH studi knock-out 17, 19 e ottenuti commercialmente utilizzando un CRISPR / Cas9 20 strategia rimuovendo 92 coppie di basi dal esone 6 del gene CMAH, anch&#39;esso Cancellati nel gene umano CMAH 19 . Positivo F 0 &lt;/ sub&gt; -mice (2 persone) sono stati incrociati con topi di tipo selvatico avere eterozigoti F 1 -mice. Dopo aver attraversato eterozigoti F 1 -mice (5 persone), omozigote CMAH knock-out F 2 -mice potrebbe essere ottenuta con successo (3 persone). </li><li> Eseguire la genotipizzazione dei topi usando il DNA genomico secondo il metodo mostrato da Zangala 21 utilizzando un kit di purificazione del DNA commerciale. <ol><li> Amplificare un corrispondente frammento di DNA del gene Cmah utilizzando la commercializzazione di DNA polimerasi e la coppia di primari 5&#39;gaaagggctcggctctgtatgaa3 &#39;e 5&#39;tttaaaaggctccggggtgagaagc3&#39;. Eseguire l&#39;amplificazione genica utilizzando 34 cicli PCR costituiti da denaturazione a 94 ° C per 40 s, ricottura a 63 ° C per 40 s e allungamento a 72 ° C per 1 min. </li><li> Visualizzare i prodotti PCR su un gel agarosico del 1%. Bisogna osservare una singola banda (0,5 kb) per l&#39;individuo di tipo selvaggio, una doppia banda (0,4 e 0,5 kb) perIndividuo eterozigotico, e una singola banda (0,4 kb) per l&#39;individuo omogeneo di knock-out. </li></ol></li></ol> 2. Raccolta del campione <ol><li> Raccogliere il latte del topo utilizzando il protocollo descritto da Willingham et al. 22 . </li><li> Raccogliere il tessuto epatico del topo utilizzando il protocollo descritto da Gonçalves et al. 23 e conservare i campioni a -80 ° C. </li></ol> 3. Isolamento di Acidi Sialici dal latte <ol><li> Preparare 100 mL di una soluzione di acido acetico da 2 M aggiungendo 12 mL di acido acetico glaciale in 88 mL di H 2 O distillato. </li><li> Trasferire 50 μL di latte in un tubo di centrifuga da 1,5 ml e aggiungere 1,2 ml della soluzione di acido acetico acquoso preparato. </li><li> Incubare la sospensione per 4 ore a 80 ° C e centrifugare il campione a 14.000 xg per 10 min. </li><li> Trasferire i primi 1.000 μL del supernatante in un nuovo tubo di centrifuga da 1.5 ml e rimuovereOve il solvente per evaporazione centrifuga a temperatura ambiente per completare la secchezza (a seconda della pompa vuoto attaccata, questo richiede 4 - 20 h). Riapplicare il campione in 500 μl di H 2 O distillato. </li><li> Preparare una colonna di scambio di microanion. Questa fase arricchirà specificamente i composti anionici e rimuove i composti cationici e neutrali dal campione di latte e fegato e aumenta quindi la selettività dell&#39;agente di etichettatura OPD fluorogenica per la derivatizzazione dell&#39;acido sialico. <ol><li> Trasferire per ciascun campione 200 mg della resina di scambio anionico (Dowex 1X8) in tubi vuoto di colonna 3 mL con un rubinetto di fissaggio fissato. </li><li> Aggiungere 2 ml della soluzione acquosa acquosa acetica preparata nel punto 3.1 per sostituire gli ioni cloruri nella resina con gli ioni acetato. Chiudere il rubinetto non appena il solvente raggiunge la parte superiore della resina. </li><li> Aggiungere delicatamente 2 ml di H 2 O distillato, aprire il rubinetto e fermare il flusso non appena la maggior parte del solvente raggiungeLa parte superiore della resina. Assicurarsi che la resina sia sempre coperta con solvente. </li><li> Lavare la colonna di resina ancora due volte con 2 ml di H 2 O distillato per rimuovere l&#39;acetato in eccesso. </li></ol></li><li> Trasferire il risultante 500 μL di solvente del campione dal punto 3.4. Sulla colonna della resina e scartare il flusso. Lavare delicatamente la resina con 2 mL di H 2 O distillata O. Eluire gli anioni del campione dalla resina utilizzando 1 ml di una soluzione di acetato di ammonio 50 mM (386 mg di acetato di ammonio sciolti in 100 mL di acqua distillata H 2 O) in 1,5 mL Tubo di centrifuga. Togliere il solvente con evaporazione centrifuga a temperatura ambiente a secchezza. NOTA: I campioni asciutti possono essere conservati a 4-6 ° C per un massimo di 12 mesi. </li></ol> 4. Isolamento di Acidi Sialici dalla Tissue Fegato <ol><li> Scongelare delicatamente 20-50 mg di fegato del topo e trasferirlo in un macinatore di tessuto Dounce (1 mL o 2 mL di volume). Aggiungere 1,2 ml della soluzione di acido acetico acquosoPreparato nel punto 3.1 e omogeneizzare il tessuto mediante una leggera cesoia per 10 s. Trasferire la sospensione risultante in un tubo da centrifuga da 1,5 ml. </li><li> Seguire i passaggi 3.3. A 3.6. NOTA: I campioni asciutti possono essere conservati a 4-6 ° C per un massimo di 12 mesi. </li></ol> 5. Preparazione di uno standard acido sialico mista <ol><li> Ponderate fra 5 e 8 mg di acido N-acetilneuraminico in un equilibrio analitico in un tubo da centrifuga da 1,5 ml. Si noti il peso esatto e aggiungere 164 ml di H 2 O distillata O per ogni mg (cioè se il peso del Neu5Ac è di 7,2 mg quindi aggiungere 7,2 x 164 = 1, 181 ml di acqua distillata H 2 O). Ciò comporta una soluzione di 20 mM Neu5Ac che può essere conservata a -20 ° C per un massimo di 12 mesi. </li><li> Ottenere l&#39;acido N-glycolylneuraminic in quantità minori a un prezzo moderato come in 1 mg aliquote. Aggiungere 154 μL di H 2 O distillato direttamente al composto per ottenere una soluzione di maglia di ~ 20 mM Neu5Gc. TrasferisciSoluzione in un tubo da centrifuga da 1,5 ml. Questa soluzione può essere conservata a -20 ° C per un massimo di 12 mesi. </li><li> Combinare 5 μL da ciascuna soluzione di scorta da punto 5.1 e 5.2 in un nuovo tubo da centrifuga da 1,5 ml e rimuovere il solvente con evaporazione centrifuga a temperatura ambiente a secchezza. NOTA: Lo standard di acido sialico miscelato può essere conservato a 4 - 6 ° C per un massimo di 12 mesi. </li></ol> 6. Derivazione della fluorescenza degli Acidi Sialici <ol><li> Preparare 10 ml di OPD-soluzione, costituita da 100 mg di o-fenilendiammina e 208 mg di idrogeno solfito di sodio in 10 ml di H 2 O. distillata </li><li> Aggiungere 20 μL di soluzione OPD ai campioni di acido sialico derivato dal latte del topo (fase 3), dal fegato del topo (fase 4) o nello standard acido sialico standard (fase 5). Vorticare vigorosamente per 30 s e incubare i campioni per 4 ore a 80 ° C al buio ( cioè avvolgere i microtubi in foglio di alluminio). </li><li> Lasciare raffreddare i campioni per 5 min, aggiungere 80 μ; L di H 2 O distillata e centrifugare i tubi a 14.000 xg per 1 min. </li><li> Trasferire 80 μl dal supernatante in un flacone HPLC ad alta reazione da 300 μL. I campioni di acido sialico derivatizzato possono essere conservati a 4 - 6 ° C per una settimana. </li></ol> 7. Analisi HPLC di derivati ​​acido sialico <ol><li> Analizzare i campioni utilizzando un sistema HPLC standard collegato a un rilevatore di fluorescenza online. </li><li> Utilizzare una colonna C18 di fase inversa con le dimensioni standard di 250 mm di lunghezza e di 4,6 mm di diametro per l&#39;analisi. </li><li> Preparare il solvente A dilutando 200 mL di soluzione di magazzino con 800 mL di acqua di LCMS (LCMS - spettrometria di massa cromatografica liquida). La soluzione stessa può essere preparata come segue: <ol><li> Aggiungere 46 g di acido formico a 800 mL di LCMS-grado H 2 O. </li><li> Regolare il pH a 4,5 aggiungendo in goccia l&#39;idrossido di ammonio (purissima pa). </li><li> Trasferire il solvente aMisurare il cilindro e riempire fino a 1.000 mL con LCMS-grado H 2 O. Questa soluzione di magazzino può essere conservata a 4 - 6 ° C per un massimo di 3 mesi. </li></ol></li><li> Per il solvente B, utilizzare acetonitrile di grado LCMS. </li><li> Separare i derivati ​​degli acidi sialici a una portata di 1 mL / min con la seguente eluizione di gradiente: <ol><li> Inizia l&#39;aggiunta del 10% del solvente B miscelato al solvente A. </li><li> Da 0 min a 15 min aumenta gradualmente la percentuale di solvente B con un gradiente lineare al 60%. </li><li> Da 15 minuti a 16 min, aumentare rapidamente la percentuale di solvente B con un gradiente lineare dal 60 al 90%. Questo inizia il lavaggio della colonna HPLC. </li><li> Per lavare ulteriormente la colonna HPLC, mantenere il livello del solvente B al 90% tra 16 min e 18 min prima di gradualmente ridurre il livello del solvente B al 10% tra 18 min e 19 min. </li><li> Riqualificare la colonna HPLC alle condizioni di partenza del 10% B tra 19 e 24 min. </li></ol></li><li> In50 μL di campione nel sistema HPLC. </li><li> Monitorare gli eluenti utilizzando le lunghezze d&#39;onda di eccitazione / emissione di rilevatore di fluorescenza di 373/448 nm e gli acidi sialici derivatizzati possono essere previsti a tempi di ritenzione approssimativi di 9 minuti (per Neu5Gc-OPD) e 10 min (per Neu5Ac-OPD). </li><li> Calcolare la quantità relativa di Neu5Gc (F Neu5Gc ) dalle aree di picco di fluorescenza del Neu5Ac (A Neu5Ac ) e Neu5Gc (A Neu5Gc ) come segue: F Neu5Gc [%] = 100 × A Neu5Gc / (A Neu5Ac + A Neu5Gc ). Nel caso dei campioni di latte e di fegato dal omozigote topo knock-out CMAH F Neu5Gc dovrebbe essere 0%, mentre i valori di F Neu5Gc di topi eterozigoti e wild-type possono variare ampiamente a seconda dell&#39;età del mouse e tipo di tessuto (tra 2% E&gt; 90%) con margini di errore previsti di ± 12%. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

Gli autori non hanno nulla da rivelare.

Il protocollo qui presentato consente di valutare fenotipicamente i topi omotigmatici di Cmah knock-out analizzando e quantificando le quantità relative di Neu5Gc di campioni di latte e fegato. L&#39;analisi è stata eseguita utilizzando una configurazione standard HPLC con rilevazione di fluorescenza. La fase più critica di questa procedura è la preparazione delle colonne di scambio anionico e l&#39;esecuzione della cromatografia per l&#39;anione; Per sistemare correttamente la resina e per raccogl...

L&#39;acido N-acetilneuraminico (Neu5Ac) e l&#39;acido N-glycolylneuraminic (Neu5Gc) sono gli acidi sialici più comuni nella maggior parte dei mammiferi 1 . Sebbene in grado di sintetizzare Neu5Ac in modo endogeno, gli esseri umani non sono in grado di produrre Neu5Gc a causa di una delezione primaria dell&#39;esone sul gene CMAH che codifica per una CMP-Neu5Ac idrossilasi 2 , 3 . Tuttavia, i prodotti alimentari a base di animali possono essere fonti dietetiche di Neu5Gc 4 , 5 , 6 , che portano alla produzione di anticorpi anti-Neu5Gc e quindi attivano una risposta immunitaria nei confronti di Neu5Gc 7 . Si sospetta che questo effetto dietetico di Neu5Gc contribuisca all&#39;infiammazione cronica e alle varie malattie 8 , 9 , 10 . Per comprendere in modo completo gli effetti di Neu5Gc in hUmani, un modello animale per lo studio sistematico degli effetti degli acidi sialici alimentari è molto auspicabile. Anche se i protocolli basati sulla reazione a catena polimerica (PCR) per l&#39;analisi dei topi knock-out sono ben stabiliti e un modo pratico per la valutazione genotipica, l&#39;analisi funzionale del fenotipo a livello metabolico richiede metodi di analisi più specifici. Il fenotipo di un modello di topo knock-out Cmah può essere valutato isolando e analizzando la composizione degli acidi sialici nei campioni di fegato o di latte. Diversi metodi per la rilevazione di acidi sialici nei tessuti animali sono stati riportati in precedenza: la reazione degli acidi sialici con resorcinolo 11 o acido tiobarbiturico 12 determina la formazione di un prodotto cromoforico e può essere semplicemente analizzato utilizzando un setup basato su platereader, ma solo il totale sialico Può essere determinato il contenuto di acido. In alternativa, l&#39;analisi degli acidi sialici è stata descritta anche utilizzando gas cromatografia13 , spettrometria di massa MALDI-ToF 14 o metodi amperometrici 15 . Tuttavia, i metodi di analisi dell&#39;acido sialico più comunemente applicati sono basati sul rilascio idrolitico, seguito da derivatizzazione fluorescente e successiva cromatografia liquida ad alta prestazione 16 , 17 , 18 .

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:147px;">Chemicals:</td>
			<td style="width:144px;"></td>
			<td style="width:143px;"></td>
			<td style="width:251px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">N-acetylneuraminic acid</td>
			<td>Sigma</td>
			<td>A0812</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">N-glycolylneuraminic acid</td>
			<td>Sigma</td>
			<td align="right">50644</td>
			<td>1 mg aliquot should be sufficient</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">o-Phenylenediamine</td>
			<td>Sigma</td>
			<td align="right">694975</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sodium hydrogen sulfite</td>
			<td>J&#38;K Scientific Ltd</td>
			<td align="right">75234</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tools/Materials:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">3 mL SPE tubes</td>
			<td>Supelco</td>
			<td>Sigma 57024</td>
			<td>empty solid phase extraction columns</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Luer stopcock</td>
			<td>Sigma</td>
			<td>S7396</td>
			<td>to stop the flow of the SPE tube</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dowex 1X8</td>
			<td>Dow Chemicals</td>
			<td>Sigma 44340</td>
			<td>200-400 mesh</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dounce tissue grinder</td>
			<td>Sigma</td>
			<td>D8938</td>
			<td>tight fit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC Analysis:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">High-recovery HPLC vial</td>
			<td>Agilent Technologies</td>
			<td>#5188-2788</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC System</td>
			<td>Shimadzu</td>
			<td>Nexera</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fluorescence Detector for HPLC</td>
			<td>Shimadzu</td>
			<td>RF-20Axs</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC Column</td>
			<td>Phenomenex</td>
			<td>Hyperclone ODS</td>
			<td>250x4.6 mm</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;">LCMS-grade H2O</td>
			<td>Merck Millipore</td>
			<td>#WX00011</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LCMS-grade Acetonitrile</td>
			<td>Merck Millipore</td>
			<td>#100029</td>
			<td>Hypergrade</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ammonium hydroxide solution</td>
			<td>Fluka</td>
			<td>#44273</td>
			<td>puriss. P.a.</td>
		</tr>
	</tbody>
</table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

CMAH (idrossilasi di citidina monofosfato-N-acetilneuraminico idrossilasi) è responsabile dell&#39;ossidazione degli acidi citidina monofosfato-N-acetilneuraminico nei mammiferi. Tuttavia, l&#39;uomo non può ossidare l&#39;acido di citidina monofosfato-N-acetilneuraminico a acido citidico monofosfato-N-glicolico-neuraminico a causa di una delezione primaria di esone del gene CMAH . Per comprendere in modo più approfondito gli effetti e le implicazioni della mancanza di attività CMAH , il modello Cmah in topi è di grande interesse per la ricerca di base e applicata. Il metodo di analisi per determinare il fenotipo di questo modello di topo è qui descritto in dettaglio e si basa sulla rilevazione dell&#39;acido N-acetilneuraminico e dell&#39;acido N-glicolenuraminico nel fegato e nel latte di topi di tipo selvatico e Cmah . Gli acidi sialici endogeni vengono liberati e derivatizzati con o-fenilendiammina per generare derivati ​​fluorogenici, che possono essere successivamente analizzati mediante HPLC. Il protocollo presentato può essereAnche applicato per l&#39;analisi di campioni di latte e tessuti provenienti da varie altre origini e può essere utile per indagare gli effetti nutrizionali e sanitari dell&#39;acido N-glycolylneuraminic.

Una panoramica schematica del metodo di analisi descritto è mostrato nella figura 1 e comprende l&#39;isolamento di acidi sialici da campioni di fegato di latte e fegato di topi mutanti topi di tipo selvatico e Cmah , e la derivatizzazione fluorescente e l&#39;analisi HPLC di questi componenti. Le figure 2 e 3 illustrano cromatogrammi HPLC rappresentativi di a...

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Descriviamo un metodo basato su HPLC per la determinazione dell&#39;acido N-acetilneuraminico e dell&#39;acido N-glicolilenraminico nel fegato e nel latte del topo.

Determinazione degli acidi sialici nei campioni di fegato e latte di tipo selvatico e<em&gt; CMAH</em&gt; Mouse Knock-out.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K Views.  Nanjing Agricultural University.  Descriviamo un metodo basato su HPLC per la determinazione dell'acido N-acetilneuraminico e dell'acido N-glicolilenraminico nel fegato e nel latte del topo. 

Video: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Quantitation of &gamma;H2AX Foci in Tissue Samples

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) processes or by exogenous factors, particularly ionizing radiation and radiomimetic compounds. Phosphorylation of the H2A histone variant, H2AX, at the serine-139 residue, in the highly conserved C-terminal SQEY motif, forming &gamma;H2AX, is an early response to DNA double-strand breaks1. This phosphorylation event is mediated by the phosphatidyl-inosito 3-kinase (PI3K) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)2. Overall, DSB induction results in the formation of discrete nuclear &gamma;H2AX foci which can be easily detected and quantitated by immunofluorescence microscopy2. Given the unique specificity and sensitivity of this marker, analysis of &gamma;H2AX foci has led to a wide range of applications in biomedical research, particularly in radiation biology and nuclear medicine. The quantitation of &gamma;H2AX foci has been most widely investigated in cell culture systems in the context of ionizing radiation-induced DSBs. Apart from cellular radiosensitivity, immunofluorescence based assays have also been used to evaluate the efficacy of radiation-modifying compounds. In addition, &gamma;H2AX has been used as a molecular marker to examine the efficacy of various DSB-inducing compounds and is recently being heralded as important marker of ageing and disease, particularly cancer3. Further, immunofluorescence-based methods have been adapted to suit detection and quantitation of &gamma;H2AX foci ex vivo and in vivo4,5. Here, we demonstrate a typical immunofluorescence method for detection and quantitation of &gamma;H2AX foci in mouse tissues.

Quantitation of &#947;H2AX Foci in Tissue Samples

Quantitation of DNA double-strand breaks on the basis of &gamma;H2AX foci has become an invaluable tool, particularly in radiation biology, for the evaluation of tissue radiosensitivity and effects of radiation modifying compounds. Here we demonstrate the use of an immunofluorescence assay for quantitation of &gamma;H2AX foci in tissue samples.

ΓH2AX quantificazione dei Foci, a campioni di tessuto

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) ...

Ricerca

Biologia

Identifying the Effects of BRCA1 Mutations on Homologous Recombination using Cells that Express Endogenous Wild-type BRCA1

The functional analysis of missense mutations can be complicated by the presence in the cell of the endogenous protein. Structure-function analyses of the BRCA1 have been complicated by the lack of a robust assay for the full length BRCA1 protein and the difficulties inherent in working with cell lines that express hypomorphic BRCA1 protein1,2,3,4,5. We developed a system whereby the endogenous BRCA1 protein in a cell was acutely depleted by RNAi targeting the 3'-UTR of the BRCA1 mRNA and replaced by co-transfecting a plasmid expressing a BRCA1 variant. One advantage of this procedure is that the acute silencing of BRCA1 and simultaneous replacement allow the cells to grow without secondary mutations or adaptations that might arise over time to compensate for the loss of BRCA1 function. This depletion and add-back procedure was done in a HeLa-derived cell line that was readily assayed for homologous recombination activity. The homologous recombination assay is based on a previously published method whereby a recombination substrate is integrated into the genome (Figure 1)6,7,8,9. This recombination substrate has the rare-cutting I-SceI restriction enzyme site inside an inactive GFP allele, and downstream is a second inactive GFP allele. Transfection of the plasmid that expresses I-SceI results in a double-stranded break, which may be repaired by homologous recombination, and if homologous recombination does repair the break it creates an active GFP allele that is readily scored by flow cytometry for GFP protein expression. Depletion of endogenous BRCA1 resulted in an 8-10-fold reduction in homologous recombination activity, and add-back of wild-type plasmid fully restored homologous recombination function. When specific point mutants of full length BRCA1 were expressed from co-transfected plasmids, the effect of the specific missense mutant could be scored. As an example, the expression of the BRCA1(M18T) protein, a variant of unknown clinical significance10, was expressed in these cells, it failed to restore BRCA1-dependent homologous recombination. By contrast, expression of another variant, also of unknown significance, BRCA1(I21V) fully restored BRCA1-dependent homologous recombination function. This strategy of testing the function of BRCA1 missense mutations has been applied to another biological system assaying for centrosome function (Kais et al, unpublished observations). Overall, this approach is suitable for the analysis of missense mutants in any gene that must be analyzed recessively.

We provide a method for testing BRCA1 variants in a tissue culture based assay for homologous recombination repair of DNA damage by depleting endogenous BRCA1 protein from a cell using RNAi and replacing it with a BRCA1 point mutant that contains a coding change.

Identificare gli effetti delle mutazioni BRCA1 sulla ricombinazione omologa utilizzando cellule che esprimono endogeno wild-type BRCA1

The functional analysis of missense mutations can be complicated by the presence in the cell of the endogenous protein. Structure-function analyses of the ...

Concentration Determination of Nucleic Acids and Proteins Using the Micro-volume Bio-spec Nano Spectrophotometer

Nucleic Acid quantitation procedures have advanced significantly in the last three decades. More and more, molecular biologists require consistent small-volume analysis of nucleic acid samples for their experiments. The BioSpec-nano provides a potential solution to the problems of inaccurate, non-reproducible results, inherent in current DNA quantitation methods, via specialized optics and a sensitive PDA detector. The BioSpec-nano also has automated functionality such that mounting, measurement, and cleaning are done by the instrument, thereby eliminating tedious, repetitive, and inconsistent placement of the fiber optic element and manual cleaning.
In this study, data is presented on the quantification of DNA and protein, as well as on measurement reproducibility and accuracy. Automated sample contact and rapid scanning allows measurement in three seconds, resulting in excellent throughput. Data analysis is carried out using the built-in features of the software. The formula used for calculating DNA concentration is:
Sample Concentration = DF &middot; (OD260-OD320)&middot; NACF (1)
Where DF = sample dilution factor and NACF = nucleic acid concentration factor.
The Nucleic Acid concentration factor is set in accordance with the analyte selected1.
Protein concentration results can be expressed as &mu;g/ mL or as moles/L by entering e280 and molecular weight values respectively. When residue values for Tyr, Trp and Cysteine (S-S bond) are entered in the e280Calc tab, the extinction coefficient values are calculated as e280 = 5500 x (Trp residues) + 1490 x (Tyr residues) + 125 x (cysteine S-S bond). The e280 value is used by the software for concentration calculation.
In addition to concentration determination of nucleic acids and protein, the BioSpec-nano can be used as an ultra micro-volume spectrophotometer for many other analytes or as a standard spectrophotometer using 5 mm pathlength cells.

This communication presents data on the accuracy and reproducibility of the BioSpec-nano UV-VIS spectrophotometer for dsDNA and protein quantitation. Even with ultra-small volumes (1 to 2 L), reproducibility is excellent, while the automated wiping function improves throughput and results in minimal carryover for more precise results.

Determinazione concentrazione di acidi nucleici e proteine ​​Utilizzando il Micro-volume Bio-spec Spettrofotometro Nano

Nucleic Acid quantitation procedures have advanced significantly in the last three decades.  More and more, molecular biologists require consistent ...

In vivo Liver Endocytosis Followed by Purification of Liver Cells by Liver Perfusion

The liver is the metabolic center of the mammalian body and serves as a filter for the blood. The basic architecture of the liver is illustrated in figure 1 in which more than 85% of the liver mass is composed of hepatocytes and the remaining 15% of the cellular mass is composed of Kupffer cells (KCs), stellate cells (HSCs), and sinusoidal endothelial cells (SECs). SECs form the blood vessel walls within the liver and contain specialized morphology called fenestrae within in the cytoplasm. Fenestration of the cytoplasm is the appearance of holes (&tilde;100 &mu;m) within the cells so that the SECs act as a sieve in which most chylomicrons, chylomicron remnants and macromolecules, but not cells, pass through to the hepatocytes and HSCs 1 (Fig. 1). Due to the lack of a basement membrane, the gap between the SECs and hepatocytes form the Space of Disse. HSCs occupy this space and play a prominent role in regulation and response to injury, storage of retinoic acid and immunoregulation of the liver 2.
SECs are among the most endocytically active cells of the body displaying an array of scavenger receptors on their cell surface 3. These include SR-A, Stabilin-1 and Stabilin-2. Generally, small colloidal particles less than 230 nm and macromolecules in buffer phase are taken up by SECs, whereas, large particles and cellular debris is endocytosed (phagocytosed) by KCs 4. Thus, the bulk clearance of extracellular material such as the glycosaminoglycans from blood is largely dependent on the health and endocytic functions of SECs 5,6. For example, an increase in blood hyaluronan levels is indicative of liver disease ranging from mild to more severe forms 7.
With the exception of one report 8, there are no immortalized SEC cell lines in existence. Even this immortalized cell line is de-differentiated in that it does not express scavenger receptors that are present on primary SECs (our data, not shown). All cell biological studies must be performed on primary cells obtained freshly from the animal. Unfortunately, SECs dedifferentiate under standard culture conditions and must be used within 1 or 2 days upon isolation from the animal. Differentiation of SECs is marked by the expression of Stabilin-2 or HARE receptor 9 , CD31, and the presence of cytoplasmic fenestration 1. Differentiation of SECs can be extended by the addition of VEGF in culture media or by culturing cells in hepatocyte conditioned medium 10,11.
In this report, we will demonstrate the endocytic activity of SECs in the intact organ using radio-labeled heparin for hyaluronan for the SEC-specific Stabilin-2 receptor. We will then purify hepatocytes and SECs from the perfused liver to measure endocytosis.

In vivo Liver Endocytosis Followed by Purification of Liver Cells by Liver Perfusion

The study of liver sinusoidal endothelial cells (SECs) must be performed with primary cells obtained from the animal as no cell lines exist. This method relies on liver digestion and differential centrifugation for SEC purification for subsequent culturing and experimentation.

In Endocitosi Fegato vivo seguita da purificazione delle cellule del fegato da parte di perfusione epatica

The liver is the metabolic center of the mammalian body and serves as a filter for the blood.  The basic architecture of the liver is illustrated in ...

A PCR-based Genotyping Method to Distinguish Between Wild-type and Ornamental Varieties of Imperata cylindrica

Wild-type I. cylindrica (cogongrass) is one of the top ten worst invasive plants in the world, negatively impacting agricultural and natural resources in 73 different countries throughout Africa, Asia, Europe, New Zealand, Oceania and the Americas1-2. Cogongrass forms rapidly-spreading, monodominant stands that displace a large variety of native plant species and in turn threaten the native animals that depend on the displaced native plant species for forage and shelter. To add to the problem, an ornamental variety [I. cylindrica var. koenigii (Retzius)] is widely marketed under the names of Imperata cylindrica 'Rubra', Red Baron, and Japanese blood grass (JBG). This variety is putatively sterile and noninvasive and is considered a desirable ornamental for its red-colored leaves. However, under the correct conditions, JBG can produce viable seed (Carol Holko, 2009 personal communication) and can revert to a green invasive form that is often indistinguishable from cogongrass as it takes on the distinguishing characteristics of the wild-type invasive variety4 (Figure 1). This makes identification using morphology a difficult task even for well-trained plant taxonomists. Reversion of JBG to an aggressive green phenotype is also not a rare occurrence. Using sequence comparisons of coding and variable regions in both nuclear and chloroplast DNA, we have confirmed that JBG has reverted to the green invasive within the states of Maryland, South Carolina, and Missouri. JBG has been sold and planted in just about every state in the continental U.S. where there is not an active cogongrass infestation. The extent of the revert problem in not well understood because reverted plants are undocumented and often destroyed.
Application of this molecular protocol provides a method to identify JBG reverts and can help keep these varieties from co-occurring and possibly hybridizing. Cogongrass is an obligate outcrosser and, when crossed with a different genotype, can produce viable wind-dispersed seeds that spread cogongrass over wide distances5-7. JBG has a slightly different genotype than cogongrass and may be able to form viable hybrids with cogongrass. To add to the problem, JBG is more cold and shade tolerant than cogongrass8-10, and gene flow between these two varieties is likely to generate hybrids that are more aggressive, shade tolerant, and cold hardy than wild-type cogongrass. While wild-type cogongrass currently infests over 490 million hectares worldwide, in the Southeast U.S. it infests over 500,000 hectares and is capable of occupying most of the U.S. as it rapidly spreads northward due to its broad niche and geographic potential3,7,11. The potential of a genetic crossing is a serious concern for the USDA-APHIS Federal Noxious Week Program. Currently, the USDA-APHIS prohibits JBG in states where there are major cogongrass infestations (e.g., Florida, Alabama, Mississippi). However, preventing the two varieties from combining can prove more difficult as cogongrass and JBG expand their distributions. Furthermore, the distribution of the JBG revert is currently unknown and without the ability to identify these varieties through morphology, some cogongrass infestations may be the result of JBG reverts. Unfortunately, current molecular methods of identification typically rely on AFLP (Amplified Fragment Length Polymorphisms) and DNA sequencing, both of which are time consuming and costly. Here, we present the first cost-effective and reliable PCR-based molecular genotyping method to accurately distinguish between cogongrass and JBG revert.

A PCR-based Genotyping Method to Distinguish Between Wild-type and Ornamental Varieties of Imperata cylindrica

We provide a cost-effective and rapid molecular genotyping protocol that employs variety-specific PCR primers that target DNA sequence differences within the chloroplast trnL-F spacer region to differentiate between varieties of Imperata cylindrica (cogongrass) that cannot be distinguished by morphology alone. These varieties include the federally listed noxious weed, cogongrass and closely-related, wide-spread ornamental variety, I. cylindrica var. koenigii (Japanese blood grass).

A PCR-based metodo di genotipizzazione di distinguere tra le varietà selvatiche di tipo ornamentale e di Imperata cylindrica</em

Wild-type I. cylindrica (cogongrass) is one of the top ten worst invasive plants in the world, negatively impacting agricultural and natural resources in ...

Do-It-Yourself Device for Recovery of Cryopreserved Samples Accidentally Dropped into Cryogenic Storage Tanks

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term storage of biological materials such as blood, cells and tissues 1,2. The cryogenic nature of liquid nitrogen, while ideal for sample preservation, can cause rapid freezing of live tissues on contact - known as 'cryogenic burn'2, which may lead to severe frostbite in persons closely involved in storage and retrieval of samples from Dewars. Additionally, as liquid nitrogen evaporates it reduces the oxygen concentration in the air and might cause asphyxia, especially in confined spaces2.
In laboratories, biological samples are often stored in cryovials or cryoboxes stacked in stainless steel racks within the Dewar tanks1. These storage racks are provided with a long shaft to prevent boxes from slipping out from the racks and into the bottom of Dewars during routine handling. All too often, however, boxes or vials with precious samples slip out and sink to the bottom of liquid nitrogen filled tank. In such cases, samples could be tediously retrieved after transferring the liquid nitrogen into a spare container or discarding it. The boxes and vials can then be relatively safely recovered from emptied Dewar. However, the cryogenic nature of liquid nitrogen and its expansion rate makes sunken sample retrieval hazardous. It is commonly recommended by Safety Offices that sample retrieval be never carried out by a single person. Another alternative is to use commercially available cool grabbers or tongs to pull out the vials3. However, limited visibility within the dark liquid filled Dewars poses a major limitation in their use.
In this article, we describe the construction of a Cryotolerant DIY retrieval device, which makes sample retrieval from Dewar containing cryogenic fluids both safe and easy.

Here we present a low cost, durable cryotolerant device for sample retrieval from Dewar tanks filled with liquid nitrogen. The ease of construction and modular design of the device makes the process of sample retrieval from cryogenic tanks safe and easy.

Do-It-Yourself dispositivo per il recupero di campioni crioconservati cadere accidentalmente nelle cisterne criogeniche

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term ...

Milk Collection Methods for Mice and Reeves' Muntjac Deer

Animal models are commonly used throughout research laboratories to accomplish what would normally be considered impractical in a pathogen&#8217;s native host. Milk collection from animals allows scientists the opportunity to study many aspects of reproduction including vertical transmission, passive immunity, mammary gland biology, and lactation. Obtaining adequate volumes of milk for these studies is a challenging task, especially from small animal models. Here we illustrate an inexpensive and facile method for milk collection in mice and Reeves&#8217; muntjac deer that does not require specialized equipment or extensive training. This particular method requires two researchers: one to express the milk and to stabilize the animal, and one to collect the milk in an appropriate container from either a Muntjac or mouse model. The mouse model also requires the use of a P-200 pipetman and corresponding pipette tips. While this method is low cost and relatively easy to perform, researchers should be advised that anesthetizing the animal is required for optimal milk collection.

Milk collection from animal models facilitates various research avenues: understanding passive immunity, identifying pathogens responsible for vertical transmission and, through the use of transgenic mice, even commercial production of proteins found in human breast milk. Here we illustrate a simple method for milk collection in mice and Reeves&#8217; muntjac deer.

Metodi Latte di raccolta per topi e Reeves &#39;Muntjac

Animal models are commonly used throughout research laboratories to accomplish what would normally be considered impractical in a pathogen&#8217;s native ...

Determination of Fatty Acid Oxidation and Lipogenesis in Mouse Primary Hepatocytes

Lipid metabolism in liver is complex. In addition to importing and exporting lipid via lipoproteins, hepatocytes can oxidize lipid via fatty acid oxidation, or alternatively, synthesize new lipid via de novo lipogenesis. The net sum of these pathways is dictated by a number of factors, which in certain disease states leads to fatty liver disease. Excess hepatic lipid accumulation is associated with whole body insulin resistance and coronary heart disease. Tools to study lipid metabolism in hepatocytes are useful to understand the role of hepatic lipid metabolism in certain metabolic disorders.
In the liver, hepatocytes regulate the breakdown and synthesis of fatty acids via &#946;-fatty oxidation and de novo lipogenesis, respectively. Quantifying metabolism in these pathways provides insight into hepatic lipid handling. Unlike in vitro quantification, using primary hepatocytes, making measurements in vivo is technically challenging and resource intensive. Hence, quantifying &#946;-fatty acid oxidation and de novo lipogenesis in cultured mouse hepatocytes provides a straight forward method to assess hepatocyte lipid handling. 
Here we describe a method for the isolation of primary mouse hepatocytes, and we demonstrate quantification of &#946;-fatty acid oxidation and de novo lipogenesis, using radiolabeled substrates.

De novo lipogenesis and &#946;-fatty acid oxidation constitute key metabolic pathways in hepatocyte, pathways that are perturbed in several metabolic disorders, including fatty liver disease. Here we demonstrate isolation of mouse primary hepatocytes and describe quantification of &#946;-fatty acid oxidation and lipogenesis.

Determinazione della ossidazione degli acidi grassi e la lipogenesi nel topo primaria Epatociti

Lipid metabolism in liver is complex. In addition to importing and exporting lipid via lipoproteins, hepatocytes can oxidize lipid via fatty acid ...

Milk Collection in the Rat Using Capillary Tubes and Estimation of Milk Fat Content by Creamatocrit

Milk, as the sole source of nutrition for the newborn mammal, provides the necessary nutrients and energy for offspring growth and development. It also contains a vast number of bioactive compounds that greatly affect the development of the neonate. The analysis of milk components will help elucidate key factors that link maternal metabolism and health with offspring growth and development. The laboratory rat represents a popular model organism for maternal studies, and rat milk can be used to examine the effect of various maternal physiological, nutritional, and pharmacological interventions on milk components, which may then impact offspring health. Here a simple method of manually collecting milk from the lactating rat that can be performed by a single investigator, does not require specialized vacuum or suction equipment, and provides sufficient milk for subsequent downstream analysis is described. A method for estimating the fat content of milk by measuring the percentage of cream within the milk sample, known as the creamatocrit, is also presented. These methods can ultimately be used to increase insight into maternal-child health and to elucidate maternal factors that are involved in proper growth and development of offspring.

Milk is a primary source of nutrition for the neonate. Analysis of milk components may provide insight into maternal factors that affect offspring health. This protocol describes a manual method of collecting milk samples from the lactating rat, which can then be used for further downstream analysis.

Milk Collection nella Rat Utilizzando tubi capillari e stima di tenore di materia grassa per Creamatocrit

Milk, as the sole source of nutrition for the newborn mammal, provides the necessary nutrients and energy for offspring growth and development. It also ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

L&#39;isolamento di filtrazione di acidi nucleici: DNA metodo di estrazione semplice e veloce

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Determinazione degli acidi sialici nei campioni di fegato e latte di tipo selvatico e

Riepilogo

Esplora Altri Video

Capitoli in questo video

ΓH2AX quantificazione dei Foci, a campioni di tessuto

Identificare gli effetti delle mutazioni BRCA1 sulla ricombinazione omologa utilizzando cellule che esprimono endogeno wild-type BRCA1

Determinazione concentrazione di acidi nucleici e proteine Utilizzando il Micro-volume Bio-spec Spettrofotometro Nano

In Endocitosi Fegato vivo seguita da purificazione delle cellule del fegato da parte di perfusione epatica

A PCR-based metodo di genotipizzazione di distinguere tra le varietà selvatiche di tipo ornamentale e di Imperata cylindrica

Do-It-Yourself dispositivo per il recupero di campioni crioconservati cadere accidentalmente nelle cisterne criogeniche

Metodi Latte di raccolta per topi e Reeves 'Muntjac

Determinazione della ossidazione degli acidi grassi e la lipogenesi nel topo primaria Epatociti

Milk Collection nella Rat Utilizzando tubi capillari e stima di tenore di materia grassa per Creamatocrit

L'isolamento di filtrazione di acidi nucleici: DNA metodo di estrazione semplice e veloce

Determinazione degli acidi sialici nei campioni di fegato e latte di tipo selvatico e

Riepilogo

Esplora Altri Video

Capitoli in questo video

ΓH2AX quantificazione dei Foci, a campioni di tessuto

Identificare gli effetti delle mutazioni BRCA1 sulla ricombinazione omologa utilizzando cellule che esprimono endogeno wild-type BRCA1

Determinazione concentrazione di acidi nucleici e proteine ​​Utilizzando il Micro-volume Bio-spec Spettrofotometro Nano

In Endocitosi Fegato vivo seguita da purificazione delle cellule del fegato da parte di perfusione epatica

A PCR-based metodo di genotipizzazione di distinguere tra le varietà selvatiche di tipo ornamentale e di Imperata cylindrica

Do-It-Yourself dispositivo per il recupero di campioni crioconservati cadere accidentalmente nelle cisterne criogeniche

Metodi Latte di raccolta per topi e Reeves 'Muntjac

Determinazione della ossidazione degli acidi grassi e la lipogenesi nel topo primaria Epatociti

Milk Collection nella Rat Utilizzando tubi capillari e stima di tenore di materia grassa per Creamatocrit

L'isolamento di filtrazione di acidi nucleici: DNA metodo di estrazione semplice e veloce

Determinazione concentrazione di acidi nucleici e proteine Utilizzando il Micro-volume Bio-spec Spettrofotometro Nano