Este trabajo fue apoyado en parte por la Fundación de Ciencias Naturales de China (los números de subvención 31471703, A0201300537 y 31671854 a JV y LL), y el plan de 100 Talentos Extranjeros (concesión número JSB2014012 a JV).

Los procedimientos que involucran sujetos animales han sido aprobados por el Comité Ético del Centro Experimental de Animales de la Universidad Agrícola de Nanjing de acuerdo con las Directrices Nacionales para el Bienestar Animal Experimental (Ministerio de Ciencia y Tecnología, RP de China, 2006) con los animales alojados en un SPF (ID de permiso: SYXK-J-2011-0037). 1. Cmah Knock-out modelo de ratón <ol><li> Utilizar ratones C57B1 / 6 de tipo salvaje del Centro de Medicina Comparada de la Universidad de Yangzhou (China). NOTA: Se generaron ratones knock-out Cmah basándose en la información proporcionada a partir de estudios de knock-out Cmah anteriores 17 , 19 y obtenidos comercialmente usando una estrategia CRISPR / Cas9 20 mediante la eliminación de 92 pares de bases del exón 6 del gen Cmah que también es Suprimido en el gen humano CMAH [ 19] . Positivo F 0 &lt;/ sub&gt; -mice (2 individuos) se cruzaron con ratones de tipo salvaje para obtener heterocigotos F 1 -mice. Después de cruzar heterocigotos F 1 -mice (5 personas), homocigoto CMAH ronda F 2 -mice se podría obtener con éxito (3 individuos). </li><li> Realizar el genotipado de ratones utilizando ADN genómico de acuerdo con el método mostrado por Zangala 21 utilizando un kit comercial de purificación de ADN. <ol><li> Amplificar un fragmento de ADN correspondiente del gen Cmah utilizando DNA polimerasa comercial y el par de cebadores 5&#39;gaaagggctcggctctgtatgaa3 &#39;y 5&#39;tttaaaatgtccggggtgagaagc3&#39;. Realizar la amplificación génica utilizando 34 ciclos de PCR consistentes en desnaturalización a 94 ° C durante 40 s, hibridación a 63 ° C durante 40 s, y elongación a 72 ° C durante 1 min. </li><li> Visualizar los productos de PCR en un gel de agarosa al 1%. Se debe observar una banda única (0,5 kb) para el individuo de tipo salvaje, una banda doble (0,4 y 0,5 kb) para elHeterocigotos knock-out individual, y una sola banda (0,4 kb) para el homocigotos knock-out individual. </li></ol></li></ol> 2. Recolección de muestras <ol><li> Recoger la leche del ratón utilizando el protocolo descrito por Willingham et al. 22 . </li><li> Recoger el tejido del hígado de ratón utilizando el protocolo descrito por Gonçalves et al. 23 y almacenar las muestras a -80 ° C. </li></ol> 3. Aislamiento de los ácidos siálicos de la leche <ol><li> Preparar 100 ml de una solución de ácido acético 2 M mediante la adición de 12 ml de ácido acético glacial en 88 ml de H2O destilada </li><li> Transferir 50 μL de leche en un tubo de centrífuga de 1,5 ml y agregar 1,2 ml de la solución acuosa de ácido acético preparada. </li><li> Incubar la suspensión durante 4 h a 80 ° C y centrifugar la muestra a 14.000 xg durante 10 min. </li><li> Transferir los 1000 μL superiores del sobrenadante en un tubo de centrífuga de 1,5 ml nuevo y remDel disolvente por evaporación centrífuga a temperatura ambiente hasta sequedad completa (dependiendo de la bomba de vacío conectada esto tomará 4 - 20 h). Volver a disolver la muestra en 500 μl de H 2 O destilada. </li><li> Preparar una columna de intercambio micro-anión. Esta etapa enriquecerá específicamente compuestos aniónicos y eliminará los compuestos catiónicos y neutros de las muestras de leche y de hígado, y por lo tanto aumenta la selectividad del agente de marcaje de OPD fluorogénico para la derivatización del ácido siálico. <ol><li> Transferir para cada muestra 200 mg de la resina de intercambio aniónico (Dowex 1X8) en tubos de columna vacíos de 3 ml con una llave de paso adjunta. </li><li> Añadir 2 ml de la solución acuosa de ácido acético preparada en la etapa 3.1 para reemplazar los iones cloruro en la resina con iones acetato. Cierre la llave de paso tan pronto como el solvente alcance la parte superior de la resina. </li><li> Añadir con cuidado 2 ml de H2O destilada, abrir la llave de paso y detener el flujo tan pronto como la mayoría de los alcances de disolventeLa parte superior de la resina. Asegúrese de que la resina esté siempre cubierta con disolvente. </li><li> Lavar la columna de la resina dos veces más con 2 ml de H 2 O destilada para retirar el exceso de etilo. </li></ol></li><li> Transferir los 500 μl resultantes del disolvente de la muestra de la etapa 3.4. Sobre la columna de resina y descartar el flujo. Lavar suavemente la resina con 2 ml de H2O destilada Eluir los aniones de muestra de la resina usando 1 ml de una solución de acetato de amonio 50 mM (386 mg de acetato de amonio disueltos en 100 ml de H2O destilada) en un 1,5 ml tubo centrífugo. Eliminar el disolvente por evaporación centrífuga a temperatura ambiente hasta sequedad. NOTA: Las muestras secas pueden almacenarse a 4-6 ° C durante un máximo de 12 meses. </li></ol> 4. Aislamiento de los ácidos siálicos del tejido del hígado <ol><li> Descongelar suavemente 20 - 50 mg de hígado de ratón y transferirlo a un triturador de tejidos Dounce (1 mL o 2 mL de volumen). Añadir 1,2 ml de la solución acuosa de ácido acéticoPreparada en el paso 3.1 y homogeneizar el tejido por cizallamiento suave durante 10 s. Transferir la suspensión resultante a un tubo de centrífuga de 1,5 ml. </li><li> Siga los pasos 3.3. A 3.6. NOTA: Las muestras secas pueden almacenarse a 4-6 ° C durante un máximo de 12 meses. </li></ol> 5. Preparación de una norma de ácido siálico mixto <ol><li> Pesar entre 5 - 8 mg de ácido N-acetilneuramínico sobre un equilibrio analítico en un tubo de centrífuga de 1,5 ml. Tenga en cuenta el peso exacto y añadir 164 l de H2O destilada por cada mg (es decir, si el peso de Neu5Ac es de 7,2 mg a continuación, añadir 7,2 x 164 = 1, 181 l de H2O destilada). Esto da como resultado una solución madre de Neu5Ac 20 mM que puede almacenarse a -20ºC durante hasta 12 meses. </li><li> Obtener ácido N-glicolilneuramínico en cantidades más pequeñas a un precio moderado tal como en alícuotas de 1 mg. Añadir 154! L de H2O destilada directamente en el compuesto con el fin de obtener una Neu5Gc mM solución madre ~ 20. Transferir elEn un tubo de centrífuga de 1,5 ml. Esta solución se puede almacenar a -20 ° C durante un máximo de 12 meses. </li><li> Combinar 5 μL de cada solución madre de la etapa 5.1 y 5.2 en un tubo de centrifugación fresco de 1,5 ml y eliminar el disolvente por evaporación centrífuga a temperatura ambiente hasta sequedad. NOTA: El estándar de ácido siálico mixto se puede almacenar a 4 - 6 ° C por hasta 12 meses. </li></ol> 6. Derivatización de la fluorescencia de los ácidos siálicos <ol><li> Preparar 10 ml de OPD-solución, que consiste en 100 mg de o-fenilendiamina y 208 mg de sulfito de hidrógeno de sodio en 10 ml de H 2 O. destiló </li><li> Añadir 20 μl de solución de OPD a las muestras de ácido siálico derivadas de la leche de ratón (etapa 3), hígado de ratón (etapa 4) o el estándar de ácido siálico mixto (paso 5). Vortex vigorosamente durante 30 s e incubar las muestras durante 4 h a 80 ° C en la oscuridad ( es decir, envolver los microtubos en papel de aluminio). </li><li> Deje que las muestras se enfríen durante 5 min, agregue 80 μ; L de H 2 O destilada y centrifugar los tubos a 14.000 xg durante 1 min. </li><li> Transferir 80 μL del sobrenadante a un frasco de HPLC de alta recuperación de 300 μl. Las muestras derivatizadas de ácido siálico se pueden almacenar a 4-6 ° C durante una semana. </li></ol> 7. Análisis por HPLC de derivados de ácido siálico <ol><li> Analizar las muestras utilizando un sistema de HPLC estándar conectado a un detector de fluorescencia en línea. </li><li> Utilizar una columna de fase inversa C18 con las dimensiones estándar de 250 mm de longitud y 4,6 mm de diámetro para el análisis. </li><li> Preparar el disolvente A diluyendo 200 ml de solución madre con 800 ml de agua de grado LCMS (LCMS - cromatografía líquida espectrometría de masas). La solución madre en sí puede prepararse como sigue: <ol><li> Añadir 46 g de ácido fórmico a 800 ml de H _ { 2} O de grado LCMS. </li><li> Ajustar el pH a 4,5 por adición gota a gota de solución de hidróxido de amonio (puriss pa). </li><li> Transferir el disolvente a unaY llenar hasta 1.000 ml con H 2 O de grado LCMS. Esta solución madre se puede almacenar a 4-6 ° C durante un máximo de 3 meses. </li></ol></li><li> Para el disolvente B, utilice acetonitrilo de grado LCMS. </li><li> Se separan los derivados de los ácidos siálicos a un caudal de 1 ml / min con la siguiente elución con gradiente: <ol><li> Comience añadiendo el 10% de disolvente B mezclado al disolvente A. </li><li> De 0 min a 15 min, aumentar gradualmente la proporción de disolvente B con un gradiente lineal hasta 60%. </li><li> De 15 minutos a 16 minutos, aumentar rápidamente la proporción de disolvente B con un gradiente lineal de 60% a 90%. Esto inicia el lavado de la columna de HPLC. </li><li> Para lavar adicionalmente la columna de HPLC, mantener el nivel de disolvente B al 90% entre 16 min y 18 min antes de reducir gradualmente el nivel de disolvente B de nuevo a 10% entre 18 min y 19 min. </li><li> Reequilibrar la columna de HPLC a las condiciones de partida de 10% de B entre 19 y 24 min. </li></ol></li><li> En50 μL de muestra en el sistema de HPLC. </li><li> Los eluyentes de monitorización que utilizan las longitudes de onda de excitación / emisión de detector de fluorescencia de 373/448 nm, y los ácidos siálicos derivatizados se pueden esperar a los tiempos de retención aproximados de 9 min (para Neu5Gc-OPD) y 10 min (para Neu5Ac-OPD). </li><li> Calcular la cantidad relativa de Neu5Gc (F Neu5Gc ) de las áreas de pico de fluorescencia de Neu5Ac (A Neu5Ac ) y Neu5Gc (A Neu5Gc ) como sigue: F Neu5Gc [%] = 100 × A Neu5Gc / (A Neu5Ac + A Neu5Gc ). En el caso de la leche y las muestras de hígado de homocigotos Cmah knockout ratón F Neu5Gc debe ser de 0%, mientras que los valores de F Neu5Gc de heterocigotos y de tipo salvaje ratones pueden variar ampliamente dependiendo de la edad del ratón y el tipo de tejido (entre el 2% Y&gt; 90%) con márgenes de error esperados de ± 12%. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

Los autores no tienen nada que revelar.

El protocolo presentado aquí permite la evaluación fenotípica de ratones knock-out homocigóticos Cmah analizando y cuantificando las cantidades relativas de Neu5Gc de leche y muestras de hígado. El análisis se realizó utilizando una configuración de HPLC estándar con detección de fluorescencia. El paso más crítico de este procedimiento es la preparación de las columnas de intercambio aniónico y la realización de la cromatografía de intercambio aniónico; Para sedimentar la resina adecuadamente y para recoger las fracciones de lavado y elución correctas requiere un poco de práctica. Alternativamente, el agente de derivatización OPD utilizado en la presente memoria puede sustituirse fácilmente por el agente de derivatización DMB (1,2-diamino-4,5-metilendioxibenceno) más caro. Además, el análisis de los derivados de ácido siálico obtenidos de la etapa 6.5. Pueden analizarse también utilizando la detección espectrométrica de masas en lugar de la detección de fluorescencia ( es decir, el sistema UPLC de Shimadzu Nexera acoplado con el detector MS-2020). UNDespués de aplicar los pasos 7.2 - 7.6, los derivados de ácido siálico se detectan directamente usando exploración en modo de ionización positiva para las relaciones m / z de 382.0 y 398.0 (estos son los aductos H + de Neu5Ac-OPD y Neu5Gc-OPD, respectivamente). Una limitación de este método es que el contenido de Neu5Gc sólo se puede cuantificar con relación a la cantidad de Neu5Ac, pero no de manera absoluta. Para ello, se necesitaría la adición de un ácido siálico distinto y cuantificable como patrón interno en la etapa inicial de la preparación de la muestra. Otro inconveniente es que sólo los ratones knock-out Cmah homocigóticos pero no heterocigóticos pueden identificarse sin ambigüedad, ya que la cantidad relativa de ratones knock-out heterocigotos Neu5Gc puede variar fuertemente dependiendo del tipo de muestra ( es decir, tejido) y la edad de los ratones individuales. Los desarrollos futuros de este método pueden incluir la adición de normas internas y la cuantificación absoluta de ácidos siálicos en ratones.

El ácido N-acetilneuramínico (Neu5Ac) y el ácido N-glicolilneuramínico (Neu5Gc) son los ácidos siálicos más comunes en la mayoría de los mamíferos 1 . Aunque son capaces de sintetizar endógenamente Neu5Ac, los seres humanos no son capaces de producir Neu5Gc debido a una deleción primaria de exón en el gen CMAH que codifica para una hidroxilasa 2 , 3 de CMP-Neu5Ac. Sin embargo, los productos alimenticios de origen animal pueden ser fuentes dietéticas de Neu5Gc 4 , 5 , 6 , lo que conduce a la producción de anticuerpos anti-Neu5Gc y por lo tanto, desencadenar una respuesta inmune hacia Neu5Gc 7 . Se sospecha que este efecto en la dieta de Neu5Gc contribuye a la inflamación crónica ya otras diversas enfermedades 8 , 9 , 10 . Con el fin de comprender ampliamente los efectos de Neu5Gc en hUn modelo animal para el estudio sistemático de los efectos de los ácidos siálicos transmitidos por los alimentos es altamente deseable. Aunque los protocolos basados ​​en la reacción en cadena de la polimerasa (PCR) para el análisis de ratones knock-out están bien establecidos y una manera conveniente para la evaluación genotípica, el análisis funcional del fenotipo en el nivel metabólico requiere métodos de análisis más específicos. El fenotipo de un modelo de ratón knock-out Cmah se puede evaluar aislando y analizando la composición de ácidos siálicos en muestras de hígado o leche. Varios métodos para la detección de ácidos siálicos en tejidos animales han sido reportados previamente: la reacción de ácidos siálicos con resorcinol 11 o ácido tiobarbitúrico 12 da como resultado la formación de un producto cromóforo y puede analizarse simplemente usando una configuración basada en platereader, pero sólo la sialic total Se puede determinar el contenido de ácido. Alternativamente, el análisis de ácidos siálicos también se describió usando cromatografía de gases13 , espectrometría de masas MALDI-ToF 14 o métodos amperométricos 15 . Sin embargo, los métodos de análisis de ácido siálico más comúnmente aplicados se basan en la liberación hidrolítica, seguido por derivatización de fluorescencia y cromatografía líquida subsiguiente de alto rendimiento 16 , 17 , 18 .

<table><tbody><tr><td>&lt;strong&gt;Chemicals:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>N-acetylneuraminic acid</td><td>Sigma</td><td>A0812</td><td></td></tr><tr><td>N-glycolylneuraminic acid</td><td>Sigma</td><td>50644</td><td>1 mg aliquot should be sufficient</td></tr><tr><td>o-Phenylenediamine</td><td>Sigma</td><td>694975</td><td></td></tr><tr><td>Sodium hydrogen sulfite</td><td>J&amp;amp;K Scientific Ltd</td><td>75234</td><td></td></tr><tr><td>&lt;strong&gt;Tools/Materials:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>3 mL SPE tubes</td><td>Supelco</td><td>Sigma 57024</td><td>empty solid phase extraction columns</td></tr><tr><td>Luer stopcock</td><td>Sigma</td><td>S7396</td><td>to stop the flow of the SPE tube</td></tr><tr><td>Dowex 1X8</td><td>Dow Chemicals</td><td>Sigma 44340</td><td>200 - 400 mesh</td></tr><tr><td>Dounce tissue grinder</td><td>Sigma</td><td>D8938</td><td>tight fit</td></tr><tr><td>&lt;strong&gt;HPLC Analysis:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>High-recovery HPLC vial</td><td>Agilent Technologies</td><td>#5188-2788</td><td></td></tr><tr><td>HPLC System</td><td>Shimadzu</td><td>Nexera</td><td></td></tr><tr><td>Fluorescence Detector for HPLC</td><td>Shimadzu</td><td>RF-20Axs</td><td></td></tr><tr><td>HPLC Column</td><td>Phenomenex</td><td>Hyperclone ODS</td><td>250 x 4.6 mm</td></tr><tr><td>LCMS-grade H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Merck Millipore</td><td>#WX00011</td><td></td></tr><tr><td>LCMS-grade Acetonitrile</td><td>Merck Millipore</td><td>#100029</td><td>Hypergrade</td></tr><tr><td>Ammonium hydroxide solution</td><td>Fluka</td><td>#44273</td><td>puriss. P.a.</td></tr></tbody></table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

El CMAH (citidina monofosfato-N-acetilneuramínico hidroxilasa) es responsable de la oxidación de citidina monofosfato-N-acetilneuramínico en mamíferos. Sin embargo, los seres humanos no pueden oxidar el ácido monofosfato de citidina-N-acetilneuramínico a ácido monofosfato de citidina-N-glicolilneuramínico debido a una deleción del exón primario del gen CMAH . Para entender los efectos y las implicaciones de la falta de actividad de CMAH con más detalle, un modelo de eliminación de Cmah en ratones es de gran interés en la investigación básica y aplicada. El método de análisis para determinar el fenotipo de este modelo de ratón se describe aquí en detalle y se basa en la detección de ácido N-acetilneuramínico y ácido N-glicolilenuramínico en el hígado y leche de ratones knock-out de tipo salvaje y Cmah . Los ácidos siálicos endógenos se liberan y se derivatizan con o-fenilendiamina para generar derivados fluorogénicos, que pueden analizarse posteriormente por HPLC. El protocolo presentado puede serTambién se aplicó para el análisis de leche y muestras de tejidos de otros orígenes, y puede ser útil para investigar los efectos nutricionales y para la salud del ácido N-glicolilneuramínico.

Una representación esquemática del método de análisis descrito se muestra en la Figura 1 e incluye el aislamiento de ácidos siálicos de leche y muestras de hígado de ratones mutantes knock-out de tipo salvaje y Cmah y la derivatización de fluorescencia y análisis HPLC de estos componentes. La Figura 2 y la Figura 3 muestran cromatogramas HPLC representativos de ácidos siálicos derivatizados de leche y muestras de hígado de ratones Cmah homocigotos y heterocigotos (- / - y +/-) y ratones de tipo salvaje. La Figura 4 muestra las cantidades relativas obtenidas de ácido N-glicolilneuramínico (Neu5Gc) de las muestras de ratón analizadas calculadas a partir de las áreas de los picos de HPLC. <img alt="Figura 1" class="xfigimg" src="/files/ftp_upload/56030/56030fig1.jpg" /> Figura <stro<html> Ng class = &quot;xfig&quot;&gt; 1 : Visión general esquemática del método de análisis descrito para los ácidos siálicos de muestras de leche y de hígado derivadas de ratón. <a href="http://ecsource.jove.com/files/ftp_upload/56030/56030fig1large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 2" class="xfigimg" src="/files/ftp_upload/56030/56030fig2.jpg" /> Figura 2 : Cromatogramas de HPLC de ácidos siálicos marcados con fluorescencia procedentes de muestras de leche derivadas de ratones Cmah knock-out homo y heterocigotos (- / - y +/-) y ratones de tipo salvaje. El cromatograma superior es el estándar de ácido siálico mixto. <a href="http://ecsource.jove.com/files/ftp_upload/56030/56030fig2large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> &quot;Src =&quot; / files / ftp_upload / 56030 / 56030fig3.jpg &quot;/&gt; Figura 3 : Cromatogramas HPLC de ácidos siálicos marcados con fluorescencia a partir de muestras de hígado derivadas de ratones Cmah knock-out homo y heterozigóticos (- / - y +/-) y ratones de tipo salvaje. El cromatograma superior es el estándar de ácido siálico mixto. <a href="http://ecsource.jove.com/files/ftp_upload/56030/56030fig3large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 4" class="xfigimg" src="/files/ftp_upload/56030/56030fig4.jpg" /> Figura 4 : Cantidades relativas de ácido N-glicolilneuramínico (Neu5Gc) de las muestras de ratón analizadas calculadas a partir de las áreas de pico de HPLC. <a href="http://ecsource.jove.com/files/ftp_upload/56030/56030fig4large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a>

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Se describe un método basado en HPLC para la determinación de ácido N-acetilneuramínico y ácido N-glicolilenuramínico en hígado y leche de ratón.

Determinación de ácidos siálicos en hígado y muestras de leche de tipo salvaje y<em&gt; CMAH</em&gt; Ratones knock-out.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Universidad San Sebastian

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K vistas.  Nanjing Agricultural University.  Se describe un método basado en HPLC para la determinación de ácido N-acetilneuramínico y ácido N-glicolilenuramínico en hígado y leche de ratón. 

Video: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Determining Bile Duct Density in the Mouse Liver

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques are used, including serum chemistry, histological analysis, and immunostaining for specific markers. Although these techniques can provide important information about the biliary system, they often do not present a full picture of bile duct (BD) developmental defects across the whole liver. This is in part due to the robust ability of the mouse liver to drain the bile even in animals with significant impairment in biliary development. Here we present a simple method to calculate the average number of BDs associated with each portal vein (PV) in sections covering all lobes of mutant/transgenic mice. In this method, livers are mounted and sectioned in a stereotypic manner to facilitate comparison among various genotypes and experimental conditions. BDs are identified via light microscopy of cytokeratin-stained cholangiocytes, and then counted and divided by the total number of PVs present in liver section. As an example, we show how this method can clearly distinguish between wild-type mice and a mouse model of Alagille syndrome. The method presented here cannot substitute for techniques that visualize the three-dimensional structure of the biliary tree. However, it offers an easy and direct way to quantitatively assess BD development and the degree of ductular reaction formation in mice.

We present a rather simple and sensitive method for accurate quantification of bile duct density in the mouse liver. This method can aid in determining the effects of genetic and environmental modifiers and the effectiveness of potential therapies in mouse models of biliary diseases.

Determinación de la densidad del conducto biliar en el hígado del ratón

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques ...

Investigación

Biología del Desarrollo

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing termini of oligo- and polysaccharides, as well as its unique chemical characteristics, sialic acid is involved in a multitude of different receptor-ligand interactions. By modifying the expression of sialic acid on the cell surface, sialic acid-dependent interactions will consequently be influenced. This can be helpful to investigate sialic acid-dependent interactions and has the potential to influence certain diseases in a beneficial way. Via metabolic glycoengineering (MGE), the expression of sialic acid on the cell surface can be modulated. Herein, cells, tissues, or even entire animals are treated with C2-modified derivatives of N-acetylmannosamine (ManNAc). These amino sugars act as sialic acid precursor molecules and therefore are metabolized to the corresponding sialic acid species and expressed on glycoconjugates. Applying this method produces intriguing effects on various biological processes. For example, it can drastically reduce&#160;the expression of polysialic acid (polySia) in treated neuronal cells and thus affects neuronal growth and differentiation. Here, we show the chemical synthesis of two of the most common C2-modified N-acylmannosamine derivatives, N-propionylmannosamine (ManNProp) as well as N-butanoylmannosamine (ManNBut), and further show how these non-natural amino sugars can be applied in cell culture experiments. The expression of modified sialic acid species is quantified by high performance liquid chromatography (HPLC) and further analyzed via mass spectrometry. The effects on polysialic acid expression are elucidated via Western blot using a commercially available polysialic acid antibody.

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid is a typical monosaccharide-unit found in glycoconjugates. It is involved in a plethora of molecular and cellular interactions. Here we present a method to modify cell surface sialic acid expression using metabolic glycoengineering with N-acetylmannosamine derivatives.

Glycoengineering metabólico del ácido siálico utilizando N-acil-modificado Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing ...

Bioingeniería

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible animal models mirror common components of human disease, including the bm12 transfer model. Upon transfer of bm12 splenocytes or purified CD4 T cells, C57BL/6 mice rapidly develop large frequencies of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells followed by high levels of circulating anti-nuclear antibodies. Since this model utilizes mice on a pure C57BL/6 background, researchers can quickly and easily study disease progression in transgenic or knockout mouse strains in a relatively short period of time. Here we describe protocols for the induction of the model and the quantitation Tfh, GC B cells, and plasma cells by multi-color flow cytometry. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells, and plasma cells in other disease models.

The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

El inducible Modelo BM12 del lupus eritematoso sistémico (LES) en ratones C57BL / 6 ratones

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible ...

Medicina

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

Un método para la medición de la función de la glándula salival en ratones

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

Inmunología e Infección

Using a Bacterial Pathogen to Probe for Cellular and Organismic-level Host Responses

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' pathogens (Listeria monocytogenes, Shigella flexneri, Burkholderia pseudomallei, Francisella tularensis, and Rickettsia spp.) gain access to the infected cell cytosol by physically and enzymatically degrading the primary vacuolar membrane. Once in the cytosol, these pathogens both proliferate as well as generate sufficient mechanical forces to penetrate the plasma membrane of the host cell in order to infect new cells. Here, we show how this terminal step of the cellular infection cycle of L. monocytogenes (Lm) can be quantified by both colony-forming unit assays and flow cytometry and give examples of how both pathogen- and host-encoded factors impact this process. We also show a close correspondence of Lm infection dynamics of cultured cells infected in vitro and those of hepatic cells derived from mice infected in vivo. These function-based assays are relatively simple and can be readily scaled up for discovery-based high-throughput screens for modulators of eukaryotic cell function.

We describe both in vitro and in vivo infection assays that can be used to analyze the activities of host-encoding factors.

Usando un patógeno bacteriano a punta de prueba para las respuestas celular y organísmica nivel Host

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' ...

Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by goblet cells and the gastric mucosa, provide the scaffold for a micrometers-thick mucus layer that lines the epithelia of the gut and respiratory tract3,4. In addition to mucins, mucus layers also contain antimicrobial peptides, cytokines, and immunoglobulins5-9. The mucus layer is an important part of host innate immunity, and forms the first line of defense against invading microorganisms8,10-12. As such, the mucus is subject to numerous interactions with microbes, both pathogens and symbionts, and secreted mucins form an important interface for these interactions. The study of such biological interactions usually involves histological methods for tissue collection and staining. The two most commonly used histological methods for tissue collection and preservation in the clinic and in research laboratories are: formalin fixation followed by paraffin embedding, and tissue freezing, followed by embedding in cryo-protectant media.
Paraffin-embedded tissue samples produce sections with optimal qualities for histological visualization including clarity and well-defined morphology. However, during the paraffin embedding process a number of epitopes become altered and in order to study these epitopes, tissue sections have to be further processed with one of many epitope retrieval methods13. Secreted mucins and lipids are extracted from the tissue during the paraffin-embedding clearing step, which requires prolong incubation with organic solvents (xylene or Citrisolv). Therefore this approach is sub-optimal for studies focusing on the nature and distribution of mucins and mucus in vivo.
In contrast, freezing tissues in Optimal Cutting Temperature (OCT) embedding medium avoids dehydration and clearing of the sample, and maintains the sample hydration. This allows for better preservation of the hydrated mucus layer, and thus permits the study of the numerous roles of mucins in epithelial biology. As this method requires minimal processing of the tissue, the tissue is preserved in a more natural state. Therefore frozen tissues sections do not require any additional processing prior to staining and can be readily analyzed using immunohistochemistry methods.
We demonstrate the preservation of micrometers-thick secreted mucus layer in frozen colon samples. This layer is drastically reduced when the same tissues are embedded in paraffin. We also demonstrate immunofluorescence staining of glycan epitopes presented on mucins using plant lectins. The advantage of this approach is that it does not require the use of special fixatives and allows utilizing frozen tissues that may already be preserved in the laboratory.

Unfixed frozen tissue samples embedded in Optimal Cutting Temperature medium (OCT) can be used to study natural distribution and glycosylation of secreted mucus. In this approach tissue processing is minimal and the natural presentation of glycolipids, mucins and glycan-epitopes is preserved. Tissue sections can be analyzed by immunohistochemistry using fluorescence or chromogenic detection.

El uso de tejidos no fijadas, congeladas para estudiar la distribución de mucina Natural

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by ...

Biología

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients with autoimmune hepatitis. The overwhelming majority of patients with DIH are women. The underlying mechanisms of these sex differences in prevalence are unclear because of the paucity of animal models that mimic human disease. Even so, underlying mechanisms are widely believed to be associated with human leukocyte antigen haplotypes and sex hormones. In contrast, using a DIH mouse model, we have uncovered that IL-4 initiated&#160;CD4+ T cells directed against an epitope of cytochrome P450 2E1 induces influx of neutrophils, macrophages and mast cells into the livers of female BALB/c mice. Using this model, we have also shown that IL-33-induced FoxP3+regulatory T cells confer protection against DIH in female and male mice. This DIH model is induced by immunizing mice with an epitope of CYP2E1 that has been covalently altered with a drug metabolite that has been associated with DIH. This epitope is recognized by patients with DIH. Our method induces robust and reproducible hepatitis and autoantibodies that can be utilized to study the pathogenesis of DIH. While in vivo studies can cause undue pain and distress in mice when done improperly, the advantage of an in vivo model is the ability to evaluate the pathogenesis of disease in a large number of mice. Additionally, biological effects of the altered liver proteins can be studied using invasive procedures. The addition of in vitro studies to the experimental design allows rapid repetition and mechanistic analysis at a cellular level. Thus, we will demonstrate our model protocol and how it can be utilized to study in vivo and in vitro mechanisms of DIH.

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

Inducción de hepatitis autoinmune inducida por fármacos en ratones BALB/c para el estudio de sus mecanismos patógenos

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

Inducir meningitis meningocócica Serogrupo C en ratones a través de parto intracisternal

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Indirect Immunofluorescence on Frozen Sections of Mouse Mammary Gland

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple method for the immune detection of proteins, the mouse lactating mammary gland being taken as an example. A protocol for the preparation of the tissue samples, especially concerning the dissection of mouse mammary gland, tissue fixation and frozen tissue sectioning, are detailed. A standard protocol to perform indirect immunofluorescence, including an optional antigen retrieval step, is also presented. The observation of the labeled tissue sections as well as image acquisition and post-treatments are also stated. This procedure gives a full overview, from the collection of animal tissue to the cellular localization of a protein. Although this general method can be applied to other tissue samples, it should be adapted to each tissue/primary antibody couple studied.

The indirect immunofluorescence protocol described in this article allows the detection and the localization of proteins in the mouse mammary gland. A complete method is given to prepare mammary gland samples, to perform immunohistochemistry, to image the tissue sections by fluorescence microscopy, and to reconstruct images.

Inmunofluorescencia indirecta en secciones congeladas de ratón Glándula Mamaria

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple ...

<meta charset="utf8"></head><body>Método optimizado para la recolección de leche por una sola persona en estudios de lactancia de ratones

An Efficient Single-Person Technique for Milk Sampling from Laboratory Mice

Rodent models have been widely used in biology since the early 20th century to study basic physiology and biochemical mechanisms. In lactation and neonatal development research, there is a need to sample milk to determine the composition and how milk may be affected by experimental manipulations, thereby impacting newborn development. Collecting biofluids in sufficient amounts from small rodents can be difficult. Several studies have demonstrated different techniques to obtain milk from mice. However, these techniques often require at least two trained personnel, which may be challenging in some cases.&#160;
Here, we demonstrate a modified milk sampling technique based on a method published in 2009. With this affordable and easy-to-assemble method, one trained person can routinely obtain 0.1&#8211;0.5 mL of milk from a dam under anesthesia in less than 10 min. Using this method, we collected sufficient milk on post-delivery day 2 (PD2) and post-delivery day 10 (PD10). We measured milk macronutrient components and compared them with the existing literature to validate our collection method.&#160;
We recorded that on PD2, milk protein averaged at 70.1 &#177; 5.2 g/L, milk fat was 174.4 &#177; 7.1 g/L, and milk lactose was 12.3 &#177; 0.6 g/L. On PD10, while milk lactose and protein remained at similar concentrations as on PD2, milk fat was significantly higher (224.4 &#177; 17.1 g/L). We also observed that the relative abundance of individual milk proteins varied between PD2 and PD10. More specifically, &#945;S1-casein and whey acidic protein were higher, while &#946;-casein was lower at PD10 compared with PD2. Overall, we demonstrate an efficient single-person technique for milk sampling from mice using a device that can easily be assembled with commonly used laboratory equipment.

<meta charset="utf8"></head><body>Una técnica eficiente de una sola persona para el muestreo de leche de ratones de laboratorio

This article describes how to assemble a device that can be used to collect milk from laboratory mice. This device is affordable, portable, and allows a collection of 0.1&#8211;0.5 mL of milk by one trained person. A detailed milking protocol is also included.&#160;

Determinación de ácidos siálicos en hígado y muestras de leche de tipo salvaje y

Resumen

Explorar más videos

Capítulos en este video