Bu çalışma kısmen Çin Doğal Bilimler Vakfı (JV ve LL&#39;ye 31471703, A0201300537 ve 31671854 hibe numaraları) ve 100 Yabancı Talent Planı (JVB için JSB2014012 hibe numarası) tarafından desteklendi.

Hayvanları ilgilendiren prosedürler, Nanjing Ziraat Üniversitesi Deneysel Hayvan Merkezi Etik Kurulu tarafından Deneysel Hayvan Refahı Ulusal Rehberine (Çin Bilimsel ve Teknolojik Araştırma Bakanlığı, 2006) uygun olarak, bir SPF&#39;de barındırılan hayvanlarla onaylanmıştır Tesis (İzin KİMLİĞİ: SYXK-J-2011-0037). 1. Cmah Knock-out Fare Modeli <ol><li> Yangzhou Üniversitesi (Çin) Karşılaştırmalı Tıp Merkezi&#39;nden alınan vahşi tip C57Bl / 6 farelerini kullanın. Not: Cmah knock-out fareler de Cmah geninin ekson 6 92 baz çifti kaldırarak, ticari olarak bir CRISPR / Cas9 20 strateji kullanarak önceki Cmah nakavt çalışmaları 17, 19 ve elde edilen sağlanan bilgilere dayanarak oluşturulan Insan CMAH geninde silinmiş 19 . Pozitif F 0 &lt;/ alt&gt; -mice (2 birey) heterozigot F 1 -mice elde etmek için, yabani tip fareler ile çaprazlanır. Heterozigot F 1- misli (beş birey) geçtikten sonra, homozigot CmA knock-out F 2- misli başarıyla elde edilebilir (3 kişi). </li><li> Ticari bir DNA saflaştırma kiti kullanarak Zangala 21 tarafından gösterilen yönteme göre genomik DNA kullanarak farelerin genotiplendirme yapın. <ol><li> Ticari DNA polimeraz ve primer çift 5&#39;gaaagggctcggctctgtatgaa3 &#39;ve 5&#39;tttaaaatgtcccgggtgagaagc3&#39; kullanarak Cmah geninin ilgili bir DNA parçasını genişletin. 94 ° C&#39;de 40 saniye, 63 ° C&#39;de 40 saniye tavlama ve 1 dakika boyunca 72 ° C&#39;de uzama içeren 34 PCR döngüsü kullanılarak gen amplifikasyonunu uygulayın. </li><li> PCR ürünlerini% 1 agaroz jel üzerinde görselleştirin. Vahşi tip birey için tek bir bant (0.5 kb), çift bant (0.4 ve 0.5 kb) gözlemlenmelidir.Heterozigot knock-out bireyi ve homozigot nakavt bireyi için tek bir bant (0.4 kb) içermektedir. </li></ol></li></ol> 2. Örnek Koleksiyon <ol><li> Willingham ve ark tarafından açıklanan protokolü kullanarak fare sütü toplayın . 22 . </li><li> Gonçalves ve ark. Tarafından tarif edilen protokolü kullanarak fare karaciğer dokusunu toplayın . 23 ve örnekleri -80 ° C&#39;de saklayın. </li></ol> 3. Sütten Sialik Asitlerin İzolasyonu <ol><li> Damıtılmış H2O 88 mL&#39;lik buzlu asetik asit 12 ml ilave edilerek 2 M asetik asit solüsyonu, 100 mL hazırlanması </li><li> 50 mL sütü bir 1.5 mL santrifüj tüpüne aktarın ve hazırlanan sulu asetik asit çözeltisinden 1.2 mL ekleyin. </li><li> Süspansiyonu 80 ° C&#39;de 4 saat inkübe edin ve numuneyi 14.000 xg&#39;de 10 dakika santrifüjleyin. </li><li> Süpernatantın en iyi 1.000 μL&#39;sini taze bir 1.5 mL santrifüj tüpüne aktarın ve remÇözücüyü oda sıcaklığında santrifüj buharlaştırmayla kurutun (bağlı vakum pompasına bağlı olarak 4-20 saat sürecektir). Yeniden çözülür damıtılmış H2O 500 uL numune </li><li> Bir mikro-anyon değişim sütunu hazırlayın. Bu adım, özellikle anyonik bileşiklerin zenginleşmesine ve süt ve karaciğer örneklerinden katyonik ve nötr bileşiklerin uzaklaştırılmasına ve dolayısıyla florojenik OPD etiketleme maddesinin sialik asit türetilmesi için seçiciliğini arttırır. <ol><li> Her numune için, 200 mg anyon değişim reçinesi (Dowex 1X8), boş bir 3 ml sütun tüplerine, bağlı bir musluk ile aktarın. </li><li> Reçinedeki klorür iyonlarını asetat iyonlarıyla değiştirmek için aşama 3.1&#39;de hazırlanan sulu asetik asit çözeltisinin 2 mL&#39;si ilave edin. Çözücü reçinenin üst kısmına ulaştığında musluğu kapatın. </li><li> Damıtılmış H 2 O damla damla 2 mL hafifçe ilave edin, musluğu açın ve çözücünün çoğuna ulaştığında akışını durdurunReçinenin üstü. Reçinenin daima solvent ile kaplandığından emin olun. </li><li> Fazla asetat çıkarılması için damıtılmış H2O 2 mL reçine sütun iki kez daha yıkanır. </li></ol></li><li> Elde edilen 500 μL örnek solven 3.4 adımından aktarılır. Reçine sütun üzerine yerleştirin ve akışı atın. Yavaşça 1.5 mL bir 50 mM amonyum asetat solüsyonu 1 ml kullanılarak reçineden örnek anyonlar (amonyum asetat 386 mg damıtılmış H2O, 100 mL) damıtılmış H2O Elute 2 mL reçine yıkama Santrifüj tüpü. Solvent, oda sıcaklığında kuruyana kadar santrifüj buharlaştırma ile çıkarılır. NOT: Kuru numuneler en fazla 12 ay süreyle 4-6 ° C&#39;de saklanabilir. </li></ol> 4. Karaciğer dokusundan Sialik Asitlerin İzolasyonu <ol><li> 20-50 mg fare karaciğeri yavaşça çözündürün ve bir Dounce doku öğütücüsüne (1 mL veya 2 mL hacim) aktarın. 1.2 mL sulu asetik asit çözeltisiAdım 3.1&#39;de hazırlanan ve dokuyu 10 saniye boyunca hafifçe keserek homojenize edin. Nihai süspansiyon 1.5 mL santrifüj tüpüne aktarılır. </li><li> Adımları takip edin 3.3. 3.6&#39;ya kadar. NOT: Kuru numuneler en fazla 12 ay süreyle 4-6 ° C&#39;de saklanabilir. </li></ol> 5. Karışık bir Sialik Asit Standardının Hazırlanması <ol><li> Analitik bir balansda 1-5 mg santrifüj tüpüne 5-8 mg N-asetilnöraminik asit tartılır. Kesin ağırlık not edin ve her mg için damıtılmış H2O 164 mcL (yani Neu5Ac ağırlığı 7.2 mg, sonra 7.2 = 1 x 164, damıtılmış H2O 181 mcL ise). Bu, -20 ° C&#39;de 12 aya kadar depolanabilen 20 mM Neu5Ac stok solüsyonuyla sonuçlanır. </li><li> N-glikolneukaminik asit, 1 mg&#39;lık alikotlar gibi orta bir fiyatla daha küçük miktarlarda alın. Bir ~ 20 mM Neu5Gc stok solüsyonu elde etmek üzere bileşik 2 O direkt olarak distile H 154 uL ekleyin. AktarınSolüsyonu 1.5 mL&#39;lik santrifüj tüpüne eklenir. Bu çözüm -20 ° C&#39;de 12 aya kadar depolanabilir. </li><li> Adım 5.1 ve 5.2&#39;deki her stok solüsyondan 5 μL, taze bir 1.5 mL santrifüj tüpüne birleştirin ve kuruyana kadar oda sıcaklığında santrifüj buharlaştırarak çözücü çıkartın. NOT: Karışık sialik asit standardı 4 - 6 ° C&#39;de 12 aya kadar depolanabilir. </li></ol> 6. Sialik Asitlerin Flüoresan Türetilmesi <ol><li> O-fenilendiamin 100 mg ve 10 ml sodyum hidrojen sülfit 208 mg oluşan 10 ml OPD-solüsyonunun hazırlanması H2O damıtılmış </li><li> Fare sütünün (adım 3), fare karaciğeri (adım 4) veya karışık sialik asit standardından (adım 5) türetilmiş sialik asit örneklerine 20 μL OPD çözeltisi ekleyin. 30 saniye boyunca şiddetle girdap edin ve örnekleri karanlıkta 80 ° C&#39;de 4 saat inkübe edin ( yani mikro tüpleri alüminyum folyoya sarın). </li><li> Örnekleri 5 dakika soğumaya bırakın, 80 μ ekleyinDamıtık H2O L ve 1 dakika boyunca 14,000 x g&#39;de santrifüj tüpleri. </li><li> Süpernatandan 80 μL, 300 μL&#39;lik yüksek kurtarma HPLC şişesine aktarın. Türetilmiş sialik asit örnekleri, bir haftaya kadar 4-6 ° C&#39;de saklanabilir. </li></ol> 7. Sialik Asit Türevlerinin HPLC Analizi <ol><li> Çevrimiçi flüoresan dedektörüne bağlı standart bir HPLC sistemi kullanarak numuneleri analiz edin. </li><li> Analiz için 250 mm uzunluğunda ve 4.6 mm çaplı standart boyutlara sahip ters faz C18 sütun kullanın. </li><li> 200 mL stok solüsyonunu 800 mL LCMS dereceli su (LCMS - sıvı kromatografi kütle spektrometresi) ile seyrelterek solvent A hazırlayın. Stok çözeltisinin kendisi aşağıdaki gibi hazırlanabilir: <ol><li> LCMS dereceli H2O 800 mL formik asidin 46 g &#39;ekleme </li><li> Damla damla amonyum hidroksit çözeltisi (puriss. Pa) ilave ederek pH&#39;ı 4.5&#39;e ayarlayın. </li><li> Solventi birLCMS dereceli H 2 O ile 1000 mL&#39;ye kadar doldurun. Bu stok çözeltisi 4 - 6 ° C&#39;de 3 aya kadar depolanabilir. </li></ol></li><li> B çözücüsü için LCMS dereceli asetonitril kullanın. </li><li> Sialik asit türevlerini 1 mL / dakika akış oranında aşağıdaki gradyanlı elüsyon ile ayırın: <ol><li> Önce çözücü A&#39;ya karıştırılmış B çözücüsü% 10 eklenerek başlanmalıdır. </li><li> 0 dakikadan 15 dakikaya kadar, solvent B oranını yavaşça doğrusal bir gradyanla% 60&#39;a yükseltin. </li><li> 15 dakika ila 16 dakika arasında, solvent B oranını% 60 ila% 90 arasında doğrusal bir gradyanla hızla arttırın. Bu, HPLC kolonunun yıkanmasını başlatır. </li><li> HPLC sütununu daha da yıkamak için, 18 dakika ile 19 dakika arasında çözücünün B düzeyini% 10&#39;a kadar kademeli olarak düşürmeden önce, çözücünün B seviyesini 16 dakika ile 18 dakika arasında% 90 seviyesinde tutun. </li><li> HPLC sütununu,% 19 B başlangıç ​​koşullarına 19 ila 24 dakika arasında yeniden dengeleyin. </li></ol></li><li> İçinde50 μL numuneyi HPLC sistemine verin. </li><li> 373/448 nm floresan dedektör uyarma / emisyon dalga boylarını kullanarak eluentleri izleyin ve türevlendirilmiş sialik asitlerin yaklaşık tutma süreleri 9 dakika (Neu5Gc-OPD için) ve 10 dakika (Neu5Ac-OPD için) beklenebilir. </li><li> Neu5Ac (A Neu5Ac ) ve Neu5Gc&#39;nin (A Neu5Gc ) floresan zirve bölgelerinden Neu5Gc&#39;nin (F Neu5Gc ) göreli miktarını aşağıdaki gibi hesaplayın: F Neu5Gc [100] = 100 x A Neu5Gc / (A Neu5Ac + A Neu5Gc ). Homozigot Cmah knock-out fare F Neu5Gc&#39;den süt ve karaciğer örnekleri% 0 olmalı, oysa heterozigot ve vahşi tip F Neu5Gc değerleri fare yaşına ve doku türüne (2% Ve&gt;% 90) ve beklenen hata marjları ±% 12&#39;dir. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

Yazarların açıklayacak bir şeyi yok.

Burada sunulan protokol, süt ve karaciğer numunelerinin Neu5Gc nispi miktarlarını analiz ederek ve nicelleştirerek homozigot Cmah nakavt farelerinin fenotipik değerlendirmesini sağlar. Analiz, floresans algılama özelliğine sahip standart bir HPLC ayarı kullanılarak gerçekleştirildi. Bu prosedürün en kritik basamağı, anyon değişim sütunlarının hazırlanması ve anyon değişim kromatografisinin uygulanmasıdır; Reçineyi düzgün şekilde çöktürmek ve doğru yıkama ve elüsyon paylar?...

N-asetilnöraminik asit (Neu5Ac) ve N-glikoli-nöraminik asit (Neu5Gc), çoğu memelide en yaygın sialik asitlerdir 1 . Neu5Ac&#39;yi endojen olarak sentezleyebiliyor olsa da, insanlar bir CMP-Neu5Ac hidroksilaz 2 , 3&#39;ü kodlayan CMAH geni üzerinde birincil ekson silinmesi nedeniyle Neu5Gc üretemiyor. Bununla birlikte, hayvana dayalı gıda ürünleri Neu5Gc 4 , 5 , 6&#39;nın diyet kaynaklı olabileceği gibi anti-Neu5Gc antikorlarının üretilmesine ve dolayısıyla Neu5Gc 7&#39;ye karşı bir bağışıklık tepkisinin tetiklenmesine neden olur. Neu5Gc&#39;nin bu besinsel etkisinin kronik inflamasyona ve diğer çeşitli hastalıklara 8 , 9 , 10 katkıda bulunduğu düşünülmektedir. Neu5Gc&#39;nin h üzerindeki etkilerini kapsamlı olarak anlamak içinUmans, gıda kaynaklı sialik asitlerin etkilerinin sistematik çalışması için bir hayvan modeli son derece arzu edilir. Nakavt farelerinin analizinde polimeraz zincir reaksiyonuna (PCR) dayanan protokoller iyi belirlenmiş ve genotipik değerlendirme için uygun bir yol olmasına rağmen, fenotipin metabolik seviyedeki işlevsel analizi daha spesifik analiz yöntemleri gerektirir. Bir Cmah knock-out fare modelinin fenotipi, karaciğer veya süt örneklerinde sialik asitlerin kompozisyonunu izole ederek ve analiz ederek değerlendirilebilir. Hayvan dokularında sialik asitlerin saptanması için çeşitli yöntemler daha önce bildirilmiştir: sialik asitlerin resorsinol 11 ya da tiobarbitürik asit 12 ile reaksiyona sokulması, bir kromoforik ürünün oluşumuyla sonuçlanır ve basitçe bir platereader temelli kurulum kullanılarak analiz edilebilir ancak sadece toplam siyaliktir Asit içeriği belirlenebilir. Alternatif olarak, sialik asitlerin analizi de gaz kromatografisi13 , MALDI-ToF kitle spektrometrisi 14 veya amperometrik yöntemler 15 . Bununla birlikte, en yaygın olarak uygulanan sialik asit analiz yöntemleri, hidrolitik salıma, bunu takiben floresan türevlendirmeye ve daha sonra yüksek performanslı sıvı kromatografisine ( 16 , 17 , 18) dayalıdır.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:147px;">Chemicals:</td>
			<td style="width:144px;"></td>
			<td style="width:143px;"></td>
			<td style="width:251px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">N-acetylneuraminic acid</td>
			<td>Sigma</td>
			<td>A0812</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">N-glycolylneuraminic acid</td>
			<td>Sigma</td>
			<td align="right">50644</td>
			<td>1 mg aliquot should be sufficient</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">o-Phenylenediamine</td>
			<td>Sigma</td>
			<td align="right">694975</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sodium hydrogen sulfite</td>
			<td>J&#38;K Scientific Ltd</td>
			<td align="right">75234</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tools/Materials:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">3 mL SPE tubes</td>
			<td>Supelco</td>
			<td>Sigma 57024</td>
			<td>empty solid phase extraction columns</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Luer stopcock</td>
			<td>Sigma</td>
			<td>S7396</td>
			<td>to stop the flow of the SPE tube</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dowex 1X8</td>
			<td>Dow Chemicals</td>
			<td>Sigma 44340</td>
			<td>200-400 mesh</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dounce tissue grinder</td>
			<td>Sigma</td>
			<td>D8938</td>
			<td>tight fit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC Analysis:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">High-recovery HPLC vial</td>
			<td>Agilent Technologies</td>
			<td>#5188-2788</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC System</td>
			<td>Shimadzu</td>
			<td>Nexera</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fluorescence Detector for HPLC</td>
			<td>Shimadzu</td>
			<td>RF-20Axs</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC Column</td>
			<td>Phenomenex</td>
			<td>Hyperclone ODS</td>
			<td>250x4.6 mm</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;">LCMS-grade H2O</td>
			<td>Merck Millipore</td>
			<td>#WX00011</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LCMS-grade Acetonitrile</td>
			<td>Merck Millipore</td>
			<td>#100029</td>
			<td>Hypergrade</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ammonium hydroxide solution</td>
			<td>Fluka</td>
			<td>#44273</td>
			<td>puriss. P.a.</td>
		</tr>
	</tbody>
</table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

CMAH (sitidin monofosfat-N-asetilnöramin asit hidroksilaz), memelilerde sitidin monofosfat-N-asetilnöraminik asitlerin oksidasyonundan sorumludur. Bununla birlikte, insanlar CMAH geninin primer ekson silinmesi nedeniyle sitidin monofosfat-N-asetilnöraminik asiti sitidin monofosfat-N-glikoli-nöraminik asite oksitleyemezler . CMAH aktivitesinin eksikliğinin etkilerini ve etkilerini daha ayrıntılı olarak anlamak için, farelerde bir Cmah knock-out modeli, temel ve uygulamalı araştırmalara yoğun ilgi duymaktadır. Bu fare modelinin fenotipini belirlemek için analiz metodu burada detaylı olarak tarif edilmiş olup, vahşi tip ve Cmah nakavt farelerinin karaciğerindeki ve sütünün her ikisinde de N-asetilnöraminasit ve N-glikolenüraminik asitin saptanmasına dayanmaktadır. Endojen sialik asitler serbest bırakılır ve daha sonra HPLC ile analiz edilebilen flüorojenik türevler oluşturmak üzere o-fenilendiamin ile türevlendirilir. Sunulan protokol,Çeşitli başka kaynaklı süt ve doku örneklerinin analizi için de uygulanmış ve N-glikoli-nevüaminik asidin beslenme ve sağlık etkilerini araştırmak için kullanılabilir.

Tanımlanan analiz yönteminin şematik bir görünümü Şekil 1&#39;de gösterilmiştir ve vahşi tip ve Cmah nakavt mutant farelerinin süt ve karaciğer numunelerinden sialik asitlerin izolasyonu ve bu bileşenlerin flüoresan türetilmesi ve HPLC analizini içerir. Şekil 2 ve Şekil 3 , homo- ve heterozigot nakavt Cmah farelerinden (- / - ve +/-) ve yabani tip farelerden süt...

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Fare karaciğeri ve sütündeki N-asetilnöraminik asit ve N-glikolenüraminik asitin tayini için HPLC temelli bir yöntem açıklanmaktadır.

Karaciğer ve Süt örneklerinde vahşi tipli ve sialik asitler tayini ve<em&gt; CMAH</em&gt; Knock-out Fare.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K Görüntüleme.  Nanjing Agricultural University.  Fare karaciğeri ve sütündeki N-asetilnöraminik asit ve N-glikolenüraminik asitin tayini için HPLC temelli bir yöntem açıklanmaktadır. 

Video: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Quantitation of &gamma;H2AX Foci in Tissue Samples

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) processes or by exogenous factors, particularly ionizing radiation and radiomimetic compounds. Phosphorylation of the H2A histone variant, H2AX, at the serine-139 residue, in the highly conserved C-terminal SQEY motif, forming &gamma;H2AX, is an early response to DNA double-strand breaks1. This phosphorylation event is mediated by the phosphatidyl-inosito 3-kinase (PI3K) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)2. Overall, DSB induction results in the formation of discrete nuclear &gamma;H2AX foci which can be easily detected and quantitated by immunofluorescence microscopy2. Given the unique specificity and sensitivity of this marker, analysis of &gamma;H2AX foci has led to a wide range of applications in biomedical research, particularly in radiation biology and nuclear medicine. The quantitation of &gamma;H2AX foci has been most widely investigated in cell culture systems in the context of ionizing radiation-induced DSBs. Apart from cellular radiosensitivity, immunofluorescence based assays have also been used to evaluate the efficacy of radiation-modifying compounds. In addition, &gamma;H2AX has been used as a molecular marker to examine the efficacy of various DSB-inducing compounds and is recently being heralded as important marker of ageing and disease, particularly cancer3. Further, immunofluorescence-based methods have been adapted to suit detection and quantitation of &gamma;H2AX foci ex vivo and in vivo4,5. Here, we demonstrate a typical immunofluorescence method for detection and quantitation of &gamma;H2AX foci in mouse tissues.

Quantitation of &#947;H2AX Foci in Tissue Samples

Quantitation of DNA double-strand breaks on the basis of &gamma;H2AX foci has become an invaluable tool, particularly in radiation biology, for the evaluation of tissue radiosensitivity and effects of radiation modifying compounds. Here we demonstrate the use of an immunofluorescence assay for quantitation of &gamma;H2AX foci in tissue samples.

Doku Örnekleri γH2AX Foci kantitasyonu

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) ...

Biyoloji

Identifying the Effects of BRCA1 Mutations on Homologous Recombination using Cells that Express Endogenous Wild-type BRCA1

The functional analysis of missense mutations can be complicated by the presence in the cell of the endogenous protein. Structure-function analyses of the BRCA1 have been complicated by the lack of a robust assay for the full length BRCA1 protein and the difficulties inherent in working with cell lines that express hypomorphic BRCA1 protein1,2,3,4,5. We developed a system whereby the endogenous BRCA1 protein in a cell was acutely depleted by RNAi targeting the 3'-UTR of the BRCA1 mRNA and replaced by co-transfecting a plasmid expressing a BRCA1 variant. One advantage of this procedure is that the acute silencing of BRCA1 and simultaneous replacement allow the cells to grow without secondary mutations or adaptations that might arise over time to compensate for the loss of BRCA1 function. This depletion and add-back procedure was done in a HeLa-derived cell line that was readily assayed for homologous recombination activity. The homologous recombination assay is based on a previously published method whereby a recombination substrate is integrated into the genome (Figure 1)6,7,8,9. This recombination substrate has the rare-cutting I-SceI restriction enzyme site inside an inactive GFP allele, and downstream is a second inactive GFP allele. Transfection of the plasmid that expresses I-SceI results in a double-stranded break, which may be repaired by homologous recombination, and if homologous recombination does repair the break it creates an active GFP allele that is readily scored by flow cytometry for GFP protein expression. Depletion of endogenous BRCA1 resulted in an 8-10-fold reduction in homologous recombination activity, and add-back of wild-type plasmid fully restored homologous recombination function. When specific point mutants of full length BRCA1 were expressed from co-transfected plasmids, the effect of the specific missense mutant could be scored. As an example, the expression of the BRCA1(M18T) protein, a variant of unknown clinical significance10, was expressed in these cells, it failed to restore BRCA1-dependent homologous recombination. By contrast, expression of another variant, also of unknown significance, BRCA1(I21V) fully restored BRCA1-dependent homologous recombination function. This strategy of testing the function of BRCA1 missense mutations has been applied to another biological system assaying for centrosome function (Kais et al, unpublished observations). Overall, this approach is suitable for the analysis of missense mutants in any gene that must be analyzed recessively.

We provide a method for testing BRCA1 variants in a tissue culture based assay for homologous recombination repair of DNA damage by depleting endogenous BRCA1 protein from a cell using RNAi and replacing it with a BRCA1 point mutant that contains a coding change.

Endojen Wild-tip BRCA1 Express hücreler kullanarak Homolog Rekombinasyon BRCA1 Mutasyonlar Etkileri belirlenmesi

The functional analysis of missense mutations can be complicated by the presence in the cell of the endogenous protein. Structure-function analyses of the ...

Concentration Determination of Nucleic Acids and Proteins Using the Micro-volume Bio-spec Nano Spectrophotometer

Nucleic Acid quantitation procedures have advanced significantly in the last three decades. More and more, molecular biologists require consistent small-volume analysis of nucleic acid samples for their experiments. The BioSpec-nano provides a potential solution to the problems of inaccurate, non-reproducible results, inherent in current DNA quantitation methods, via specialized optics and a sensitive PDA detector. The BioSpec-nano also has automated functionality such that mounting, measurement, and cleaning are done by the instrument, thereby eliminating tedious, repetitive, and inconsistent placement of the fiber optic element and manual cleaning.
In this study, data is presented on the quantification of DNA and protein, as well as on measurement reproducibility and accuracy. Automated sample contact and rapid scanning allows measurement in three seconds, resulting in excellent throughput. Data analysis is carried out using the built-in features of the software. The formula used for calculating DNA concentration is:
Sample Concentration = DF &middot; (OD260-OD320)&middot; NACF (1)
Where DF = sample dilution factor and NACF = nucleic acid concentration factor.
The Nucleic Acid concentration factor is set in accordance with the analyte selected1.
Protein concentration results can be expressed as &mu;g/ mL or as moles/L by entering e280 and molecular weight values respectively. When residue values for Tyr, Trp and Cysteine (S-S bond) are entered in the e280Calc tab, the extinction coefficient values are calculated as e280 = 5500 x (Trp residues) + 1490 x (Tyr residues) + 125 x (cysteine S-S bond). The e280 value is used by the software for concentration calculation.
In addition to concentration determination of nucleic acids and protein, the BioSpec-nano can be used as an ultra micro-volume spectrophotometer for many other analytes or as a standard spectrophotometer using 5 mm pathlength cells.

This communication presents data on the accuracy and reproducibility of the BioSpec-nano UV-VIS spectrophotometer for dsDNA and protein quantitation. Even with ultra-small volumes (1 to 2 L), reproducibility is excellent, while the automated wiping function improves throughput and results in minimal carryover for more precise results.

Konsantrasyon belirlenmesi Micro hacimli Bio-spec Nano Spektrofotometre Nükleik Asitler ve Proteinler

Nucleic Acid quantitation procedures have advanced significantly in the last three decades.  More and more, molecular biologists require consistent ...

In vivo Liver Endocytosis Followed by Purification of Liver Cells by Liver Perfusion

The liver is the metabolic center of the mammalian body and serves as a filter for the blood. The basic architecture of the liver is illustrated in figure 1 in which more than 85% of the liver mass is composed of hepatocytes and the remaining 15% of the cellular mass is composed of Kupffer cells (KCs), stellate cells (HSCs), and sinusoidal endothelial cells (SECs). SECs form the blood vessel walls within the liver and contain specialized morphology called fenestrae within in the cytoplasm. Fenestration of the cytoplasm is the appearance of holes (&tilde;100 &mu;m) within the cells so that the SECs act as a sieve in which most chylomicrons, chylomicron remnants and macromolecules, but not cells, pass through to the hepatocytes and HSCs 1 (Fig. 1). Due to the lack of a basement membrane, the gap between the SECs and hepatocytes form the Space of Disse. HSCs occupy this space and play a prominent role in regulation and response to injury, storage of retinoic acid and immunoregulation of the liver 2.
SECs are among the most endocytically active cells of the body displaying an array of scavenger receptors on their cell surface 3. These include SR-A, Stabilin-1 and Stabilin-2. Generally, small colloidal particles less than 230 nm and macromolecules in buffer phase are taken up by SECs, whereas, large particles and cellular debris is endocytosed (phagocytosed) by KCs 4. Thus, the bulk clearance of extracellular material such as the glycosaminoglycans from blood is largely dependent on the health and endocytic functions of SECs 5,6. For example, an increase in blood hyaluronan levels is indicative of liver disease ranging from mild to more severe forms 7.
With the exception of one report 8, there are no immortalized SEC cell lines in existence. Even this immortalized cell line is de-differentiated in that it does not express scavenger receptors that are present on primary SECs (our data, not shown). All cell biological studies must be performed on primary cells obtained freshly from the animal. Unfortunately, SECs dedifferentiate under standard culture conditions and must be used within 1 or 2 days upon isolation from the animal. Differentiation of SECs is marked by the expression of Stabilin-2 or HARE receptor 9 , CD31, and the presence of cytoplasmic fenestration 1. Differentiation of SECs can be extended by the addition of VEGF in culture media or by culturing cells in hepatocyte conditioned medium 10,11.
In this report, we will demonstrate the endocytic activity of SECs in the intact organ using radio-labeled heparin for hyaluronan for the SEC-specific Stabilin-2 receptor. We will then purify hepatocytes and SECs from the perfused liver to measure endocytosis.

In vivo Liver Endocytosis Followed by Purification of Liver Cells by Liver Perfusion

The study of liver sinusoidal endothelial cells (SECs) must be performed with primary cells obtained from the animal as no cell lines exist. This method relies on liver digestion and differential centrifugation for SEC purification for subsequent culturing and experimentation.

Karaciğer Hücreleri Karaciğer Perfüzyon Arıtma Takip in vivo Karaciğer endositoz

The liver is the metabolic center of the mammalian body and serves as a filter for the blood.  The basic architecture of the liver is illustrated in ...

A PCR-based Genotyping Method to Distinguish Between Wild-type and Ornamental Varieties of Imperata cylindrica

Wild-type I. cylindrica (cogongrass) is one of the top ten worst invasive plants in the world, negatively impacting agricultural and natural resources in 73 different countries throughout Africa, Asia, Europe, New Zealand, Oceania and the Americas1-2. Cogongrass forms rapidly-spreading, monodominant stands that displace a large variety of native plant species and in turn threaten the native animals that depend on the displaced native plant species for forage and shelter. To add to the problem, an ornamental variety [I. cylindrica var. koenigii (Retzius)] is widely marketed under the names of Imperata cylindrica 'Rubra', Red Baron, and Japanese blood grass (JBG). This variety is putatively sterile and noninvasive and is considered a desirable ornamental for its red-colored leaves. However, under the correct conditions, JBG can produce viable seed (Carol Holko, 2009 personal communication) and can revert to a green invasive form that is often indistinguishable from cogongrass as it takes on the distinguishing characteristics of the wild-type invasive variety4 (Figure 1). This makes identification using morphology a difficult task even for well-trained plant taxonomists. Reversion of JBG to an aggressive green phenotype is also not a rare occurrence. Using sequence comparisons of coding and variable regions in both nuclear and chloroplast DNA, we have confirmed that JBG has reverted to the green invasive within the states of Maryland, South Carolina, and Missouri. JBG has been sold and planted in just about every state in the continental U.S. where there is not an active cogongrass infestation. The extent of the revert problem in not well understood because reverted plants are undocumented and often destroyed.
Application of this molecular protocol provides a method to identify JBG reverts and can help keep these varieties from co-occurring and possibly hybridizing. Cogongrass is an obligate outcrosser and, when crossed with a different genotype, can produce viable wind-dispersed seeds that spread cogongrass over wide distances5-7. JBG has a slightly different genotype than cogongrass and may be able to form viable hybrids with cogongrass. To add to the problem, JBG is more cold and shade tolerant than cogongrass8-10, and gene flow between these two varieties is likely to generate hybrids that are more aggressive, shade tolerant, and cold hardy than wild-type cogongrass. While wild-type cogongrass currently infests over 490 million hectares worldwide, in the Southeast U.S. it infests over 500,000 hectares and is capable of occupying most of the U.S. as it rapidly spreads northward due to its broad niche and geographic potential3,7,11. The potential of a genetic crossing is a serious concern for the USDA-APHIS Federal Noxious Week Program. Currently, the USDA-APHIS prohibits JBG in states where there are major cogongrass infestations (e.g., Florida, Alabama, Mississippi). However, preventing the two varieties from combining can prove more difficult as cogongrass and JBG expand their distributions. Furthermore, the distribution of the JBG revert is currently unknown and without the ability to identify these varieties through morphology, some cogongrass infestations may be the result of JBG reverts. Unfortunately, current molecular methods of identification typically rely on AFLP (Amplified Fragment Length Polymorphisms) and DNA sequencing, both of which are time consuming and costly. Here, we present the first cost-effective and reliable PCR-based molecular genotyping method to accurately distinguish between cogongrass and JBG revert.

A PCR-based Genotyping Method to Distinguish Between Wild-type and Ornamental Varieties of Imperata cylindrica

We provide a cost-effective and rapid molecular genotyping protocol that employs variety-specific PCR primers that target DNA sequence differences within the chloroplast trnL-F spacer region to differentiate between varieties of Imperata cylindrica (cogongrass) that cannot be distinguished by morphology alone. These varieties include the federally listed noxious weed, cogongrass and closely-related, wide-spread ornamental variety, I. cylindrica var. koenigii (Japanese blood grass).

Wild-tip ve Süs Çeşitler arasında ayırt A PCR tabanlı Genotiplendirme Yöntemi Imperata cylindrica</em

Wild-type I. cylindrica (cogongrass) is one of the top ten worst invasive plants in the world, negatively impacting agricultural and natural resources in ...

Do-It-Yourself Device for Recovery of Cryopreserved Samples Accidentally Dropped into Cryogenic Storage Tanks

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term storage of biological materials such as blood, cells and tissues 1,2. The cryogenic nature of liquid nitrogen, while ideal for sample preservation, can cause rapid freezing of live tissues on contact - known as 'cryogenic burn'2, which may lead to severe frostbite in persons closely involved in storage and retrieval of samples from Dewars. Additionally, as liquid nitrogen evaporates it reduces the oxygen concentration in the air and might cause asphyxia, especially in confined spaces2.
In laboratories, biological samples are often stored in cryovials or cryoboxes stacked in stainless steel racks within the Dewar tanks1. These storage racks are provided with a long shaft to prevent boxes from slipping out from the racks and into the bottom of Dewars during routine handling. All too often, however, boxes or vials with precious samples slip out and sink to the bottom of liquid nitrogen filled tank. In such cases, samples could be tediously retrieved after transferring the liquid nitrogen into a spare container or discarding it. The boxes and vials can then be relatively safely recovered from emptied Dewar. However, the cryogenic nature of liquid nitrogen and its expansion rate makes sunken sample retrieval hazardous. It is commonly recommended by Safety Offices that sample retrieval be never carried out by a single person. Another alternative is to use commercially available cool grabbers or tongs to pull out the vials3. However, limited visibility within the dark liquid filled Dewars poses a major limitation in their use.
In this article, we describe the construction of a Cryotolerant DIY retrieval device, which makes sample retrieval from Dewar containing cryogenic fluids both safe and easy.

Here we present a low cost, durable cryotolerant device for sample retrieval from Dewar tanks filled with liquid nitrogen. The ease of construction and modular design of the device makes the process of sample retrieval from cryogenic tanks safe and easy.

KRİYOPREZERVE Numune Kurtarma için Do-It-Yourself Aygıt yanlışlıkla Kriyojenik Depolama Tankları içine Dropped

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term ...

Milk Collection Methods for Mice and Reeves' Muntjac Deer

Animal models are commonly used throughout research laboratories to accomplish what would normally be considered impractical in a pathogen&#8217;s native host. Milk collection from animals allows scientists the opportunity to study many aspects of reproduction including vertical transmission, passive immunity, mammary gland biology, and lactation. Obtaining adequate volumes of milk for these studies is a challenging task, especially from small animal models. Here we illustrate an inexpensive and facile method for milk collection in mice and Reeves&#8217; muntjac deer that does not require specialized equipment or extensive training. This particular method requires two researchers: one to express the milk and to stabilize the animal, and one to collect the milk in an appropriate container from either a Muntjac or mouse model. The mouse model also requires the use of a P-200 pipetman and corresponding pipette tips. While this method is low cost and relatively easy to perform, researchers should be advised that anesthetizing the animal is required for optimal milk collection.

Milk collection from animal models facilitates various research avenues: understanding passive immunity, identifying pathogens responsible for vertical transmission and, through the use of transgenic mice, even commercial production of proteins found in human breast milk. Here we illustrate a simple method for milk collection in mice and Reeves&#8217; muntjac deer.

Fareler ve Reeves &#39;munçağı Deer için Süt Toplama Yöntemleri

Animal models are commonly used throughout research laboratories to accomplish what would normally be considered impractical in a pathogen&#8217;s native ...

Determination of Fatty Acid Oxidation and Lipogenesis in Mouse Primary Hepatocytes

Lipid metabolism in liver is complex. In addition to importing and exporting lipid via lipoproteins, hepatocytes can oxidize lipid via fatty acid oxidation, or alternatively, synthesize new lipid via de novo lipogenesis. The net sum of these pathways is dictated by a number of factors, which in certain disease states leads to fatty liver disease. Excess hepatic lipid accumulation is associated with whole body insulin resistance and coronary heart disease. Tools to study lipid metabolism in hepatocytes are useful to understand the role of hepatic lipid metabolism in certain metabolic disorders.
In the liver, hepatocytes regulate the breakdown and synthesis of fatty acids via &#946;-fatty oxidation and de novo lipogenesis, respectively. Quantifying metabolism in these pathways provides insight into hepatic lipid handling. Unlike in vitro quantification, using primary hepatocytes, making measurements in vivo is technically challenging and resource intensive. Hence, quantifying &#946;-fatty acid oxidation and de novo lipogenesis in cultured mouse hepatocytes provides a straight forward method to assess hepatocyte lipid handling. 
Here we describe a method for the isolation of primary mouse hepatocytes, and we demonstrate quantification of &#946;-fatty acid oxidation and de novo lipogenesis, using radiolabeled substrates.

De novo lipogenesis and &#946;-fatty acid oxidation constitute key metabolic pathways in hepatocyte, pathways that are perturbed in several metabolic disorders, including fatty liver disease. Here we demonstrate isolation of mouse primary hepatocytes and describe quantification of &#946;-fatty acid oxidation and lipogenesis.

Fare İlköğretim Hepatositlerde Yağ Asidi Oksidasyon ve lipogenez Belirlenmesi

Lipid metabolism in liver is complex. In addition to importing and exporting lipid via lipoproteins, hepatocytes can oxidize lipid via fatty acid ...

Milk Collection in the Rat Using Capillary Tubes and Estimation of Milk Fat Content by Creamatocrit

Milk, as the sole source of nutrition for the newborn mammal, provides the necessary nutrients and energy for offspring growth and development. It also contains a vast number of bioactive compounds that greatly affect the development of the neonate. The analysis of milk components will help elucidate key factors that link maternal metabolism and health with offspring growth and development. The laboratory rat represents a popular model organism for maternal studies, and rat milk can be used to examine the effect of various maternal physiological, nutritional, and pharmacological interventions on milk components, which may then impact offspring health. Here a simple method of manually collecting milk from the lactating rat that can be performed by a single investigator, does not require specialized vacuum or suction equipment, and provides sufficient milk for subsequent downstream analysis is described. A method for estimating the fat content of milk by measuring the percentage of cream within the milk sample, known as the creamatocrit, is also presented. These methods can ultimately be used to increase insight into maternal-child health and to elucidate maternal factors that are involved in proper growth and development of offspring.

Milk is a primary source of nutrition for the neonate. Analysis of milk components may provide insight into maternal factors that affect offspring health. This protocol describes a manual method of collecting milk samples from the lactating rat, which can then be used for further downstream analysis.

Kılcal Tüpler ve Creamatocrit Süt Yağ İçeriğinin Tahmin kullanarak Rat Süt Toplama

Milk, as the sole source of nutrition for the newborn mammal, provides the necessary nutrients and energy for offspring growth and development. It also ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Nükleik Asitlerin süzülmesi İzolasyonu: basit ve hızlı DNA izolasyonu,

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...