نود أن نعرب عن تقديرنا للمختبرات في مجتمع C. elegans التي طورت الأدوات وشاركتها والتي تم الاستشهاد بعملها في هذه المخطوطة. تم توفير بعض السلالات من قبل CGC ، الذي يموله مكتب المعاهد الوطنية للصحة لبرامج البنية التحتية للبحوث (P40 OD010440). تم دعم هذا العمل من خلال منحة مشروع المعاهد الكندية للبحوث الصحية (CIHR) إلى A.L.S. (PJT-175245). يتم دعم CL من قبل منحة الدراسات العليا لمجلس أبحاث العلوم الطبيعية والهندسة في كندا (NSERC) (PGS-D).

الوراثة اللاجينية و ChIP في Caenorhabditis elegans

<ol>
	<li>Alcazar, R. M., Lin, R., Fire, A. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmission+dynamics+of+heritable+silencing+induced+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Transmission dynamics of heritable silencing induced by double-stranded RNA in Caenorhabditis elegans.</a> Genetics. 180 (3), 1275-1288 (2008).</li><li>Ashe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+can+trigger+a+multigenerational+epigenetic+memory+in+the+germline+of+C.+elegans.">piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans.</a> Cell. 150 (1), 88-99 (2012).</li><li>Buckley, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nuclear+Argonaute+promotes+multigenerational+epigenetic+inheritance+and+germline+immortality.">A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality.</a> Nature. 489 (7416), 447-451 (2012).</li><li>Vastenhouw, N. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+gene+silencing+by+RNAi.">Long-term gene silencing by RNAi.</a> Nature. 442 (7105), 882 (2006).</li><li>Lee, H. -. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C.+elegans+piRNAs+mediate+the+genome-wide+surveillance+of+germline+transcripts.">C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts.</a> Cell. 150 (1), 78-87 (2012).</li><li>Luteijn, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extremely+stable+Piwi-induced+gene+silencing+in+Caenorhabditis+elegans.">Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans.</a> The EMBO Journal. 31 (16), 3422-3430 (2012).</li><li>Sapetschnig, A., Sarkies, P., Lehrbach, N. J., Miska, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tertiary+siRNAs+mediate+paramutation+in+C.+elegans.">Tertiary siRNAs mediate paramutation in C. elegans.</a> PLoS Genetics. 11 (3), e1005078 (2015).</li><li>Shirayama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+initiate+an+epigenetic+memory+of+nonself+RNA+in+the+C.+elegans+germline.">piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.</a> Cell. 150 (1), 65-77 (2012).</li><li>Minkina, O., Hunter, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+heritable+germline+silencing+directs+somatic+silencing+at+an+endogenous+locus.">Stable heritable germline silencing directs somatic silencing at an endogenous locus.</a> Molecular Cell. 65 (4), 659-670 (2017).</li><li>Seroussi, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+epigenetic+regulation+by+C.+elegans+nuclear+RNA+interference+pathways.">Mechanisms of epigenetic regulation by C. elegans nuclear RNA interference pathways.</a> Seminars in Cell &amp; Developmental Biology. 127, 142-154 (2022).</li><li>Lev, I., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H3K9me3+is+required+for+inheritance+of+small+RNAs+that+target+a+unique+subset+of+newly+evolved+genes.">H3K9me3 is required for inheritance of small RNAs that target a unique subset of newly evolved genes.</a> eLife. 8, e40448 (2019).</li><li>Woodhouse, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifiers+SET-25+and+SET-32+are+required+for+establishment+but+not+long-term+maintenance+of+transgenerational+epigenetic+inheritance.">Chromatin modifiers SET-25 and SET-32 are required for establishment but not long-term maintenance of transgenerational epigenetic inheritance.</a> Cell Reports. 25 (8), 2259-2272 (2018).</li><li>Houri-Zeevi, L., Teichman, G., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stress+resets+ancestral+heritable+small+RNA+responses.">Stress resets ancestral heritable small RNA responses.</a> eLife. 10, e65797 (2021).</li><li>Houri-Ze'evi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+tunable+mechanism+determines+the+duration+of+the+transgenerational+small+RNA+inheritance+in+C.+elegans.">A tunable mechanism determines the duration of the transgenerational small RNA inheritance in C. elegans.</a> Cell. 165 (1), 88-99 (2016).</li><li>Spracklin, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RNAi+inheritance+machinery+of+Caenorhabditis+elegans.">The RNAi inheritance machinery of Caenorhabditis elegans.</a> Genetics. 206 (3), 1403-1416 (2017).</li><li>Perales, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenerational+epigenetic+inheritance+is+negatively+regulated+by+the+HERI-1+chromodomain+protein.">Transgenerational epigenetic inheritance is negatively regulated by the HERI-1 chromodomain protein.</a> Genetics. 210 (4), 1287-1299 (2018).</li><li>Shukla, A., Perales, R., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+coordinate+poly(UG)+tailing+to+prevent+aberrant+and+perpetual+gene+silencing.">piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing.</a> Current Biology. 31 (20), 4473-4485 (2021).</li><li>Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse+GeneticsWormBook:+the+Online+Review+of+C.+elegans+Biology.">Reverse GeneticsWormBook: the Online Review of C. elegans Biology.</a> WormBook. , (2006).</li><li>Rivera Gomez, K., Schvarzstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization+of+nematodes+for+live+imaging+using+an+agarose+pad+produced+with+a+Vinyl+Record.">Immobilization of nematodes for live imaging using an agarose pad produced with a Vinyl Record.</a> microPublication Biology. 2018, (2018).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+C.+elegans.">Maintenance of C. elegans.</a> WormBook: The Online Review of C. Elegans Biology. , 1-11 (2006).</li><li>Askjaer, P., Ercan, S., Meister, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modern+techniques+for+the+analysis+of+chromatin+and+nuclear+organization+in+C.+elegans.">Modern techniques for the analysis of chromatin and nuclear organization in C. elegans.</a> WormBook: the Online Review of C. elegans Biology. , 1-35 (2014).</li><li>Gu, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+siRNA+in+Caenorhabditis+elegans+generates+a+transgenerational+sequence-targeted+histone+H3+lysine+9+methylation+footprint.">Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.</a> Nature Genetics. 44 (2), 157-164 (2012).</li><li>Kalinava, N., Ni, J. Z., Peterman, K., Chen, E., Gu, S. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoupling+the+downstream+effects+of+germline+nuclear+RNAi+reveals+that+H3K9me3+is+dispensable+for+heritable+RNAi+and+the+maintenance+of+endogenous+siRNA-mediated+transcriptional+silencing+in+Caenorhabditis+elegans.">Decoupling the downstream effects of germline nuclear RNAi reveals that H3K9me3 is dispensable for heritable RNAi and the maintenance of endogenous siRNA-mediated transcriptional silencing in Caenorhabditis elegans.</a> Epigenetics &amp; Chromatin. 10, 6 (2017).</li><li>Kalinava, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=elegans+heterochromatin+factor+SET-32+plays+an+essential+role+in+transgenerational+establishment+of+nuclear+RNAi-mediated+epigenetic+silencing.">elegans heterochromatin factor SET-32 plays an essential role in transgenerational establishment of nuclear RNAi-mediated epigenetic silencing.</a> Cell Reports. 25 (8), 2273-2284 (2018).</li><li>Lev, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MET-2-dependent+H3K9+methylation+suppresses+transgenerational+small+RNA+inheritance.">MET-2-dependent H3K9 methylation suppresses transgenerational small RNA inheritance.</a> Current Biology. 27 (8), 1138-1147 (2017).</li><li>Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G., Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effectiveness+of+specific+RNA-mediated+interference+through+ingested+double-stranded+RNA+in+Caenorhabditis+elegans.">Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans.</a> Genome Biology. 2 (1), (2001).</li><li>Xu, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cytoplasmic+Argonaute+protein+promotes+the+inheritance+of+RNAi.">A cytoplasmic Argonaute protein promotes the inheritance of RNAi.</a> Cell Reports. 23 (8), 2482-2494 (2018).</li><li>Grishok, A., Tabara, H., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+requirements+for+inheritance+of+RNAi+in+C.+elegans.">Genetic requirements for inheritance of RNAi in C. elegans.</a> Science. 287 (5462), 2494-2497 (2000).</li><li>Houri-Zeevi, L., Korem Kohanim, Y., Antonova, O., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+rules+explain+transgenerational+small+RNA+inheritance+in+C.+elegans.">Three rules explain transgenerational small RNA inheritance in C. elegans.</a> Cell. 182 (5), 1186-1197 (2020).</li><li>Burton, N. O., Burkhart, K. B., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+RNAi+maintains+heritable+gene+silencing+in+Caenorhabditis+elegans.">Nuclear RNAi maintains heritable gene silencing in Caenorhabditis elegans.</a> Proceedings of the National Academy of Sciences. 108 (49), 19683-19688 (2011).</li><li>Mao, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Nrde+pathway+mediates+small-RNA-directed+histone+H3+lysine+27+trimethylation+in+Caenorhabditis+elegans.">The Nrde pathway mediates small-RNA-directed histone H3 lysine 27 trimethylation in Caenorhabditis elegans.</a> Current Biology. 25 (18), 2398-2403 (2015).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Research. 22 (9), 1813-1831 (2012).</li><li>Mukhopadhyay, A., Deplancke, B., Walhout, A. J. M., Tissenbaum, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+(ChIP)+coupled+to+detection+by+quantitative+real-time+PCR+to+study+transcription+factor+binding+to+DNA+in+Caenorhabditis+elegans.">Chromatin immunoprecipitation (ChIP) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA in Caenorhabditis elegans.</a> Nature Protocols. 3 (4), 698-709 (2008).</li></ol>

يؤكد جميع المؤلفين أنه ليس لديهم أي تعارضات للكشف عنها.

في هذا البروتوكول ، يتم إدخال dsRNA عن طريق التغذية ، والتي أصبحت طريقة قياسية في C. elegans18. بالنسبة لمقايسات وراثة RNAi ، يوفر نهج التغذية طريقة سهلة للحصول على عدد كبير من السكان P02،11،12،22،23،24،25. ومع ذلك ، فإن توقيت ومدة التعرض للحمض النووي الريبي يؤثر على فعالية إسكات الجيناتالمحورة 26 ، ويؤثر تركيز بكتيريا RNAi على استمرار إسكات RNAi الوراثي1. لذلك ، تعد بكتيريا RNAi الموحدة ونمو الديدان مهمة للحصول على مستوى ثابت من إسكات GFP ومدة الميراث. هنا ، يتم طلاء الأجنة على ألواح RNAi بحيث تتعرض P0 لبكتيريا RNAi من الفقس. قامت الأساليب البديلة بطلاء المرحلة L1 24,27 أوL4 25 المتزامنة على ألواح RNAi-NGM. بالإضافة إلى ذلك ، نظرا لأن الجوع والضغوط الأخرى تؤثر على الحفاظ على وراثة RNAi13 ، يجب مراقبة اللوحات لمنع الاكتظاظ واستنفاد الإمدادات الغذائية. كبديل لبدء RNAi عن طريق التغذية ، فإن بعض دراسات وراثة C. elegans RNAi الرائدة تحفز RNAi من خلال حقن الغدد التناسلية ، مما يوفر تحكما أكبر في تركيز dsRNA 1,28.
في هذا البروتوكول ، يتم تمرير كل جيل كمجموعة سكانية مع معالجة هيبوكلوريت قلوية ، كما هو موضح سابقا16،22،23،24. تضمن معالجة هيبوكلوريت عدم تلوث جيل F1 ببكتيريا RNAi من البيئة الأبوية22 ويمنع اختناق الزجاجة غير المرغوب فيه من السكان. ومع ذلك ، قد يكون المرور الجماعي أيضا قيدا ، نظرا لأن الفردية قد يكون لها أنماط وراثة مميزة 1,29. طريقة بديلة لإنشاء كل جيل هي اختيار الفردية1،2،9،11،25. يسمح هذا النهج بتتبع الأنماط الظاهرية داخل الأنساب ودمج التهجينات الجينية. قد يكون تحليل النسب مفيدا أيضا للأنماط الظاهرية منخفضة الاختراق12.
تعبير البروتين الفلوري هو قراءة قوية ومريحة للإسكات الناجم عن الحمض النووي الريبي2،3،4،12،14،15،16،25،30. كما هو موضح في هذا البروتوكول ، يمكن تسجيل تعبير GFP يدويا ك ON أو OFF 11،12،15،16،25. يمكن تحسين التسجيل اليدوي بشكل أكبر من خلال تعيين مستويات الكثافة النوعية3،4،14. بدلا من ذلك ، يمكن أن يوفر تسجيل الكثافة الآلي للصور المجهرية11،12،14،25،27 أو قياس مضان التدفق الخلوي للحيوانات الحية2 قراءة كمية وعالية الإنتاجية. ومع ذلك ، نظرا لأن تعبير المراسل يقتصر على الخط الجرثومي ، فإن التحذير من الأساليب الآلية هو أنه يجب عليهم أيضا التمييز بين ذات التعبير الصامت ل GFP مقابل التي ليس لها خط جرثومي ، خاصة إذا كانت الدراسة تتضمن طفرات ذات تطور غير طبيعي للخط الجرثومي. كبديل لفلورة GFP ، يمكن استخدام النسخ العكسي (RT) -qPCR لتحديد مستويات RNAi المستهدفة قبل mRNA و mRNA2،16،23،24. يوفر هذا النهج قراءة أكثر مباشرة للإسكات ، والتي تستهدف الحمض النووي الريبي ، وهي مفيدة بشكل خاص لأهداف RNAi الأخرى حيث لا ينتج عن الإسكات نمط ظاهري مرئي. يتمثل أحد قيود استخدام مراسلي GFP المصطنعين في أن التسلسلات الخارجية والداخلية يتم تنظيمها بشكل تفاضلي في RNAi11 عبر الأجيال. لذلك ينبغي اعتبار الدراسات ذات الأهداف الداخلية ، مثل الأليل الجنيني المميت الحساس للحرارة oma-1 (zu405) 1،11،16،25 ، نهجا تكميليا لمراسلي الجينات المحورة الفلورية.
يتطلب تحليل ChIP في سياق مقايسات وراثة RNAi مقارنة بين العلاجات والتكرارات. أولا ، لحساب الاختلافات في المواد الأولية بين العينات ، يتم تطبيع إشارة ChIP إلى إشارة الإدخال في نفس موضع "النسبة المئوية للإدخال". ستساعد معالجة هيستون H3 ChIP بالتوازي على تحديد ما إذا كانت أي تغييرات في تعديل هيستون تتوافق مع التغيرات في كثافة النيوكليوسوم. بالإضافة إلى ذلك ، نظرا لأن ChIP عملية متعددة الخطوات ، فقد تختلف الكفاءة بين العينات. يعد اختيار مواقع التحكم الإيجابية والسلبية المناسبة مفيدا لتقييم ومقارنة نسبة الإشارة إلى الضوضاء بين العينات والتجارب. بالإضافة إلى ذلك ، لتسهيل المقارنات بين العينات ، غالبا ما يتم تسوية قيم دورة عتبة ChIP DNA qPCR عند هدف RNAi إلى موضع التحكم3،11،15،23،30،31. لتقييم آثار علاج RNAi ، تتم أيضا مقارنة نسبة إشارة ChIP في علاج RNAi مقابل التحكم أو عدم وجود شروط RNAi. يتمثل أحد قيود النهج الحالي في أن ChIP يتم إجراؤه مع كاملة ، في حين أن الاستجابة لعلاج RNAi قد تكون فريدة من نوعها بالنسبة للخط الجرثومي. تتمثل إحدى طرق التغلب على هذا التحذير في إجراء ChIP باستخدام نوى الخط الجرثومي المعزولة. كما تمت مناقشة اعتبارات فنية إضافية لتحسين ChIP على نطاق واسع في مكان آخر32,33.
بشكل عام ، يوفر وراثة RNAi وبروتوكول ChIP أساسا مفصلا وسهل التكيف يمكن دمجه مع تقنيات أخرى لمواصلة استكشاف التنظيم اللاجيني عبر الأجيال. على سبيل المثال ، يمكن إنشاء مكتبات تسلسل عالية الإنتاجية من ChIP DNA (ChIP-seq) للحصول على عرض أكثر تفصيلا لمشهد الكروماتين القريب من هدف RNAi وعلى نطاق واسع للجينوم.

تسمح الوراثة اللاجينية بنقل المعلومات التنظيمية الجينية عبر الأجيال ، وبالتالي يمكن أن تسمح للبيئة أو تجارب الوالدين بالتأثير على ذريتهم. في C. elegans ، يمكن توريث إسكات الجينات الجرثومية الذي بدأه الحمض النووي الريبي الخارجي المزدوج (dsRNA) لأجيال متعددة في ذرية غير معرضة للمحفز الأصلي1،2،3،4. هذه العملية ، التي تسمى وراثة تداخل الحمض النووي الريبي (RNAi) ، هي واحدة من العديد من ظواهر الإسكات اللاجينية ذات الصلة في C. elegans ، بما في ذلك الإسكات متعدد الأجيال الذي بدأه piRNA 2,5 ، والطفرة / RNAe (الإسكات اللاجيني الناجم عن الحمض النووي الريبي)6،7،8 ، والإسكات متعدد النسخ الذي بدأهالصفيف 9 ، والتي لها متطلبات متداخلة ولكنها متميزة لآلات تنظيم الحمض النووي الريبي والكروماتين الصغيرة . في C. elegans RNAi الخارجي ، تتم معالجة dsRNA إلى RNAs صغيرة متداخلة (siRNAs) تعمل في مركب مع بروتينات Argonaute الأولية للتعرف على mRNA المستهدف. يؤدي هذا الاستهداف إلى تضخيم siRNAs الثانوية التي ترتبط ب Argonautes الثانوية لإسكات mRNA المستهدفة من خلال مسارات الإسكات السيتوبلازمية والنووية. بالنسبة لأهداف RNAi المعبر عنها بالخط الجرثومي ، يستهدف Argonaute HRDE-1 الثانوي النووي وعوامل RNAi النووية الإضافية النسخ الوليدة ، مما يؤدي إلى قمع النسخ وتجنيد ميثيل ترانسفيراز هيستون لترسيب علامات الكروماتين القمعية ، بما في ذلك H3K9me310. يعزز Histone H3K9me3 إنشاء إسكات وراثي لجينات التحوير البروتينية الفلورية الخضراء المعبر عنها (GFP) عن طريق وراثة RNAi11,12.
الهدف من هذا البروتوكول هو استخدام جين محوري يعبر عن بروتين اندماج GFP-histone في الخط الجرثومي كمراسل لوراثة RNAi وفحص التغييرات في تعديلات الهستون في موضع التحوير الجيني المراسل باستخدام الترسيب المناعي للكروماتين وتفاعل البلمرة المتسلسل الكمي (ChIP-qPCR). يصف هذا البروتوكول نهج تغذية RNAi موحد قائم على الألواح لبدء إسكات المراسلين. كما يوفر جدولا زمنيا مفصلا لتمرير بين الأجيال عن طريق عزل الأجنة في الرحم عن البالغين الجاذبين عن طريق العلاج القلوي بهيبوكلوريت ("التبييض"). كما تم وصف الطرق والبيانات التمثيلية لرصد تواتر إسكات GFP في مجموعة فرعية من السكان بواسطة المجهر الفلوري وللهيستون H3K9me3 ChIP-qPCR. توفر مقايسات وراثة RNAi المستندة إلى المراسلين نظاما قابلا للتتبع للغاية لتشريح أدوار العوامل الوراثية والبيئية وظيفيا في التنظيم اللاجيني 13,14 ، وقد حددت الشاشات الجينية التي تستخدم مثل هؤلاء المراسلين كلا من الجينات المطلوبة ل 2,3,15 والجينات التي تنظمسلبا 16,17 مدة الوراثة اللاجينية عبر الأجيال.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Agarose</td>
			<td>Bioshop</td>
			<td>AGA002</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Bioshop</td>
			<td>AMP201</td>
			<td>Make a 100 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Anti-H3K9me3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab8898</td>
			<td>Concentration is batch-dependent (0.9 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Anti-Histone H3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab1791</td>
			<td>Concentration is batch-dependent (0.7 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Bleach (6% Sodium hypochlorite)</td>
			<td>Lavo</td>
			<td>02358107</td>
			<td></td>
		</tr>
		<tr>
			<td>C. elegans strain with GFP RNAi Reporter</td>
			<td>NA</td>
			<td>SX1263</td>
			<td>Sapetschnig et al. 2015 (ref. 7). A gift from E. Miska lab, University of Cambridge.</td>
		</tr>
		<tr>
			<td>Carbenicillin</td>
			<td>BioShop</td>
			<td>CAR544</td>
			<td>Make a 25 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Dynabeads Protein G Magnetic Beads</td>
			<td>Invitrogen</td>
			<td>10003D</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain HT115(DE3)</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>HT115(DE3)</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain OP50-1</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>OP50-1</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (0.5 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence Stereoscope</td>
			<td>Zeiss</td>
			<td>Axio Zoom.V16</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde (37%)</td>
			<td>Sigma</td>
			<td>F8775</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Sigma</td>
			<td>50046</td>
			<td>Make a 1.25 M solution and store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>HEPES-KOH (1 M, pH 7.5)</td>
			<td>Teknova</td>
			<td>H1035</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrophobic Printed Slides, 10 wells</td>
			<td>VWR</td>
			<td>100488-904</td>
			<td></td>
		</tr>
		<tr>
			<td>IGEPAL CA-630 (Octylphenol ethoxylate)</td>
			<td>BioShop</td>
			<td>NON999</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
		<tr>
			<td>IPTG (Isopropyl-&#946;-D-thiogalactoside)</td>
			<td>BioShop</td>
			<td>IPT001</td>
			<td>Make a 0.2 g/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>1725122</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar Plates supplemented with 100 &#181;g/mL Ampicillin</td>
			<td>NA</td>
			<td>NA</td>
			<td>Standard lab recipe.</td>
		</tr>
		<tr>
			<td>Levamisole (Tetramisole hydrochloride)</td>
			<td>Sigma</td>
			<td>L9756</td>
			<td>Make a 200 mM solution in ultrapure water. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>LiCl (8 M)</td>
			<td>Sigma</td>
			<td>L7026</td>
			<td></td>
		</tr>
		<tr>
			<td>M9 Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>22 mM KH2PO4, 42 mM Na2HPO4, 86 mM NaCl, 1 mM MgSO4.</td>
		</tr>
		<tr>
			<td>Magnetic Separator (1.5 mL tubes)</td>
			<td>Applied Biosystems</td>
			<td>A13346</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Separator (0.2 mL tubes)</td>
			<td>Permagen</td>
			<td>MSR812</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Cover Glass</td>
			<td>Fisher Scientific</td>
			<td>12541B</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Slide</td>
			<td>Technologist Choice</td>
			<td>LAB-037</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl (5 M)</td>
			<td>Promega</td>
			<td>V4221</td>
			<td>For ChIP buffers.</td>
		</tr>
		<tr>
			<td>NaOH&#160;</td>
			<td>Sigma</td>
			<td>S5881</td>
			<td>Make a 10 M solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>NGM Plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#956;g/mL cholesterol, 25 mM Potassium phosphate pH 6.0, 1 mM MgSO4, 50 &#181;g/mL streptomycin.</td>
		</tr>
		<tr>
			<td>Normal Rabbit IgG (1 mg/mL)</td>
			<td>Cell Signaling Technology</td>
			<td>2729</td>
			<td></td>
		</tr>
		<tr>
			<td>Petri Dishes (35 mm x 10 mm)</td>
			<td>Sarstedt</td>
			<td>82.1135.500</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (10X)</td>
			<td>Fisher BioReagents</td>
			<td>BP3991</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - Control RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4440 (Plasmid #1654)</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - GFP-targetting RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4417 (Plasmid #1649)</td>
			<td>Note, alternative L4440-derived plasmids targeting GFP can be used.</td>
		</tr>
		<tr>
			<td>Primer pair [-3.3 kb upstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: AAACCAAAGGACGAGAGATTCA, R: GGCTCGATCAAGTAAAATTTCG</td>
		</tr>
		<tr>
			<td>Primer pair [+1.3 kb downstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TCGACCAGTTCTAAAGTCACCG, R: ACGTGCGGGATCATTTCTTACT</td>
		</tr>
		<tr>
			<td>Primer pair [clec-18]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TGCTCCATGACCTCAACAACA, R: AGTACAGTTCACCGATCCAGA</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 1]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CTGGAGTTGTCCCAATTCTTGT, R: GGGTAAGTTTTCCGTATGTTGC</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 4]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: GATGGCCCTGTCCTTTTACCA, R: ATGCCATGTGTAATCCCAGCA</td>
		</tr>
		<tr>
			<td>Primer pair [hrp-2]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CGTCAACAGGGAGCAGCTG, R: CCTCCGAACTTTCTCTGTCCA</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail Tablet</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K&#160;</td>
			<td>Bioline</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit&#160;</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>Real-Time PCR Detection System</td>
			<td>Bio-Rad</td>
			<td>CFX96&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAi-NGM plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#181;g/mL cholesterol, 25 mM Potassium phosphate buffer pH 6.0, 1 mM MgSO4, 25 &#181;g/mL carbenicillin and 5 mM IPTG.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>Sigma</td>
			<td>R4642</td>
			<td></td>
		</tr>
		<tr>
			<td>Sarkosyl (N-Lauroylsarcosine sodium salt)</td>
			<td>Sigma</td>
			<td>L5777</td>
			<td>Make a 10% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Sigma</td>
			<td>74255</td>
			<td>Make a 10% (w/v) solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>Sodium deoxycholate</td>
			<td>Sigma</td>
			<td>30970</td>
			<td>Make a 5% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>Sonication Tube</td>
			<td>Evergreen</td>
			<td>214-3721-010</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonication Tube Cap</td>
			<td>Evergreen</td>
			<td>300-2911-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Qsonica</td>
			<td>Q800R3-110</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptomycin sulfate</td>
			<td>Bioshop</td>
			<td>STP101</td>
			<td>Make a 50 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>TAE buffer (1X)</td>
			<td>NA</td>
			<td>NA</td>
			<td>40 mM Tris, 20 mM acetate, 1 mM EDTA</td>
		</tr>
		<tr>
			<td>Tally counter clicker</td>
			<td>Uline</td>
			<td>H-7350</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Bioshop</td>
			<td>TET701</td>
			<td>Make a 5 mg/mL solution in ethanol and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>Eppendorf</td>
			<td>05-400-205</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl (1 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15568025</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma</td>
			<td>T8787</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
	</tbody>
</table>

analysis of transgenerational epigenetic inheritance in c. elegans using a fluorescent reporter and chromatin immunoprecipitation (chip)

يسمح الوراثة اللاجينية عبر الأجيال (TEI) بنقل المعلومات عبر الخط الجرثومي دون تغيير تسلسل الجينوم ، من خلال عوامل مثل الحمض النووي الريبي غير المشفر وتعديلات الكروماتين. تعد ظاهرة وراثة تداخل الحمض النووي الريبي (RNAi) في الديدان الخيطية Caenorhabditis elegans نموذجا فعالا للتحقيق في TEI يستفيد من دورة الحياة القصيرة لهذا الكائن النموذجي ، والتكاثر الذاتي ، والشفافية. في وراثة RNAi ، يؤدي تعرض ل RNAi إلى إسكات الجينات وتغيير توقيعات الكروماتين في الموقع المستهدف والتي تستمر لأجيال متعددة في غياب الزناد الأولي. يصف هذا البروتوكول تحليل وراثة الحمض النووي الريبي في C. elegans باستخدام مراسل بروتين الفلورسنت الأخضر النووي المعبر عنه بالخط الجرثومي (GFP). يبدأ إسكات المراسل عن طريق إطعام البكتيريا التي تعبر عن الحمض النووي الريبي المزدوج الذي يستهدف GFP. في كل جيل ، يتم تمرير للحفاظ على التطور المتزامن ، ويتم تحديد إسكات الجينات المراسل عن طريق الفحص المجهري. في أجيال مختارة ، يتم جمع السكان ومعالجتهم من أجل الترسيب المناعي للكروماتين (ChIP) - تفاعل البلمرة المتسلسل الكمي (qPCR) لقياس إثراء تعديل الهستون في موقع مراسل GFP. يمكن تعديل هذا البروتوكول لدراسة وراثة الحمض النووي الريبي بسهولة ودمجه مع تحليلات أخرى لمزيد من التحقيق في عوامل TEI في مسارات الحمض النووي الريبي والكروماتين الصغيرة.

Epigenetic inheritance allows the transmission of gene regulatory information across generations and can therefore allow the environment or experiences of parents to affect their progeny. In C. elegans, germline gene silencing initiated by exogenous double-stranded RNA (dsRNA) can be inherited for multiple generations in progeny not exposed to the original trigger1,2,3,4. This process, termed RNA interference (RNAi) inheritance, is one of several related epigenetic silencing phenomena in C. elegans, including piRNA-initiated multigenerational silencing2,5, paramutation/RNAe (RNA-induced epigenetic silencing)6,7,8, and multicopy array-initiated silencing9, which have overlapping but distinct requirements for small RNA and chromatin regulation machinery. In C. elegans exogenous RNAi, dsRNA is processed into small interfering RNAs (siRNAs) that act in a complex with primary Argonaute proteins to recognize their target mRNA. This targeting leads to the amplification of secondary siRNAs that associate with secondary Argonautes to silence target mRNA through both cytoplasmic and nuclear silencing pathways. For germline-expressed RNAi targets, the nuclear secondary Argonaute HRDE-1 and additional nuclear RNAi factors target nascent transcripts, resulting in transcriptional repression and recruitment of histone methyltransferases to deposit repressive chromatin marks, including H3K9me310. Histone H3K9me3 promotes the establishment of heritable silencing of germline-expressed green fluorescent protein (GFP) transgenes by RNAi inheritance11,12.
The goal of this protocol is to use a transgene expressing a GFP-histone fusion protein in the germline as a reporter for RNAi inheritance and to assay changes in histone modifications at the reporter transgene locus using chromatin immunoprecipitation and quantitative polymerase chain reaction (ChIP-qPCR). This protocol describes a standardized plate-based RNAi feeding approach to initiate reporter silencing. It also provides a detailed timeline for passaging animals between generations by isolating in utero embryos from gravid adults by alkaline hypochlorite treatment (&#39;bleaching&#39;). Methods and representative data for monitoring the frequency of GFP silencing in a subset of the population by fluorescence microscopy and for histone H3K9me3 ChIP-qPCR are also described. Reporter-based RNAi inheritance assays provide a highly tractable system to functionally dissect the roles of genetic and environmental factors in epigenetic regulation13,14, and genetic screens using such reporters have identified both genes that are required for2,3,15 and genes that negatively regulate16,17 the duration of transgenerational epigenetic inheritance.

تسليط الضوء على المؤلف: وراثة RNAi و ChIP في C. elegans 

تحليل الوراثة اللاجينية عبر الأجيال في C. elegans باستخدام مراسل الفلورسنت والترسيب المناعي للكروماتين (ChIP)

Research in our lab examines how chromatin-associated proteins, histone modifications, and small RNA pathway factors work together in the context of development and transgenerational epigenetic inheritance. The RNA inheritance assay, using a GFP reporter, has become a very powerful tool. This protocol describes how to standardize the preparation, scoring, and passaging of worms, and the preparation of ChIP samples, which can help to generate reproducible results.One of the experimental challenges when studying germline-expressed transgenes is isolating the effects in the animal's germline. We're currently using whole animals for ChIP, but in the future we would like to develop assays to examine chromatin, specifically in the germline. Our laboratory is interested in histone methylation and proteins that recognize these marks.Going forward, we would like to investigate the interplay between these chromatin readers and small RNA pathways in the context of RNAi inheritance at transgenes and the regulation of endogenous sequences.

تعرضت التي تحمل الخط الجرثومي المعبر عنه GFP-histone H2B [mex-5p::gfp-h2b::tbb-2 3'UTR]7 مراسل (الشكل 2A) إلى GFP RNAi أو التحكم في RNAi عن طريق التغذية ، وتم تمريرها كما هو موضح في البروتوكول والشكل 1. تم تسجيل إشارة GFP النووية في الخط الجرثومي يدويا باستخدام مجهر تشريح مضان لعينة من السكان في كل جيل. كان إسكات جين التحوير مخترقا بالكامل في P0 و F1 التي تم تسجيلها والتي عولجت ب GFP RNAi (الشكل 2B). في جيل F2 ، كانت نسبة السكان الذين يظهرون ميراث إسكات GFP حوالي 50٪. بحلول جيل F5 ، لم تظهر غالبية السكان وراثة الإسكات ، وبحلول جيل F10 ، لم يتم اكتشاف أي ميراث ، حيث عبرت جميع عن GFP.
لتحديد التغير في تخصيب هيستون H3K9me3 المقابل للإسكات الناجم عن RNAi ، تم إجراء ChIP-qPCR على الجيل F1 بعد إما GFP RNAi أو التحكم في علاج RNAi. كما هو متوقع ، أظهر السكان المعالجون ب GFP RNAi مستويات هيستون H3K9me3 أعلى عند هدف GFP وفي منطقة المصب 1.3 كيلو بايت مقارنة بالحيوانات المعالجة ب RNAi (الشكل 2C). يتم دعم خصوصية هيستون H3K9me3 ChIP من خلال التخصيب في موضع التحكم الإيجابي (clec-18) المعروف أنه غني في هذه العلامة ، ولكن ليس في موضع تحكم سلبي قريب (hrp-2). كما تم الكشف عن تخصيب هيستون H3 والتخصيب القريب من الخلفية في الترسبات المناعية للتحكم في IgG في جميع مواقع qPCR ، كما هو متوقع. عندما يتم تطبيع تخصيب ChIP في المراسل إلى موضع التحكم الإيجابي clec-18 ، يتم عرض إثراء هيستون H3K9me3 أعلى على GFP RNAi ، في حين أن تخصيب هيستون H3 مشابه بين التحكم وعلاجات GFP RNAi (الشكل 2D). نظرا لأنه من غير المتوقع أن يؤثر GFP RNAi على هيستون H3K9me3 أو إجمالي إشغال هيستون H3 في موضع clec-18 ، فإن هذا التطبيع يخفف من الاختلاف الفني ، مثل الاختلافات في كفاءة ChIP بين عينات GFP RNAi وعينات التحكم RNAi. يظهر تغيير الطي لمستويات هيستون H3K9me3 وهيستون H3 بين علاجات RNAi إثراء هيستون H3K9me3 الخاص بمراسل GFP ، بغض النظر عن إشغال الهستون ، عند إسكات GFP RNAi الناجم عن (الشكل 2E).
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65285/65285fig02.jpg"> الشكل 2: يتوافق الإسكات الناجم عن GFP RNAi مع ارتفاع تخصيب H3K9me3 عند هدف RNAi. (أ) رسم تخطيطي لمراسل GFP RNAi المعبر عنه بالخط الجرثومي mjIs134 [mex-5p::gfp-h2b::tbb-2 3'UTR] مع تمييز مناطق amplicon qPCR. (ب) سجل تعبير GFP عبر الأجيال بعد علاجات RNAi عند 21 درجة مئوية. تمثل أشرطة الخطأ الانحراف المعياري عن نسختين بيولوجيتين. (ج) ChIP-qPCR من H3K9me3 ، هيستون H3 ، والتحكم IgG في F1 الشباب من اثنين من النسخ البيولوجية المتماثلة. clec-18 و hrp-2 هما مواضع التحكم الإيجابية والسلبية لتخصيب H3K9me3 ، على التوالي. (د) تم تطبيع تخصيب H3K9me3 وهيستون H3 في مراسل GFP RNAi إلى موضع التحكم الإيجابي clec-18. (ه) التغير في تخصيب H3K9me3 وهيستون H3 بين GFP RNAi- المعالجة بالحمض النووي الريبي الضابط ، مع التطبيع إلى clec-18. يمثل الخط المنقط تغييرا في الطي بمقدار 1. <a href="https://www.jove.com/files/ftp_upload/65285/65285fig02large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>

Watch this Scientific Journal Video about RNAi Inheritance and ChIP in C. elegans at JoVE.com

يصف هذا البروتوكول تداخل الحمض النووي الريبي ومقايسة ChIP لدراسة الوراثة اللاجينية للإسكات الناجم عن الحمض النووي الريبي وتعديلات الكروماتين المرتبطة به في C. elegans.

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through ...

يفحص البحث في مختبرنا كيفية عمل البروتينات المرتبطة بالكروماتين وتعديلات الهستون وعوامل مسار الحمض النووي الريبي الصغيرة معا في سياق التطور والوراثة اللاجينية عبر الأجيال. أصبح اختبار وراثة الحمض النووي الريبي ، باستخدام مراسل GFP ، أداة قوية للغاية. يصف هذا البروتوكول كيفية توحيد إعداد الديدان وتسجيلها وتمريرها ، وإعداد عينات ChIP ، والتي يمكن أن تساعد في توليد نتائج قابلة للتكرار.أحد التحديات التجريبية عند دراسة جينات التحوير المعبر عنها بالخط الجرثومي هو عزل التأثيرات في الخط الجرثومي للحيوان. نحن نستخدم حاليا كاملة ل ChIP ، ولكن في المستقبل نود تطوير فحوصات لفحص الكروماتين ، وتحديدا في الخط الجرثومي. يهتم مختبرنا بمثيلة الهستون والبروتينات التي تتعرف على هذه العلامات.من الآن فصاعدا ، نود التحقيق في التفاعل بين قارئات الكروماتين هذه ومسارات الحمض النووي الريبي الصغيرة في سياق وراثة RNAi في جينات التحوير وتنظيم التسلسلات الداخلية.

analysis-transgenerational-epigenetic-inheritance-c-elegans-using

Research

JoVE Journal

Genetics

Analysis of Transgenerational Epigenetic Inheritance in C. elegans Using a Fluorescent Reporter and Chromatin Immunoprecipitation (ChIP)

1.6K Views.  University of Toronto. يفحص البحث في مختبرنا كيفية عمل البروتينات المرتبطة بالكروماتين وتعديلات الهستون وعوامل مسار الحمض النووي الريبي الصغيرة معا في سياق التطور والوراثة اللاجينية عبر الأجيال. أصبح اختبار وراثة الحمض النووي الريبي ، باستخدام مراسل GFP ، أداة قوية للغاية. يصف هذا البروتوكول كي...

Video: تسليط الضوء على المؤلف: وراثة RNAi و ChIP في C. elegans 

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through factors such as non-coding RNAs and chromatin modifications. The phenomenon of RNA interference (RNAi) inheritance in the nematode Caenorhabditis elegans is an effective model to investigate TEI that takes advantage of this model organism's short life cycle, self-propagation, and transparency. In RNAi inheritance, exposure of animals to RNAi leads to gene silencing and altered chromatin signatures at the target locus that persist for multiple generations in the absence of the initial trigger. This protocol describes the analysis of RNAi inheritance in C. elegans using a germline-expressed nuclear green fluorescent protein (GFP) reporter. Reporter silencing is initiated by feeding the animals bacteria expressing double-stranded RNA targeting GFP. At each generation, animals are passaged to maintain synchronized development, and reporter gene silencing is determined by microscopy. At select generations, populations are collected and processed for chromatin immunoprecipitation (ChIP)-quantitative polymerase chain reaction (qPCR) to measure histone modification enrichment at the GFP reporter locus. This protocol for studying RNAi inheritance can be easily modified and combined with other analyses to further investigate TEI factors in small RNA and chromatin pathways.

This protocol describes an RNA interference and ChIP assay to study the epigenetic inheritance of RNAi-induced silencing and associated chromatin modifications in C. elegans.

Bleaching and Plating Caenorhabditis elegans P0 Generation Embryos onto RNAi-NGM plates

Bleaching and Plating Caenorhabditis elegans P0 Generation Embryos onto RNAi-NGM plates  

Prepare animals for the RNAi inheritance assay by picking three or four gravid Caenorhabditis elegans adults under the 35 millimeter standard NGM plates seeded with OP50-1 bacteria. After four days, wash the gravid adult worms off the plates into 1.5 milliliter tubes using 800 microliters of M9 buffer supplemented with Triton X-100. Repeat the wash and pull the worms into one tube.After centrifuging the worms at 1, 000 G for 1.5 to two minutes, aspirate the supernatant leaving 100 microliters without disturbing the worm pellet. To each tube containing the worm pellet, add 650 microliters of double distilled water. To isolate the C.elegans embryos from the collected population, add 250 microliters of the freshly prepared bleaching solution and start a timer.Every one to two minutes, vortex the tubes thoroughly. After five minutes, monitor the degradation of adult worms under the stereoscope. Continue vortexing until the worms are completely dissolved and only embryos remain.This generally takes six to seven minutes. Immediately centrifuge the tubes at 1, 000 G for 1.5 minutes and aspirate the supernatant, leaving approximately 50 to 100 microliters of the supernatant with the embryos. Add one milliliter of M9 buffer supplemented with Triton X-100 to the embryos and vortex.Centrifuge the suspension and repeat the wash two times. After the final wash, aspirate the supernatant and leave approximately 100 microliters in the tube. Vortex the tubes with isolated embryos and pipette two microliters from each tube twice onto a labeled glass slide.Count the embryos using a tally counter to estimate the concentration of embryos per microliter. To start a semi-synchronized population growth, transfer approximately 250 embryos onto each RNAi NGM plate containing E.coli HT115 bacteria with GFP or control RNAi vectors. Allow the liquid to absorb.Incubate the P naught generation treated with RNAi for four days at 21 degrees Celsius.

التبييض والطلاء Caenorhabditis elegans P0 جيل الأجنة على لوحات RNAi-NGM

Passaging and Scoring the Caenorhabditis elegans P0 Generation for Germline GFP Expression

Passaging and Scoring the Caenorhabditis elegans P0 Generation for Germline GFP Expression  

Begin preparing the agarose pads by placing a drop of melted 1%agarose onto the vinyl record using a glass Pasteur pipet. Orient a glass slide so that the lines on the record are horizontal or vertical, and place the slide quickly onto the agarose drop for 30 seconds. Remove the glass slide from the record and add approximately five microliters of freshly prepared five millimolar levamisole under the stereoscope.Gently flick the tube containing worms and transfer 5 to 10 microliters onto the agarose pad to mount the worms. Estimate the number of worms as they are being added so that there are approximately 40 worms per replicate. Line up the worms in rows using an eyelash pick, and place a glass coverslip onto the slide.Isolate the embryos from the remaining worms using the bleaching protocol and plate 250 embryos onto 35 millimeter NGM plates seeded with OP50-1 bacteria. Under the fluorescent stereoscope, use a GFP filter set and count and record the number of GFP positive and GFP negative worms on the slides for each replicate using a tally counter. The manual scoring of the nuclear GFP signal in the germline for each generation showed that the silencing of the transgene was fully penetrant in the scored P0 and F1 worms treated with GFP RNAi.In the F2 generation, the proportion of the population exhibiting inheritance of GFP silencing was approximately 50%By the F5 generation, the majority of the population did not show the inheritance of silencing. By the F10 generation, all the worms expressed GFP and no inheritance was detected.

تمرير وتسجيل جيل Caenorhabditis elegans P0 للتعبير عن الخط الجرثومي GFP

Collection of F1 Generation Caenorhabditis elegans for Chromatin Immunoprecipitation (ChIP)

Collection of F1 Generation Caenorhabditis elegans for Chromatin Immunoprecipitation (ChIP)  

Begin by plating approximately 3, 500 C.elgans F1 generation embryos on 14 plates and allow them to grow to the young adult stage for three days at 21 degrees Celsius. Wash and collect the C.elgans into 1.5-milliliter tubes using PBS/TX. Centrifuge at 1000 G for two minutes, aspirate, and pull the worms from one strain into one tube.Repeat three washes with PBS/TX. Next, aspirate the supernatant leaving one milliliter in the tube and invert to mix. After counting the number of C.elgans worms in three microliters three times, calculate the concentration of worms and transfer a volume corresponding to 3000 worms to a new tube for formaldehyde cross-linking.

مجموعة من جيل F1 Caenorhabditis elegans لترسب الكروماتين المناعي (ChIP)

Formaldehyde Crosslinking of the F1 Generation of Caenorhabditis elegans for ChIP

Formaldehyde Crosslinking of the F1 Generation of Caenorhabditis elegans for ChIP  

Begin by adding formaldehyde to a 1.8%final concentration to the tube containing the worms and rotating the tube at room temperature for six minutes. Then immediately freeze the tubes in liquid nitrogen, and store the samples at 80 degrees Celsius. To proceed thaw the formaldehyde cross-link sample in a room temperature water bath for three minutes, and rotate the samples for 16 minutes at room temperature.At 1.25 molar glycine to a 125 millimolar final concentration, and rotate for five minutes at room temperature. Following this step, keep the samples on ice, or at four degrees, and use ice cold buffers until the magnetic bead elution. After centrifuging the sample at 1000 g for three minutes, wash it three times with one milliliter of PBSTX.Then wash it two times with one milliliter of Resuspension Buffer. After the last wash, leave enough Buffer to ensure the total volume is at least three times the pellet volume and a minimum of 100 microliters.

تشابك الفورمالديهايد لجيل F1 من Caenorhabditis elegans ل ChIP

Sonication of Formaldehyde-Crosslinked Caenorhabditis elegans and Chromatin Immunoprecipitation

Sonication of Formaldehyde-Crosslinked Caenorhabditis elegans and Chromatin Immunoprecipitation  

Begin by mixing and aliquoting 90 to 120 microliters of the formaldehyde crosslinked C.Elegans samples into a polystyrene sonication tube. Add an equal volume of resuspension buffer containing 2X detergents. Sonicate in a water bath sonicator for seven minutes.Gently mix the sample by pipetting and repeat the sonication for an additional seven minutes. Once done, transfer the sonicated lysate to a 1.5 milliliter tube. Add a half volume of resuspension buffer without detergents.After centrifugation at 13, 000 G for 15 minutes at four degrees Celsius, divide the lysate supernatant into four parts. Store the input lysate part at minus 20 degrees Celsius in a 1.5 milliliter tube. Add 0.5 micrograms of anti-H3K9 trimethylation, anti-histone H3 or IgG to the appropriate immunoprecipitation or IP sample.Incubate the reaction at four degrees Celsius overnight with rotation. The following day, aliquot the nine microliters of protein G coated magnetic beads per IP sample in a 1.5 milliliter tube. After two washes with one milliliter of FA-150, resuspend the magnetic beads in the FA-150 buffer.Once done, add 7.5 microliters of the magnetic bead suspension to each IP antibody mix before incubating the tubes at four degrees Celsius for two hours with rotation. Next, wash the magnetic beads seven times using at least 200 microliters of each buffer solution. Incubate each wash at four degrees Celsius for five minutes with rotation before collecting the beads on a magnetic stand to aspirate the wash.After aspirating the last wash of the buffer, resuspend the magnetic beads in 50 microliters of chromatin IP elution buffer, and transfer it to a 1.5 milliliter tube. After eluting the sample in a ThermoMixer, collect the beads on a magnetic stand and transfer the supernatant to a new tube. Repeat the elution with another 50 microliters of chromatin immunoprecipitation elution buffer.Once done, pull a total of 100 microliters of supernatant before proceeding with reverse cross-linking and DNA elution.