Name: determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.
Uploaded: 2017-07-14T15:00:00.000+00:00
Duration: 8 min 4 s
Description: Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Questo lavoro è stato sostenuto in parte dalla Fondazione della Scienza Naturale della Cina (numeri di sovvenzione 31471703, A0201300537 e 31671854 per JV e LL) e 100 piani di talenti stranieri (numero di sovvenzione JSB2014012 a JV).

Le procedure che coinvolgono soggetti animali sono stati approvati dal comitato etico del Centro sperimentale animale dell&#39;Università agricola di Nanjing in conformità alle linee guida nazionali per il benessere degli animali sperimentali (Ministero della scienza e della tecnologia, PR della Cina, 2006) con gli animali alloggiati in un SPF (ID di autorizzazione: SYXK-J-2011-0037). 1. Modello del mouse di Knock-out Cmah <ol><li> Usa i topi selvatici C57Bl / 6 dal Centro di Medicina Comparativa dell&#39;Università di Yangzhou (Cina). NOTA: CMAH topi knock-out sono stati generati sulla base delle informazioni fornite dai precedenti CMAH studi knock-out 17, 19 e ottenuti commercialmente utilizzando un CRISPR / Cas9 20 strategia rimuovendo 92 coppie di basi dal esone 6 del gene CMAH, anch&#39;esso Cancellati nel gene umano CMAH 19 . Positivo F 0 &lt;/ sub&gt; -mice (2 persone) sono stati incrociati con topi di tipo selvatico avere eterozigoti F 1 -mice. Dopo aver attraversato eterozigoti F 1 -mice (5 persone), omozigote CMAH knock-out F 2 -mice potrebbe essere ottenuta con successo (3 persone). </li><li> Eseguire la genotipizzazione dei topi usando il DNA genomico secondo il metodo mostrato da Zangala 21 utilizzando un kit di purificazione del DNA commerciale. <ol><li> Amplificare un corrispondente frammento di DNA del gene Cmah utilizzando la commercializzazione di DNA polimerasi e la coppia di primari 5&#39;gaaagggctcggctctgtatgaa3 &#39;e 5&#39;tttaaaaggctccggggtgagaagc3&#39;. Eseguire l&#39;amplificazione genica utilizzando 34 cicli PCR costituiti da denaturazione a 94 ° C per 40 s, ricottura a 63 ° C per 40 s e allungamento a 72 ° C per 1 min. </li><li> Visualizzare i prodotti PCR su un gel agarosico del 1%. Bisogna osservare una singola banda (0,5 kb) per l&#39;individuo di tipo selvaggio, una doppia banda (0,4 e 0,5 kb) perIndividuo eterozigotico, e una singola banda (0,4 kb) per l&#39;individuo omogeneo di knock-out. </li></ol></li></ol> 2. Raccolta del campione <ol><li> Raccogliere il latte del topo utilizzando il protocollo descritto da Willingham et al. 22 . </li><li> Raccogliere il tessuto epatico del topo utilizzando il protocollo descritto da Gonçalves et al. 23 e conservare i campioni a -80 ° C. </li></ol> 3. Isolamento di Acidi Sialici dal latte <ol><li> Preparare 100 mL di una soluzione di acido acetico da 2 M aggiungendo 12 mL di acido acetico glaciale in 88 mL di H 2 O distillato. </li><li> Trasferire 50 μL di latte in un tubo di centrifuga da 1,5 ml e aggiungere 1,2 ml della soluzione di acido acetico acquoso preparato. </li><li> Incubare la sospensione per 4 ore a 80 ° C e centrifugare il campione a 14.000 xg per 10 min. </li><li> Trasferire i primi 1.000 μL del supernatante in un nuovo tubo di centrifuga da 1.5 ml e rimuovereOve il solvente per evaporazione centrifuga a temperatura ambiente per completare la secchezza (a seconda della pompa vuoto attaccata, questo richiede 4 - 20 h). Riapplicare il campione in 500 μl di H 2 O distillato. </li><li> Preparare una colonna di scambio di microanion. Questa fase arricchirà specificamente i composti anionici e rimuove i composti cationici e neutrali dal campione di latte e fegato e aumenta quindi la selettività dell&#39;agente di etichettatura OPD fluorogenica per la derivatizzazione dell&#39;acido sialico. <ol><li> Trasferire per ciascun campione 200 mg della resina di scambio anionico (Dowex 1X8) in tubi vuoto di colonna 3 mL con un rubinetto di fissaggio fissato. </li><li> Aggiungere 2 ml della soluzione acquosa acquosa acetica preparata nel punto 3.1 per sostituire gli ioni cloruri nella resina con gli ioni acetato. Chiudere il rubinetto non appena il solvente raggiunge la parte superiore della resina. </li><li> Aggiungere delicatamente 2 ml di H 2 O distillato, aprire il rubinetto e fermare il flusso non appena la maggior parte del solvente raggiungeLa parte superiore della resina. Assicurarsi che la resina sia sempre coperta con solvente. </li><li> Lavare la colonna di resina ancora due volte con 2 ml di H 2 O distillato per rimuovere l&#39;acetato in eccesso. </li></ol></li><li> Trasferire il risultante 500 μL di solvente del campione dal punto 3.4. Sulla colonna della resina e scartare il flusso. Lavare delicatamente la resina con 2 mL di H 2 O distillata O. Eluire gli anioni del campione dalla resina utilizzando 1 ml di una soluzione di acetato di ammonio 50 mM (386 mg di acetato di ammonio sciolti in 100 mL di acqua distillata H 2 O) in 1,5 mL Tubo di centrifuga. Togliere il solvente con evaporazione centrifuga a temperatura ambiente a secchezza. NOTA: I campioni asciutti possono essere conservati a 4-6 ° C per un massimo di 12 mesi. </li></ol> 4. Isolamento di Acidi Sialici dalla Tissue Fegato <ol><li> Scongelare delicatamente 20-50 mg di fegato del topo e trasferirlo in un macinatore di tessuto Dounce (1 mL o 2 mL di volume). Aggiungere 1,2 ml della soluzione di acido acetico acquosoPreparato nel punto 3.1 e omogeneizzare il tessuto mediante una leggera cesoia per 10 s. Trasferire la sospensione risultante in un tubo da centrifuga da 1,5 ml. </li><li> Seguire i passaggi 3.3. A 3.6. NOTA: I campioni asciutti possono essere conservati a 4-6 ° C per un massimo di 12 mesi. </li></ol> 5. Preparazione di uno standard acido sialico mista <ol><li> Ponderate fra 5 e 8 mg di acido N-acetilneuraminico in un equilibrio analitico in un tubo da centrifuga da 1,5 ml. Si noti il peso esatto e aggiungere 164 ml di H 2 O distillata O per ogni mg (cioè se il peso del Neu5Ac è di 7,2 mg quindi aggiungere 7,2 x 164 = 1, 181 ml di acqua distillata H 2 O). Ciò comporta una soluzione di 20 mM Neu5Ac che può essere conservata a -20 ° C per un massimo di 12 mesi. </li><li> Ottenere l&#39;acido N-glycolylneuraminic in quantità minori a un prezzo moderato come in 1 mg aliquote. Aggiungere 154 μL di H 2 O distillato direttamente al composto per ottenere una soluzione di maglia di ~ 20 mM Neu5Gc. TrasferisciSoluzione in un tubo da centrifuga da 1,5 ml. Questa soluzione può essere conservata a -20 ° C per un massimo di 12 mesi. </li><li> Combinare 5 μL da ciascuna soluzione di scorta da punto 5.1 e 5.2 in un nuovo tubo da centrifuga da 1,5 ml e rimuovere il solvente con evaporazione centrifuga a temperatura ambiente a secchezza. NOTA: Lo standard di acido sialico miscelato può essere conservato a 4 - 6 ° C per un massimo di 12 mesi. </li></ol> 6. Derivazione della fluorescenza degli Acidi Sialici <ol><li> Preparare 10 ml di OPD-soluzione, costituita da 100 mg di o-fenilendiammina e 208 mg di idrogeno solfito di sodio in 10 ml di H 2 O. distillata </li><li> Aggiungere 20 μL di soluzione OPD ai campioni di acido sialico derivato dal latte del topo (fase 3), dal fegato del topo (fase 4) o nello standard acido sialico standard (fase 5). Vorticare vigorosamente per 30 s e incubare i campioni per 4 ore a 80 ° C al buio ( cioè avvolgere i microtubi in foglio di alluminio). </li><li> Lasciare raffreddare i campioni per 5 min, aggiungere 80 μ; L di H 2 O distillata e centrifugare i tubi a 14.000 xg per 1 min. </li><li> Trasferire 80 μl dal supernatante in un flacone HPLC ad alta reazione da 300 μL. I campioni di acido sialico derivatizzato possono essere conservati a 4 - 6 ° C per una settimana. </li></ol> 7. Analisi HPLC di derivati ​​acido sialico <ol><li> Analizzare i campioni utilizzando un sistema HPLC standard collegato a un rilevatore di fluorescenza online. </li><li> Utilizzare una colonna C18 di fase inversa con le dimensioni standard di 250 mm di lunghezza e di 4,6 mm di diametro per l&#39;analisi. </li><li> Preparare il solvente A dilutando 200 mL di soluzione di magazzino con 800 mL di acqua di LCMS (LCMS - spettrometria di massa cromatografica liquida). La soluzione stessa può essere preparata come segue: <ol><li> Aggiungere 46 g di acido formico a 800 mL di LCMS-grado H 2 O. </li><li> Regolare il pH a 4,5 aggiungendo in goccia l&#39;idrossido di ammonio (purissima pa). </li><li> Trasferire il solvente aMisurare il cilindro e riempire fino a 1.000 mL con LCMS-grado H 2 O. Questa soluzione di magazzino può essere conservata a 4 - 6 ° C per un massimo di 3 mesi. </li></ol></li><li> Per il solvente B, utilizzare acetonitrile di grado LCMS. </li><li> Separare i derivati ​​degli acidi sialici a una portata di 1 mL / min con la seguente eluizione di gradiente: <ol><li> Inizia l&#39;aggiunta del 10% del solvente B miscelato al solvente A. </li><li> Da 0 min a 15 min aumenta gradualmente la percentuale di solvente B con un gradiente lineare al 60%. </li><li> Da 15 minuti a 16 min, aumentare rapidamente la percentuale di solvente B con un gradiente lineare dal 60 al 90%. Questo inizia il lavaggio della colonna HPLC. </li><li> Per lavare ulteriormente la colonna HPLC, mantenere il livello del solvente B al 90% tra 16 min e 18 min prima di gradualmente ridurre il livello del solvente B al 10% tra 18 min e 19 min. </li><li> Riqualificare la colonna HPLC alle condizioni di partenza del 10% B tra 19 e 24 min. </li></ol></li><li> In50 μL di campione nel sistema HPLC. </li><li> Monitorare gli eluenti utilizzando le lunghezze d&#39;onda di eccitazione / emissione di rilevatore di fluorescenza di 373/448 nm e gli acidi sialici derivatizzati possono essere previsti a tempi di ritenzione approssimativi di 9 minuti (per Neu5Gc-OPD) e 10 min (per Neu5Ac-OPD). </li><li> Calcolare la quantità relativa di Neu5Gc (F Neu5Gc ) dalle aree di picco di fluorescenza del Neu5Ac (A Neu5Ac ) e Neu5Gc (A Neu5Gc ) come segue: F Neu5Gc [%] = 100 × A Neu5Gc / (A Neu5Ac + A Neu5Gc ). Nel caso dei campioni di latte e di fegato dal omozigote topo knock-out CMAH F Neu5Gc dovrebbe essere 0%, mentre i valori di F Neu5Gc di topi eterozigoti e wild-type possono variare ampiamente a seconda dell&#39;età del mouse e tipo di tessuto (tra 2% E&gt; 90%) con margini di errore previsti di ± 12%. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

Gli autori non hanno nulla da rivelare.

Il protocollo qui presentato consente di valutare fenotipicamente i topi omotigmatici di Cmah knock-out analizzando e quantificando le quantità relative di Neu5Gc di campioni di latte e fegato. L&#39;analisi è stata eseguita utilizzando una configurazione standard HPLC con rilevazione di fluorescenza. La fase più critica di questa procedura è la preparazione delle colonne di scambio anionico e l&#39;esecuzione della cromatografia per l&#39;anione; Per sistemare correttamente la resina e per raccogl...

L&#39;acido N-acetilneuraminico (Neu5Ac) e l&#39;acido N-glycolylneuraminic (Neu5Gc) sono gli acidi sialici più comuni nella maggior parte dei mammiferi 1 . Sebbene in grado di sintetizzare Neu5Ac in modo endogeno, gli esseri umani non sono in grado di produrre Neu5Gc a causa di una delezione primaria dell&#39;esone sul gene CMAH che codifica per una CMP-Neu5Ac idrossilasi 2 , 3 . Tuttavia, i prodotti alimentari a base di animali possono essere fonti dietetiche di Neu5Gc 4 , 5 , 6 , che portano alla produzione di anticorpi anti-Neu5Gc e quindi attivano una risposta immunitaria nei confronti di Neu5Gc 7 . Si sospetta che questo effetto dietetico di Neu5Gc contribuisca all&#39;infiammazione cronica e alle varie malattie 8 , 9 , 10 . Per comprendere in modo completo gli effetti di Neu5Gc in hUmani, un modello animale per lo studio sistematico degli effetti degli acidi sialici alimentari è molto auspicabile. Anche se i protocolli basati sulla reazione a catena polimerica (PCR) per l&#39;analisi dei topi knock-out sono ben stabiliti e un modo pratico per la valutazione genotipica, l&#39;analisi funzionale del fenotipo a livello metabolico richiede metodi di analisi più specifici. Il fenotipo di un modello di topo knock-out Cmah può essere valutato isolando e analizzando la composizione degli acidi sialici nei campioni di fegato o di latte. Diversi metodi per la rilevazione di acidi sialici nei tessuti animali sono stati riportati in precedenza: la reazione degli acidi sialici con resorcinolo 11 o acido tiobarbiturico 12 determina la formazione di un prodotto cromoforico e può essere semplicemente analizzato utilizzando un setup basato su platereader, ma solo il totale sialico Può essere determinato il contenuto di acido. In alternativa, l&#39;analisi degli acidi sialici è stata descritta anche utilizzando gas cromatografia13 , spettrometria di massa MALDI-ToF 14 o metodi amperometrici 15 . Tuttavia, i metodi di analisi dell&#39;acido sialico più comunemente applicati sono basati sul rilascio idrolitico, seguito da derivatizzazione fluorescente e successiva cromatografia liquida ad alta prestazione 16 , 17 , 18 .

<table><tbody><tr><td>&lt;strong&gt;Chemicals:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>N-acetylneuraminic acid</td><td>Sigma</td><td>A0812</td><td></td></tr><tr><td>N-glycolylneuraminic acid</td><td>Sigma</td><td>50644</td><td>1 mg aliquot should be sufficient</td></tr><tr><td>o-Phenylenediamine</td><td>Sigma</td><td>694975</td><td></td></tr><tr><td>Sodium hydrogen sulfite</td><td>J&amp;amp;K Scientific Ltd</td><td>75234</td><td></td></tr><tr><td>&lt;strong&gt;Tools/Materials:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>3 mL SPE tubes</td><td>Supelco</td><td>Sigma 57024</td><td>empty solid phase extraction columns</td></tr><tr><td>Luer stopcock</td><td>Sigma</td><td>S7396</td><td>to stop the flow of the SPE tube</td></tr><tr><td>Dowex 1X8</td><td>Dow Chemicals</td><td>Sigma 44340</td><td>200 - 400 mesh</td></tr><tr><td>Dounce tissue grinder</td><td>Sigma</td><td>D8938</td><td>tight fit</td></tr><tr><td>&lt;strong&gt;HPLC Analysis:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>High-recovery HPLC vial</td><td>Agilent Technologies</td><td>#5188-2788</td><td></td></tr><tr><td>HPLC System</td><td>Shimadzu</td><td>Nexera</td><td></td></tr><tr><td>Fluorescence Detector for HPLC</td><td>Shimadzu</td><td>RF-20Axs</td><td></td></tr><tr><td>HPLC Column</td><td>Phenomenex</td><td>Hyperclone ODS</td><td>250 x 4.6 mm</td></tr><tr><td>LCMS-grade H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Merck Millipore</td><td>#WX00011</td><td></td></tr><tr><td>LCMS-grade Acetonitrile</td><td>Merck Millipore</td><td>#100029</td><td>Hypergrade</td></tr><tr><td>Ammonium hydroxide solution</td><td>Fluka</td><td>#44273</td><td>puriss. P.a.</td></tr></tbody></table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

CMAH (idrossilasi di citidina monofosfato-N-acetilneuraminico idrossilasi) è responsabile dell&#39;ossidazione degli acidi citidina monofosfato-N-acetilneuraminico nei mammiferi. Tuttavia, l&#39;uomo non può ossidare l&#39;acido di citidina monofosfato-N-acetilneuraminico a acido citidico monofosfato-N-glicolico-neuraminico a causa di una delezione primaria di esone del gene CMAH . Per comprendere in modo più approfondito gli effetti e le implicazioni della mancanza di attività CMAH , il modello Cmah in topi è di grande interesse per la ricerca di base e applicata. Il metodo di analisi per determinare il fenotipo di questo modello di topo è qui descritto in dettaglio e si basa sulla rilevazione dell&#39;acido N-acetilneuraminico e dell&#39;acido N-glicolenuraminico nel fegato e nel latte di topi di tipo selvatico e Cmah . Gli acidi sialici endogeni vengono liberati e derivatizzati con o-fenilendiammina per generare derivati ​​fluorogenici, che possono essere successivamente analizzati mediante HPLC. Il protocollo presentato può essereAnche applicato per l&#39;analisi di campioni di latte e tessuti provenienti da varie altre origini e può essere utile per indagare gli effetti nutrizionali e sanitari dell&#39;acido N-glycolylneuraminic.

Una panoramica schematica del metodo di analisi descritto è mostrato nella figura 1 e comprende l&#39;isolamento di acidi sialici da campioni di fegato di latte e fegato di topi mutanti topi di tipo selvatico e Cmah , e la derivatizzazione fluorescente e l&#39;analisi HPLC di questi componenti. Le figure 2 e 3 illustrano cromatogrammi HPLC rappresentativi di a...

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Descriviamo un metodo basato su HPLC per la determinazione dell&#39;acido N-acetilneuraminico e dell&#39;acido N-glicolilenraminico nel fegato e nel latte del topo.

Determinazione degli acidi sialici nei campioni di fegato e latte di tipo selvatico e<em&gt; CMAH</em&gt; Mouse Knock-out.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K Views.  Nanjing Agricultural University.  Descriviamo un metodo basato su HPLC per la determinazione dell'acido N-acetilneuraminico e dell'acido N-glicolilenraminico nel fegato e nel latte del topo. 

Video: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Determining Bile Duct Density in the Mouse Liver

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques are used, including serum chemistry, histological analysis, and immunostaining for specific markers. Although these techniques can provide important information about the biliary system, they often do not present a full picture of bile duct (BD) developmental defects across the whole liver. This is in part due to the robust ability of the mouse liver to drain the bile even in animals with significant impairment in biliary development. Here we present a simple method to calculate the average number of BDs associated with each portal vein (PV) in sections covering all lobes of mutant/transgenic mice. In this method, livers are mounted and sectioned in a stereotypic manner to facilitate comparison among various genotypes and experimental conditions. BDs are identified via light microscopy of cytokeratin-stained cholangiocytes, and then counted and divided by the total number of PVs present in liver section. As an example, we show how this method can clearly distinguish between wild-type mice and a mouse model of Alagille syndrome. The method presented here cannot substitute for techniques that visualize the three-dimensional structure of the biliary tree. However, it offers an easy and direct way to quantitatively assess BD development and the degree of ductular reaction formation in mice.

We present a rather simple and sensitive method for accurate quantification of bile duct density in the mouse liver. This method can aid in determining the effects of genetic and environmental modifiers and the effectiveness of potential therapies in mouse models of biliary diseases.

Determinazione della densità del dotto biliare nel fegato del topo

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques ...

Ricerca

Biologia dello sviluppo

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing termini of oligo- and polysaccharides, as well as its unique chemical characteristics, sialic acid is involved in a multitude of different receptor-ligand interactions. By modifying the expression of sialic acid on the cell surface, sialic acid-dependent interactions will consequently be influenced. This can be helpful to investigate sialic acid-dependent interactions and has the potential to influence certain diseases in a beneficial way. Via metabolic glycoengineering (MGE), the expression of sialic acid on the cell surface can be modulated. Herein, cells, tissues, or even entire animals are treated with C2-modified derivatives of N-acetylmannosamine (ManNAc). These amino sugars act as sialic acid precursor molecules and therefore are metabolized to the corresponding sialic acid species and expressed on glycoconjugates. Applying this method produces intriguing effects on various biological processes. For example, it can drastically reduce&#160;the expression of polysialic acid (polySia) in treated neuronal cells and thus affects neuronal growth and differentiation. Here, we show the chemical synthesis of two of the most common C2-modified N-acylmannosamine derivatives, N-propionylmannosamine (ManNProp) as well as N-butanoylmannosamine (ManNBut), and further show how these non-natural amino sugars can be applied in cell culture experiments. The expression of modified sialic acid species is quantified by high performance liquid chromatography (HPLC) and further analyzed via mass spectrometry. The effects on polysialic acid expression are elucidated via Western blot using a commercially available polysialic acid antibody.

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid is a typical monosaccharide-unit found in glycoconjugates. It is involved in a plethora of molecular and cellular interactions. Here we present a method to modify cell surface sialic acid expression using metabolic glycoengineering with N-acetylmannosamine derivatives.

Glycoengineering metabolica di acido sialico utilizzando N-acil-per volta Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing ...

Bioingegneria

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible animal models mirror common components of human disease, including the bm12 transfer model. Upon transfer of bm12 splenocytes or purified CD4 T cells, C57BL/6 mice rapidly develop large frequencies of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells followed by high levels of circulating anti-nuclear antibodies. Since this model utilizes mice on a pure C57BL/6 background, researchers can quickly and easily study disease progression in transgenic or knockout mouse strains in a relatively short period of time. Here we describe protocols for the induction of the model and the quantitation Tfh, GC B cells, and plasma cells by multi-color flow cytometry. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells, and plasma cells in other disease models.

The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

Il BM12 inducibile modello di Lupus Eritematoso Sistemico (LES) in C57BL / 6 Mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible ...

Medicina

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

Un metodo per la misurazione della funzione della ghiandola salivaria in topi

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

Immunologia e infezioni

Using a Bacterial Pathogen to Probe for Cellular and Organismic-level Host Responses

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' pathogens (Listeria monocytogenes, Shigella flexneri, Burkholderia pseudomallei, Francisella tularensis, and Rickettsia spp.) gain access to the infected cell cytosol by physically and enzymatically degrading the primary vacuolar membrane. Once in the cytosol, these pathogens both proliferate as well as generate sufficient mechanical forces to penetrate the plasma membrane of the host cell in order to infect new cells. Here, we show how this terminal step of the cellular infection cycle of L. monocytogenes (Lm) can be quantified by both colony-forming unit assays and flow cytometry and give examples of how both pathogen- and host-encoded factors impact this process. We also show a close correspondence of Lm infection dynamics of cultured cells infected in vitro and those of hepatic cells derived from mice infected in vivo. These function-based assays are relatively simple and can be readily scaled up for discovery-based high-throughput screens for modulators of eukaryotic cell function.

We describe both in vitro and in vivo infection assays that can be used to analyze the activities of host-encoding factors.

Utilizzando un agente patogeno batterico alla sonda per le risposte cellulari e organismica-livello Host

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' ...

Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by goblet cells and the gastric mucosa, provide the scaffold for a micrometers-thick mucus layer that lines the epithelia of the gut and respiratory tract3,4. In addition to mucins, mucus layers also contain antimicrobial peptides, cytokines, and immunoglobulins5-9. The mucus layer is an important part of host innate immunity, and forms the first line of defense against invading microorganisms8,10-12. As such, the mucus is subject to numerous interactions with microbes, both pathogens and symbionts, and secreted mucins form an important interface for these interactions. The study of such biological interactions usually involves histological methods for tissue collection and staining. The two most commonly used histological methods for tissue collection and preservation in the clinic and in research laboratories are: formalin fixation followed by paraffin embedding, and tissue freezing, followed by embedding in cryo-protectant media.
Paraffin-embedded tissue samples produce sections with optimal qualities for histological visualization including clarity and well-defined morphology. However, during the paraffin embedding process a number of epitopes become altered and in order to study these epitopes, tissue sections have to be further processed with one of many epitope retrieval methods13. Secreted mucins and lipids are extracted from the tissue during the paraffin-embedding clearing step, which requires prolong incubation with organic solvents (xylene or Citrisolv). Therefore this approach is sub-optimal for studies focusing on the nature and distribution of mucins and mucus in vivo.
In contrast, freezing tissues in Optimal Cutting Temperature (OCT) embedding medium avoids dehydration and clearing of the sample, and maintains the sample hydration. This allows for better preservation of the hydrated mucus layer, and thus permits the study of the numerous roles of mucins in epithelial biology. As this method requires minimal processing of the tissue, the tissue is preserved in a more natural state. Therefore frozen tissues sections do not require any additional processing prior to staining and can be readily analyzed using immunohistochemistry methods.
We demonstrate the preservation of micrometers-thick secreted mucus layer in frozen colon samples. This layer is drastically reduced when the same tissues are embedded in paraffin. We also demonstrate immunofluorescence staining of glycan epitopes presented on mucins using plant lectins. The advantage of this approach is that it does not require the use of special fixatives and allows utilizing frozen tissues that may already be preserved in the laboratory.

Unfixed frozen tissue samples embedded in Optimal Cutting Temperature medium (OCT) can be used to study natural distribution and glycosylation of secreted mucus. In this approach tissue processing is minimal and the natural presentation of glycolipids, mucins and glycan-epitopes is preserved. Tissue sections can be analyzed by immunohistochemistry using fluorescence or chromogenic detection.

Utilizzo non fissati, tessuti congelati allo Studio di distribuzione naturale Mucina

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by ...

Biologia

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients with autoimmune hepatitis. The overwhelming majority of patients with DIH are women. The underlying mechanisms of these sex differences in prevalence are unclear because of the paucity of animal models that mimic human disease. Even so, underlying mechanisms are widely believed to be associated with human leukocyte antigen haplotypes and sex hormones. In contrast, using a DIH mouse model, we have uncovered that IL-4 initiated&#160;CD4+ T cells directed against an epitope of cytochrome P450 2E1 induces influx of neutrophils, macrophages and mast cells into the livers of female BALB/c mice. Using this model, we have also shown that IL-33-induced FoxP3+regulatory T cells confer protection against DIH in female and male mice. This DIH model is induced by immunizing mice with an epitope of CYP2E1 that has been covalently altered with a drug metabolite that has been associated with DIH. This epitope is recognized by patients with DIH. Our method induces robust and reproducible hepatitis and autoantibodies that can be utilized to study the pathogenesis of DIH. While in vivo studies can cause undue pain and distress in mice when done improperly, the advantage of an in vivo model is the ability to evaluate the pathogenesis of disease in a large number of mice. Additionally, biological effects of the altered liver proteins can be studied using invasive procedures. The addition of in vitro studies to the experimental design allows rapid repetition and mechanistic analysis at a cellular level. Thus, we will demonstrate our model protocol and how it can be utilized to study in vivo and in vitro mechanisms of DIH.

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

Induzione dell'epatite autoimmune indotta da farmaci in topi BALB / c per lo studio dei suoi meccanismi patogenetici

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

Indurre Meningococcal Meningitis Serogroup C in Topi tramite consegna intracisternale

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Indirect Immunofluorescence on Frozen Sections of Mouse Mammary Gland

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple method for the immune detection of proteins, the mouse lactating mammary gland being taken as an example. A protocol for the preparation of the tissue samples, especially concerning the dissection of mouse mammary gland, tissue fixation and frozen tissue sectioning, are detailed. A standard protocol to perform indirect immunofluorescence, including an optional antigen retrieval step, is also presented. The observation of the labeled tissue sections as well as image acquisition and post-treatments are also stated. This procedure gives a full overview, from the collection of animal tissue to the cellular localization of a protein. Although this general method can be applied to other tissue samples, it should be adapted to each tissue/primary antibody couple studied.

The indirect immunofluorescence protocol described in this article allows the detection and the localization of proteins in the mouse mammary gland. A complete method is given to prepare mammary gland samples, to perform immunohistochemistry, to image the tissue sections by fluorescence microscopy, and to reconstruct images.

Immunofluorescenza indiretta su sezioni congelate di mouse ghiandola mammaria

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple ...

<meta charset="utf8"></head><body>Metodo ottimizzato per una sola persona per la raccolta del latte negli studi sull'allattamento dei topi

An Efficient Single-Person Technique for Milk Sampling from Laboratory Mice

Rodent models have been widely used in biology since the early 20th century to study basic physiology and biochemical mechanisms. In lactation and neonatal development research, there is a need to sample milk to determine the composition and how milk may be affected by experimental manipulations, thereby impacting newborn development. Collecting biofluids in sufficient amounts from small rodents can be difficult. Several studies have demonstrated different techniques to obtain milk from mice. However, these techniques often require at least two trained personnel, which may be challenging in some cases.&#160;
Here, we demonstrate a modified milk sampling technique based on a method published in 2009. With this affordable and easy-to-assemble method, one trained person can routinely obtain 0.1&#8211;0.5 mL of milk from a dam under anesthesia in less than 10 min. Using this method, we collected sufficient milk on post-delivery day 2 (PD2) and post-delivery day 10 (PD10). We measured milk macronutrient components and compared them with the existing literature to validate our collection method.&#160;
We recorded that on PD2, milk protein averaged at 70.1 &#177; 5.2 g/L, milk fat was 174.4 &#177; 7.1 g/L, and milk lactose was 12.3 &#177; 0.6 g/L. On PD10, while milk lactose and protein remained at similar concentrations as on PD2, milk fat was significantly higher (224.4 &#177; 17.1 g/L). We also observed that the relative abundance of individual milk proteins varied between PD2 and PD10. More specifically, &#945;S1-casein and whey acidic protein were higher, while &#946;-casein was lower at PD10 compared with PD2. Overall, we demonstrate an efficient single-person technique for milk sampling from mice using a device that can easily be assembled with commonly used laboratory equipment.

<meta charset="utf8"></head><body>Un'efficiente tecnica per una sola persona per il campionamento del latte da topi da laboratorio

This article describes how to assemble a device that can be used to collect milk from laboratory mice. This device is affordable, portable, and allows a collection of 0.1&#8211;0.5 mL of milk by one trained person. A detailed milking protocol is also included.&#160;

Determinazione degli acidi sialici nei campioni di fegato e latte di tipo selvatico e

Riepilogo

Esplora Altri Video

Capitoli in questo video