Wir danken Angelika Berg für Labor-Unterstützung. Diese Arbeit wurde von der Max-Planck-Gesellschaft und der Jena School for Microbial Communication (JSMC) unterstützt und finanziert.

1. Insekten-Aufzucht <ol><li> Kaufen oder zu erhalten Eier von Spodoptera littoralis Kupplungen von Ihrer eigenen Aufzucht. Pflegen sie in sterile Petrischalen bei Raumtemperatur (RT) bis zum Schlüpfen. </li><li> Bereiten Sie die künstliche Ernährung für die Insekten Aufzucht, wie folgt: <ol><li> Soak 500 g gemahlener weißer Bohnen über Nacht in 100 ml Wasser. </li><li> In 9,0 g Ascorbinsäure und 75 g Agar auf 1000 ml destilliertem H 2 O und danach kochen. </li><li> Ließ die Mischung abkühlen, und wenn es sich verfestigt (zu einem weißen wachsartigen Feststoff-Gemisch) lagern bei 4 ° C bis zur Verwendung. </li></ol></li><li> Übertragen Sie die frisch geschlüpften Larven in einen sauberen Plastikdose ziehen sie sie auf der künstlichen Ernährung bei 23-25 ​​° C unter einem langen Tag mit 16 Stunden Regime von Beleuchtungs-und 8 Stunden Dunkelheit. Ändern Sie das Essen jeden Tag, bis die Larven durch alle sechs Larvenstadien zu gehen. </li></ol> 2. 13 C-Markierung von DNA in metabolisch aktiven Darmbakterien <ol><li> Man löst 186,1 mg voll 13 C-markierter Glucose mit destilliertem und entionisiertem Wasser (ddH 2 O) und gut mischen mit 100 g künstliche Nahrung für die SIP-Experiment. Gewährleisten eine endgültige 13 C-Glucose-Konzentration von 10 mM in der künstlichen Ernährung. Dies ahmt die in situ Glukosekonzentration im Darm von S. littoralis Larven auf Baumwollpflanzen nach Shao et al. (eingereicht). </li><li> Über 9-15 gesunde zweiten Larvenstadium von der Aufzucht-Box, um sterile Plastikpetrischalen (eine Larve pro Petrischale) mit frischen 13 C-Glucose versetzt künstliche Ernährung. Künstliche Ernährung mit der gleichen Menge an nativer Glucose (12 C-Glukose), wie beschrieben, zum Zuführen der Kontrollgruppe. </li><li> Erneuern Sie die künstliche Ernährung häufig während der Inkubationszeit (1 Tag). Verwenden Aufzuchtbedingungen wie in Schritt 1.3. </li><li> Sammeln neun Larven aus jeder Behandlung für die spätere Verarbeitung (DNA-Extraktion). Jederreplizieren, wird von drei Personen besteht, machen mindestens drei Wiederholungen pro Behandlung. </li></ol> 3. Insekten-Dissection <ol><li> Reinigen und desinfizieren Sie die Präparationswerkzeuge zu Beginn der Arbeit mit Ethanol 70% (Extras = Vannas Schere, Pinzette und Skalpell mit feinen Einwegklingen). </li><li> Nehmen Sie die Tiere mit einem weichen Pinzette und ihre Haut waschen oberflächlich mit destilliertem Wasser. Legen sie auf Eis für mindestens 30 Minuten, um sie zu betäuben. </li><li> Während noch betäubt Ort sie bei 0 ° C für 1 Stunde um sie zu töten. Desinfizieren Sie die toten Insekten oberflächlich durch Eintauchen in Ethanol (70%) für ein paar Minuten. </li><li> Führen die Insekten Zerlegung in einem Volumen von etwa 15 ml 1x PBS auf eine sterile Petrischale (= 1 × PBS 137 mM NaCl, 2,7 mM KCl, 4,3 mM Na 2 HPO 4, 1,47 mM KH 2 PO 4 abgeschieden, der pH-Wert auf 7,4 , Autoklav). Seien Sie sicher, dass das gesamte Insektenkörper vollständig in der SOLUT tauchtIonen während der ganzen Periode Seziersaal. </li><li> Beginnen Sie mit der Präparation durch einen Einschnitt in der Haut an der rechten und linken Seite des Insekts, beginnen auf dem Kopf und endet am After. Entfernen Sie die ganze Haut, Malpighischen und fetten Körper. Ändern Sie die frische Puffer vor Aufschneiden der Darm. Abschnitt der Darm in Vorder-, Mittel-und Enddarm, wenn erforderlich. Speichern des Gewebes in den Gefrierschrank (-80 bis -20 ° C), bis die DNA-Extraktion </li></ol> 4. DNA-Extraktion und Amplifikation <ol><li> Platzieren Sie den Insekten Gewebe in einem 1,5 ml sterilen Zentrifugenröhrchen und trocknen alle Proben bei 45 ° C in einer Vakuumkonzentrationsvorrichtung. Crush getrocknet Gewebe mit einem sterilen Kunststoff Stößel. </li><li> Entpacken Sie die genomische DNA mit einem geeigneten Bodensatz für die DNA-Extraktion. Übertragen Sie die trockenen Gewebe in das Reaktionsrohr des Kits und befolgen Sie die Anweisungen, wie vom Hersteller angegeben. </li><li> Bestimmung der Konzentration des letzten eluierten DNA unter Verwendung eines Spektrophotometers. </li><li> Verifya erfolgreiche Extraktion der mikrobiellen Metagenom-DNA aus dem Insektendarm durch Herstellung eines diagnostischen PCR-Test unter Verwendung eubakteriellen allgemeinen Primer 27f (5 - AGAGTTTGATCCTGGCTCAG -3) und 1492r (5 - GGTTACCTTGTTACGACTT -3). Stellen Sie die PCR-Reaktion wie folgt: <ol><li> Set von 50 ul Reaktionsmischung, enthaltend 1x Puffer, 1,5 mM MgCl 2, 10 mM vier Desoxynucleosidtriphosphate (dNTPs), 2,5 U Taq-DNA-Polymerase, 0,5 mM von jedem Primer und 60 ng der extrahierten DNA als Matrize. </li><li> Führen Sie die PCR-Reaktionen unter Verwendung eines Thermocycler wie folgt: anfängliche Denaturierung bei 94 ° C für 3 min, gefolgt von 35 Zyklen: 94 ° C für 45 sec, Annealing bei 55 ° C für 30 sec und Verlängerung bei 72 ° C für 1 min . Verwenden eine letzte Verlängerung bei 72 ° C für 10 min. </li><li> Überprüfen Sie, ob die erfolgreiche PCR-Amplifikation in einem 1% igen Elektrophorese Ethidiumbromid (EB) gefärbten Gel (1 g Agarose in 100 ml 1x TAE-Puffer und Fleck mit 1 ul EB). Kaution 5 ul thE-PCR-Produkt + 1 ul 6x Ladefarbstoff in die Geltaschen. (1x TAE = 40 mM Tris-Base, 20 mM Essigsäure, 1 mM EDTA, auf pH 8). </li><li> Führen Sie das Gel mit 1xTAE Puffer bei 300 V, 115 mA für ca. 20 min in einem Elektrophorese-Kammer. Durch die Verwendung eines Gel-Dokumentation Kammer (UV-Transilluminator mit einer digitalen Kamera und Computer angeschlossen ist) beobachten das Gel und vergleichen Sie die Größe des Endprodukts mit der ebenfalls geladen Gen-Marker, die richtige Größe der Amplikons müssen von ca. 1,5 kb sein. </li></ol></li><li> Bewahren Sie die PCR-Produkte unter Tiefkühlbedingungen, bevorzugt -80 ° C bis zur Verwendung. </li></ol> 5. DNA-Separation-CsCl-Ultrazentrifugation <ol><li> Bereiten Sie die Reagenzien für die Gradienten für Ultrazentrifugation wie folgt: <ol><li> Vorbereitung einer 7.163 M Cäsiumchlorid (CsCl)-Lösung durch Auflösen von 603,0 allmählich g CsCl in ddH 2 O und Auffüllen auf ein Endvolumen von 500 ml. </li><li> Genau demen Sie die Dichte des hergestellten CsCl-Lösung durch Auswiegen einer 1,0-ml-Aliquot einer dreistelligen Waage mit dreifacher Ausführung. Dies reicht für gewöhnlich von 1,88 und 1,89 g / ml bei Raumtemperatur. </li><li> Vorbereitung der Gradienten-Puffer (100 mM Tris, 100 mM KCl und 1 mM EDTA) durch die Kombination von 50 ml 1 M Tris-HCl (pH 8,0), 1 ml 0,5 M EDTA (pH 8) und 3,75 g KCl in einem abschließenden Volumen von 500 ml mit ddH 2 O. Filter (0,22 um) Autoklaven sterilisieren und diese Lösung. </li></ol></li><li> DNA-Trennung <ol><li> Nach der Bestimmung der einzelnen DNA-Konzentration der behandelten Insekten, gemessen wie in Punkt 4.3, bündeln diese Insekten, die einem Replikat zusammen und normalisieren ihre DNA-Konzentration, um sicherzustellen, dass jeder an die Sammelprobe trägt gleichermaßen. Eine Endkonzentration von 500-5000 ng DNA (Messung wieder die endgültige Konzentration) ist geeignet für das Verfahren 21 Ultrazentrifugation. </li><li> Um den Gradienten Medium, kombinieren die quantifizierten DNA, Gradientenpuffer eind 4,8 ml 7,163 M CsCl-Lösung zusammen, um eine gemischte Volumen von 6,0 ml in einem sterilen 15 ml mit Schraubverschluss Rohr (Erzeugung eines Gradienten mittel-DNA-Gemisch). </li><li> Legen Sie das vorbereitete-Medium-DNA-Gemisch in ein 5,1 ml Ultrazentrifugenröhrchen (füllen, bis die Basis des Röhrenhals) mit einer Spritze und Nadel. Vermeiden Pumpen oder Luftblasen bilden. Fügen Sie mindestens ein Leerzeichen Gradienten (mit ddH2O statt DNA) in jedem Zentrifugenlauf als Referenzverlauf. </li><li> Ausgleichsrohr Paare innerhalb von 10 mg Gewicht nach jedem vorgeschriebenen Gradienten Medium in den jeweiligen Ultrazentrifugenröhrchen gefüllt. Verschließen Sie den Schlauch mit einer &quot;Tube Topper&quot; und stellen Sie sicher, dass die Dichtung leckfrei durch Umdrehen der Röhre und mit etwas Druck mit der Hand. </li><li> Verwenden Sie einen nahezu vertikalen Rotor mit acht Vertiefungen zur Aufnahme 5,1 ml Ultrazentrifugation Rohre für die Ultrazentrifugation. Sorgfältig verschließen die Rotor Brunnen und laden den Rotor in der Ultrazentrifuge nach der masteller die Anweisungen. Stellen Sie die Ultrazentrifugation Bedingungen: Schleudern bei 50.000 UpM (etwa 177.000 · g), die Temperatur bei 20 ° C und Ultrazentrifugation Laufzeit für 40 h mit Vakuum. Wählen Sie die maximale Beschleunigung und die Verzögerung ohne Bremse. </li><li> Sobald Sie fertig sind, sorgfältig die Rohre aus dem Zentrifugenrotor mit einer Pinzette entfernen. Legen Sie sie in einem Rack ohne die gebildeten Gradienten in den Rohren zu stören. Verarbeiten der Gradientenfraktionierung Proben so schnell wie möglich, jede Diffusions minimieren. </li></ol></li><li> Retrieval von DNA aus Isopyknische Getrennt Steigungen von Fraktionierung <ol><li> Einen genauen HPLC-Pumpensystem für die Durchführung der Gradientenfraktionierung, die gleichermaßen die gebildeten Gradienten aus der Ultrazentrifugenröhrchen oben Verdrängungsmethode trennt. Schließen Sie die HPLC-Pumpe (100% Durchfluss Gradient) an der Flasche mit 1 l Hubraum gefüllt ddH2O und dicht mit dem offenen Pumpenschlauch befestigen mit einer 23 G-1 in Spritzennadel. Ausreichend bromophenol blauen Farbstoff in die ddH2O es eine dunkelblaue Farbe zu geben. Dies erleichtert die Visualisierung der Grenzfläche zwischen dem Medium und dem Gradienten Verschiebung ddH 2 O. </li><li> Die Pumpe auf einer Strömungsgeschwindigkeit von 850 ml / min äquilibriert und das System, bis ein Tropfen des blau gefärbten ddH 2 O ergibt sich aus der Spritzennadel. </li><li> Sorgfältig fixieren Ultrazentrifugenröhrchen mit einem Klemmständer und durchbohren die Unterseite des Rohres mit einer Spritze 23 G 1 in langen Nadel. Die Pumpe mit der Ultrazentrifugenröhrchen durch Einführen der Nadel in den Pumpschlauch in das obere Ende des Rohrs befestigt ist, und sammeln Tropfen von unten direkt in sterile 1,5 ml Mikrozentrifugenröhrchen. Sammle ein Bruch alle 30 sec, in Höhe von ca. 425 ul pro Fraktion und insgesamt 12 Fraktionen pro Steigung. Beachten Sie, dass die letzte Fraktion (Fraktion 12) enthält in der Regel die Verschiebung ddH 2 O und sollte verworfen werden. </li><li> Nach der Fraktionierung michasure die Dichte aller getrennten Fraktionen mit einer Analysenwaage, wie in Schritt 5.1.2 erwähnt. </li><li> Ausfällung der DNA aus jeder Fraktion (etwa 425 ul) hergestellt, indem zuerst 1 &amp;mgr; l Glycogen (20 &amp;mgr; g / &amp;mgr; l in ddH 2 O, autoklaviert) als Träger für die Fällung von geringen DNA. Mischen Sie es gut durch Inversion. </li><li> Hinzufügen beiden Volumina (850 ul) von Polyethylenglykol (PEG)-Lösung (150 aufzulösen g Polyethylenglykol 6000 und 46,8 g NaCl in ddH 2 O auf ein Gesamtvolumen von 500 ml. Filter, sterilisiert und Autoklaven. Die PEG-Lösung 30 % PEG 6000 und 1,6 M NaCl), und mischen durch Invertieren zehn Mal. </li><li> Lassen Sie die Röhrchen bei RT für mindestens zwei Stunden (falls nötig, über Nacht), um die DNA auszufällen. </li><li> Zentrifugieren der Niederschläge bei 13.000 × g für 30 min bei RT. Ein sichtbares Pellet sollte zu bilden. </li><li> Entfernen Sie vorsichtig den Überstand mit einer Pipette und waschen das Pellet mit 500 ul 70% Ethanol. Zentrifugieren unter den gleichenBedingungen für 10 min wieder. </li><li> Vorsichtig den Überstand verwerfen und an der Luft trocknen das Pellet bei RT für 15 min. </li><li> Abgeblasen, und der getrocknete DNA-Pellet in 30 ul ddH 2 O und gut mischen durch leichtes Antippen des Röhrchens. Quantifizierung der DNA in jeder Gradientenfraktion wie in Schritt 4.3 Lagern Sie die Proben unter -20 oder -80 ° C, wenn die Langzeitlagerung erforderlich ist. </li></ol></li></ol> 6. DNA-Charakterisierung durch Pyrosequenzierung <ol><li> Sicherzustellen, dass die unmarkierte nativen (12 C)-DNA nimmt den Dichtebereich von 1,705 g / ml bis 1,720 g / ml, während 13 C-markierten DNA hat eine Dichte von etwa 1,720 bis 1,735 g / ml. Beachten Sie, dass sowohl die native und 13 aus Umweltproben extrahiert C-markierte DNA kann mehrere Gradientenfraktionen überspannen. Erwarten Sie das Licht, mit DNA-Fraktionen 9-11 und der schweren DNA mit 4-6 Fraktionen zugeordnet werden zugeordnet werden. </li><li> Kombinieren Taste, um eine einzelne Fraktionen &quot;kompiliert&quot; repräsentativen Teil ac erstellengemäß der speziellen Spitzen Zuordnung der Dichte-DNA gelöst. Alternativ können andere Mittel, um die getrennten Fraktionen unter Verwendung der Isotopenverhältnis-Massenspektrometrie (IRMS) 22 oder ein Fingerprinting-Verfahren, wie denaturierende Gradienten-Gelelektrophorese (DGGE) 23, weiter zu untersuchen entsprechenden Fraktionen vor der Sequenzierung zu wählen. </li><li> Führen Pyrosequenzierung der PCR-amplifizierte bakteriellen 16S rRNA-Gene aus den kompilierten schweren, mittleren und leichten Fraktionen der einzelnen Gradienten. Unter Verwendung dieses Verfahrens Identifizierung der Linie und relative Häufigkeit von metabolisch aktive Bakterienspezies in der SIP-inkubierten Proben möglich ist. Führen Pyrosequenzierung wie folgt: <ol><li> Führen Amplikon Pyrosequenzierung mit einem Roche 454 FLX Titanium Reagenzien mit. </li><li> Bereiten Barcode-Amplikons zum Multiplexen mit der Fusion Primersatz Gray28F (5 - GAGTTTGATCNTGGCTCAG -3) und Gray519r (5 - GTNTTACNGCGGCKGCTG -3) 24,25 mit th verlängertE jeweiligen Primer-Adapter A / B und probenspezifischen Multiplex-Identifier (MID). </li><li> Tragen Sie eine Ein-Schritt-PCR mit 30 Zyklen, mit einem Hot Start Taq-Polymerase, um die Sequenzierung Bibliothek zu erzeugen. </li><li> Sequenz, die auf der Grundlage der Amplikons Lieferanten-Protokoll, und erweitern die liest aus der Vorwärtsrichtung (Gray28F) wie in <a href="http://www.researchandtesting.com/">http://www.researchandtesting.com/</a> . </li></ol></li></ol> 7. Pyrosequenzierung Datenanalyse <ol><li> Analysieren Sie die rohen Sequenzabschnitte von der 454 Pyrosequenzierung mit den &quot;quantitativen Einblicke in mikrobielle Ökologie&quot;, QIIME Software-Pipeline 26 erzeugt. Führen Sie die Verarbeitung wie folgt: <ol><li> Zunächst wandeln das 454-Maschine erzeugten sff Datei auf FASTA, QUAL und Flowgram Dateien mit der process_sff.py Skript. </li><li> Bestätigen Sie die Mapping-Datei (basierend auf check_id_map.py) und weisen Multiplex liest, um biologische samsätze mit der split_libraries.py Skript. Schneiden Sie die Low-Qualität endet mit einem Schiebefenster Größe von 50 und einer durchschnittlichen Qualität-Cutoff von 25, beseitigen auch kurze Sequenzen mehrdeutig (die Länge &lt;200 bp) aus dem Datensatz. </li><li> DeNoise die Daten mit Hilfe der 454 denoise_wrapper.py. </li><li> Als nächstes Cluster die hochwertige liest in operative taxonomischen Einheiten (OTUs) mit dem mehrfachen Kommissionierung OTU-Methode (pick_otus.py mit 97% Sequenzähnlichkeit cut-offs). </li><li> Wählen Sie einen Vertreter aus jeder Sequenz OTU mit pick_rep_set.py. </li><li> Weisen Taxonomie an den Vertreter Sequenz Satzes basierend auf assign_taxonomy.py. Nutzen Sie die ribosomale Database Project (RDP)-Klassifikator mit einem Minimum an Vertrauen auf 0,80 eingestellt Rekordbelegung. </li><li> Richten Sie den Vertreter Folge gegen die vorausgerichteten Greengenes Kern 16S-Sequenzen unter Verwendung des Algorithmus PyNast (align_seqs.py eingestelltmit der minimalen Sequenzidentität zu 75 Prozent Satz). </li><li> Zusätzlich führen Chimären von der weiteren Analyse, indem Sie identify_chimeric_seqs.py. </li><li> Entfernen Sie alle Lücke Positionen vor dem Aufbau einer phylogenetischen Baum (make_phylogeny.py) (nicht nützlich für phylogenetische Rückschluss) mit dem lanemask Vorlage (filter_alignment.py). </li><li> Schließlich erzeugen OTU Tabellen mit make_otu_table.py, die Bakterien Phylotypen innerhalb jeder Probe beschreibt. Verwenden Sie die Tabelle, um die OTU Heatmap für den Vergleich der bakteriellen Hülle und Fülle und Aktivität zu konstruieren. </li><li> Falls erforderlich, berechnen die Alpha-und Beta-Diversität innerhalb und zwischen den Proben. Auf die gleiche Weise können Verdünnung Kurven (Graphen der Vielfalt gegenüber Sequenzierung Tiefe) und Hauptkoordinaten-Analyse (HKoA) Grundstücke, die die Beziehungen zwischen den mikrobiellen Gemeinschaften ebenfalls hergestellt werden. </li></ol></li></ol>

<ol>
	<li>Pais, R., Lohs, C., Wu, Y. N., Wang, J. W., Aksoy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+obligate+mutualist+Wigglesworthia+glossinidia+influences+reproduction,+digestion,+and+immunity+processes+of+its+host,+the+tsetse+fly.">The obligate mutualist Wigglesworthia glossinidia influences reproduction, digestion, and immunity processes of its host, the tsetse fly.</a> Appl. Environ. Microbiol. 74, 5965-5974 (2008).</li><li>Freitak, D., Heckel, D. G., Vogel, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dietary-dependent+trans-generational+immune+priming+in+an+insect+herbivore.">Dietary-dependent trans-generational immune priming in an insect herbivore.</a> Proc. Biol. Sci. 276, 2617-2624 (2009).</li><li>Dillon, R. J., Vennard, C. T., Charnley, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Note:+Gut+bacteria+produce+components+of+a+locust+cohesion+pheromone.">A Note: Gut bacteria produce components of a locust cohesion pheromone.</a> J. Appl. Microbiol. 92, 759-763 (2002).</li><li>Douglas, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutritional+interactions+in+insect-microbial+symbioses:+Aphids+and+their+symbiotic+bacteria+Buchnera.">Nutritional interactions in insect-microbial symbioses: Aphids and their symbiotic bacteria Buchnera.</a> Annu. Rev. Entomol. 43, 17-37 (1998).</li><li>Reichardt, N., Barclay, A. R., Weaver, L. T., Morrison, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+stable+isotopes+to+measure+the+metabolic+activity+of+the+human+intestinal+microbiota.">Use of stable isotopes to measure the metabolic activity of the human intestinal microbiota.</a> Appl. Environ. Microbiol. 77, 8009-8014 (2011).</li><li>Dumont, M. G., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+isotope+probing+-+linking+microbial+identity+to+function.">Stable isotope probing - linking microbial identity to function.</a> Nat. Rev. Microbiol. 3, 499-504 (2005).</li><li>Gil, R., Latorre, A., Moya, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+endosymbionts+of+insects:+insights+from+comparative+genomics.">Bacterial endosymbionts of insects: insights from comparative genomics.</a> Environ. Microbiol. 6, 1109-1122 (2004).</li><li>Brune, A., VH, R. e. s. h., Card&#233;, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Encyclopedia of Insects. , 1132 (2005).</li><li>Breznak, J. A., Brune, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+microorganisms+in+the+digestion+of+lignocellulose+by+termites.">Role of microorganisms in the digestion of lignocellulose by termites.</a> Annu. Rev. Entomol. 39, 453-487 (1994).</li><li>Broderick, N. A., Raffa, K. F., Goodman, R. M., Handelsman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Census+of+the+bacterial+community+of+the+gypsy+moth+larval+midgut+by+using+culturing+and+culture-independent+methods.">Census of the bacterial community of the gypsy moth larval midgut by using culturing and culture-independent methods.</a> Appl. Environ. Microbiol. 70, 293-300 (2004).</li><li>Funke, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hydrolysis+of+quorum-sensing+molecules+in+the+gut+of+lepidopteran+larvae.">Rapid hydrolysis of quorum-sensing molecules in the gut of lepidopteran larvae.</a> Chembiochem. 9, 1953-1959 (2008).</li><li>Tang, X. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complexity+and+variability+of+gut+commensal+microbiota+in+polyphagous+lepidopteran+larvae.">Complexity and variability of gut commensal microbiota in polyphagous lepidopteran larvae.</a> PloS One. 7, (2012).</li><li>Amann, R. I., Ludwig, W., Schleifer, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phylogenetic+identification+and+in-situ+detection+of+individual+microbial-cells+without+cultivation.">Phylogenetic identification and in-situ detection of individual microbial-cells without cultivation.</a> Microbiol. Rev. 59, 143-169 (1995).</li><li>Olsen, G. J., Lane, D. J., Giovannoni, S. J., Pace, N. R., Stahl, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+ecology+and+evolution+-+a+ribosomal-rna+approach.">Microbial ecology and evolution - a ribosomal-rna approach.</a> Annu. Rev. Microbiol. 40, 337-365 (1986).</li><li>Pilloni, G., von Netzer, F., Engel, M., Lueders, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electron+acceptor-dependent+identification+of+key+anaerobic+toluene+degraders+at+a+tar-oil-contaminated+aquifer+by+Pyro-SIP.">Electron acceptor-dependent identification of key anaerobic toluene degraders at a tar-oil-contaminated aquifer by Pyro-SIP.</a> FEMS Microbiol. Ecol. 78, 165-175 (2011).</li><li>Lu, Y. H., Conrad, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+stable+isotope+probing+of+methanogenic+archaea+in+the+rice+rhizosphere.">In situ stable isotope probing of methanogenic archaea in the rice rhizosphere.</a> Science. 309, 1088-1090 (2005).</li><li>Radajewski, S., Ineson, P., Parekh, N. R., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable-isotope+probing+as+a+tool+in+microbial+ecology.">Stable-isotope probing as a tool in microbial ecology.</a> Nature. 403, 646-649 (2000).</li><li>Lueders, T., Pommerenke, B., Friedrich, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable-isotope+probing+of+microorganisms+thriving+at+thermodynamic+limits:+Syntrophic+propionate+oxidation+in+flooded+soil.">Stable-isotope probing of microorganisms thriving at thermodynamic limits: Syntrophic propionate oxidation in flooded soil.</a> Appl. Environ. Microbiol. 70, 5778-5786 (2004).</li><li>Kunapuli, U., Lueders, T., Meckenstock, R. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+stable+isotope+probing+to+identify+key+iron-reducing+microorganisms+involved+in+anaerobic+benzene+degradation.">The use of stable isotope probing to identify key iron-reducing microorganisms involved in anaerobic benzene degradation.</a> ISME J. 1, 643-653 (2007).</li><li>Fuhrer, T., Fischer, E., Sauer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+identification+and+quantification+of+glucose+metabolism+in+seven+bacterial+species.">Experimental identification and quantification of glucose metabolism in seven bacterial species.</a> J. Bacteriol. 187, 1581-1590 (2005).</li><li>Dunford, E. A., Neufeld, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Stable-Isotope+Probing+(DNA-SIP).">DNA Stable-Isotope Probing (DNA-SIP).</a> J. Vis. Exp. (42), (2010).</li><li>Yamasaki, S., Nomura, N., Nakajima, T., Uchiyama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cultivation-independent+identification+of+candidate+dehalorespiring+bacteria+in+tetrachloroethylene+degradation.">Cultivation-independent identification of candidate dehalorespiring bacteria in tetrachloroethylene degradation.</a> Environ. Sci. Technol. 46, 7709-7716 (2012).</li><li>Lueders, T., Manefield, M., Friedrich, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+sensitivity+of+DNA-+and+rRNA-based+stable+isotope+probing+by+fractionation+and+quantitative+analysis+of+isopycnic+centrifugation+gradients.">Enhanced sensitivity of DNA- and rRNA-based stable isotope probing by fractionation and quantitative analysis of isopycnic centrifugation gradients.</a> Environ. Microbiol. 6, 73-78 (2004).</li><li>Ishak, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+diversity+in+Solenopsis+invicta+and+Solenopsis+geminata+ant+colonies+characterized+by+16S+amplicon+454+pyrosequencing.">Bacterial diversity in Solenopsis invicta and Solenopsis geminata ant colonies characterized by 16S amplicon 454 pyrosequencing.</a> Microb. Ecol. 61, 821-831 (2011).</li><li>Sun, Y., Wolcott, R. D., Dowd, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tag-encoded+FLX+amplicon+pyrosequencing+for+the+elucidation+of+microbial+and+functional+gene+diversity+in+any+environment.">Tag-encoded FLX amplicon pyrosequencing for the elucidation of microbial and functional gene diversity in any environment.</a> Methods Mol. Biol. 733, 129-141 (2011).</li><li>Kuczynski, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+QIIME+to+Analyze+16S+rRNA+Gene+sequences+from+microbial+communities.">Using QIIME to Analyze 16S rRNA Gene sequences from microbial communities.</a> Curr. Protoc. Microbiol. Chapter 1, Unit1E 5 (2012).</li><li>Dillon, R. J., Dillon, V. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gut+bacteria+of+insects:+nonpathogenic+interactions.">The gut bacteria of insects: nonpathogenic interactions.</a> Annu. Rev. Entomol. 49, 71-92 (2004).</li><li>Neufeld, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+stable-isotope+probing.">DNA stable-isotope probing.</a> Nat. Protoc. 2, 860-866 (2007).</li><li>Dumont, M. G., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+isotope+probing+-+linking+microbial+identity+to+function.">Stable isotope probing - linking microbial identity to function.</a> Nat. Rev. Microbiol. 3, 499-504 (2005).</li></ol>

Wir haben nichts zu offenbaren.

Der Darm der meisten Insekten beherbergt eine reiche und komplexe mikrobielle Gemeinschaft, in der Regel 10 7 10 9 prokaryotischen Zellen einlegen dort Überzahl der Gastgeber die eigenen Zellen in den meisten Fällen. Somit ist das Insektendarm eine &quot;Hot Spot&quot; für diverse mikrobielle Aktivitäten, die mehrere Aspekte der mikrobiellen Beziehungen, von der Pathogenese zur mutualism 27 verpflichten. Obwohl viele Studien haben eine erstaunliche Vielfalt an Insektendarm mikrobiell...

Insekten-Bakterien-Symbiose Verbände sind für eine Vielzahl von Insektenarten 7 bekannt. In diesen symbiotischen Verbände, spielen Mikroorganismen eine wichtige Rolle beim Wachstum und der Entwicklung von Insekten. Mikroben haben gezeigt, Insektenreproduktions 1, Pheromonbiosynthese 3, Ernährung, einschließlich der Synthese von essentiellen Aminosäuren 4 und Verdauung von Lebensmitteln ungeeignet zum Host beitragen. Trotz der Vielzahl von gut-Bakterienverbände, viel weniger ist über die funktionelle Rolle, die sie zugunsten des Insekts spielen, bekannt. Nur im Falle der Termiten, die symbiotische Verdauung von Lignocellulose durch Prokaryonten, Protozoen und Pilzen durchgeführt wird, wurde ausführlich untersucht 8,9. Im Gegensatz dazu, ist wenig über die Symbiose im Darm der Insekten Generalist, dh die Baumwollwurms heute bekannten Spodoptera littoralis. Darüber hinaus wurden aufgrund ihrer häufigen Verschiebung der Wirtspflanzen, allgemeineIST Insekten und deren darmassoziierten Bakteriengemeinschaften sind ständig neue Herausforderungen, um ihre Ernährungsgewohnheiten Verbrauchsanlagen mit einer Vielzahl von sekundären Pflanzenstoffen verknüpft ausgesetzt. Daneben ist die Darmumgebung Lepidoptera, stellt an sich eine raue Umgebung für das Wachstum von Bakterien, die wegen der hohen pH 10 gut. Insbesondere in dem Fall von S. littoralis reicht sie von 10,5 in der Vorderdarm, ca.. 9 im Mitteldarm auf fast 7 im Enddarm 11 pH-Wert. Auf der anderen Seite, die bakterielle Gemeinschaft mit dem Darm von S. verbunden littoralis ist einfach. Tang, Freitak, 12 et al. Berichtet maximal 36 Phylotypen auf insgesamt 7 verschiedene Bakterienarten als die einzigen Mitglieder der Bakteriengemeinschaft mit diesem Insekt verbunden gehört. Neben dieser, ist keine komplizierte Aufzuchtverfahren für die Insektenwachstums im Labor erforderlich. Weiterhin dieser und der kurzen Lebenszyklus der Insekten zu erleichtern Multi-generational Studien, drehen diese Art in ein ideales Modellsystem zur Untersuchung der Darm-Mikroben-Interaktionen. Mit dem Aufkommen der PCR-basierten Sequenzierungstechnologien, ist die Zahl der Studien, die sich mit Darm Biota von mehreren Organismen (dh Menschen, Insekten oder Meeresorganismen) erhöht. Darüber hinaus sind die Ergebnisse aus der Isolation und Kultivierung der Darm beherbergt Bakterien als in der Vergangenheit unabhängig. Fast 99% der Bakterien nicht kultivierbaren und die Simulation der im Darm herrschenden Umweltbedingungen ist schwierig 12. Durch PCR konnte 16S-rRNA-Gen-Fragmenten (ein weit verbreitetes phylogenetische Marker-Gen unter Bakterien) selektiv aus einer gemischten DNA-Matrize der Darmbakteriengemeinschaften, sequenziert amplifiziert, kloniert. Mit diesen Informationen kann der Benutzer die Bakterienspezies nach Erfassen der Sequenzinformation aus öffentlichen Datenbanken 13,14 identifizieren. Dennoch nähert sich die Sequenzierung, um bakterielle beschreibenGemeinden vor unzureichend aufgrund fehlender Informationen über die Stoffwechseleigenbeitrag der einzelnen Arten innerhalb der Gemeinschaft. Stabil-Isotopen-Probing (SIP) ist ein vielversprechender Kultur-freie Technik. Es wird oft in der Umweltmikrobiologie zur mikrobiellen Stammbäume, um bestimmte Stoffwechselaktivitäten verknüpft analysieren. Dies wird durch das Verfolgen stabilen Isotop markierten Atome von Substraten in mikrobiellen Biomarkern, z. B. Phospholipid-Fettsäuren abgeleitet sind, DNA, RNA und 5 gelöst. Bei der Betrachtung von Nukleinsäuren wird die Methodik bei der Trennung von 13 C-markierter DNA oder RNA aus der unmarkierten DNA durch Dichtegradienten-Ultrazentrifugation 6 basiert. Wegen dieser direkten Verbindung zwischen der DNA-Markierung und die metabolische Aktivität, einem nachgeschalteten molekularen Analyse der Nukleinsäuren identifiziert die Arten und liefert Informationen über Stoffwechselaktivitäten. Außerdem Kombination von DNA-SIP und Pyrosequenzierung durch AnwendungPilloni, von Netzer, et al. 15. ermöglicht eine besonders einfache und sensitive Identifizierung der Bakterienarten in der schweren 13 C-markierten DNA-Fraktion vor. Bisher wurde diese Technik angewandt, um die Bakteriengemeinschaften in biogeochemischen Prozesse im Boden unter aeroben und anaeroben Bedingungen 16,17 18,19 beteiligt zu beschreiben. Neben der Verwendung in der Umweltwissenschaft ist die Technik, die in den medizinischen Wissenschaften angewendet worden, wie durch Reichardt et al. 5, die die Stoffwechselaktivitäten der verschiedenen phylogenetischen Gruppen der menschlichen Darmflora in Reaktion auf ein unverdauliches Kohlenhydrat beschrieben gemeldet. Hier verwenden wir 13 C-Glucose auf &#39;label&#39; die DNA der metabolisch aktiven Bakterienarten im Darm. Glucose ist ein Zucker von den meisten Bakterienarten entlang der weit verbreiteten Entner-Doudoroff (ED)-Weg verwendet, obwohl Ausnahmen sind bekannt 20. Diesrechtfertigt den Einsatz von 13 C-Glucose als zuverlässiger Stoffwechsel Sonde, die eine Verbindung zwischen Stoffwechselprodukte von Interesse und der Kohlenstoffquelle entlang etablierten Wege bietet. Je nach wissenschaftlicher Frage andere Substrate, dh 13 C-Methan, 13 CO 2 oder Pflanzen unter einer 13 CO 2-Atmosphäre angehoben ist, kann verwendet werden, um Stoffwechselaktivitäten zu adressieren. An dieser Stelle, die im Stoffwechsel Charakterisierung der Bakteriengemeinschaft im Darm der Insekten-Generalist, nämlich S. verwendete Protokoll präsentieren wir littoralis (Lepidoptera, Noctuidae). Darüber hinaus wurde das Verfahren auf Pyrosequenzierung, was wiederum ermöglicht die Identifizierung von Insektendarmbakteriengemeinschaften mit hoher Auflösung und Genauigkeit gekoppelt. Als Hauptsubstrat wurde 13 C-markierter Glukose in den Experimenten verwendet.

<table border="0" cellpadding="0" cellspacing="0" width="872"> 
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:384px;">Dumont #5 Mirror Finish Forceps</td>
			<td style="width:203px;">Fine Science Tools</td>
			<td style="width:135px;">11251-23</td>
			<td style="width:151px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vannas Spring Scissors</td>
			<td>Fine Science Tools</td>
			<td>15000-00</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Speed Vacuum Concentrator 5301</td>
			<td>Eppendorf Germany</td>
			<td>5305 000.304</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Plastic pestle</td>
			<td>Carl Roth GmbH Co. Germany</td>
			<td>P986.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NanoVue spectrophotometer</td>
			<td>GE HealthCare, UK</td>
			<td>28-9569-58</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mastercycler pro/thermocycler</td>
			<td>Eppendorf Germany</td>
			<td>6321 000.515</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agagel Standard Horizontal Gel Electrophoresis chamber</td>
			<td>Biometra</td>
			<td>Discontinued</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultracentrifuge (Optima L-90K)</td>
			<td>Beckman</td>
			<td>A20684</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultracentrifuge rotor (NVT 90)</td>
			<td>Beckman</td>
			<td>362752</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HPLC pump</td>
			<td>Agilent</td>
			<td>1100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Quick-Seal, Polyallomer tube</td>
			<td>Beckman</td>
			<td>342412</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Transilluminator UVstar 15 </td>
			<td>Biometra</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

identification of metabolically active bacteria in the gut of the generalist spodoptera littoralis via dna stable isotope probing using 13c-glucose

Guts der meisten Insekten werden durch komplexe Gemeinschaften von symbiotischen Bakterien nicht pathogen bewohnt. Innerhalb dieser mikrobiellen Gemeinschaften ist es möglich, kommen oder mutualistic Bakterienarten identifizieren. Letztere sind beobachtet worden, um mehrere Funktionen zu den Insekten dienen, also hilft in Insekten Wiedergabe ein, die Förderung der Immunantwort 2, Pheromonproduktion 3, sowie Ernährung, einschließlich der Synthese von essentiellen Aminosäuren 4, unter anderem. Aufgrund der Bedeutung dieser Vereine haben viele Anstrengungen unternommen, um die Gemeinden bis zu den einzelnen Mitgliedern zu charakterisieren. Die meisten dieser Bemühungen wurden entweder auf Kultivierungsmethoden basieren oder auf der Erzeugung von 16S-rRNA-Gen-Fragmente, die für die endgültige Identifizierung sequenziert wurden herangezogen. Leider sind diese Ansätze nur dann erkannt, die in der Darmbakterienarten vorhanden und sofern keine informatIonen auf die metabolische Aktivität der Mikroorganismen. Die metabolisch aktive Bakterienarten im Darm eines Insekts zu charakterisieren, haben wir stabile Isotop Sondierung (SIP) in vivo Anwendung 13 C-Glucose als universelle Substrat. Dies ist eine vielversprechende Kultur freie Technik, die die Verknüpfung der mikrobiellen Stammbäume ihrer besonderen Stoffwechselaktivität ermöglicht. Dies ist durch die Verfolgung stabilen Isotop markierten Atome von Substraten in mikrobiellen Biomarkern, wie DNA und RNA 5 möglich. Der Einbau von 13 C-Isotope in DNA erhöht die Dichte der markierten DNA im Vergleich zum unmarkierten (12 C) ein. Am Ende wird das 13 C-markierte DNA oder RNA, die durch Dichte-Gradienten-Ultrazentrifugation aus dem 12 C-unmarkierten ähnliches 6 getrennt. Anschließende molekulare Analyse der getrennten Nukleinsäure Isotopologen stellt die Verbindung zwischen der metabolischen Aktivität und der Identität der Spezies. Hier präsentieren wir die verwendet werden, um die stoffwechselaktiven Bakterien im Darm der Insekten-Generalist (unser Modellsystem), Spodoptera littoralis (Lepidoptera, Noctuidae) charakterisieren Protokoll. Die phylogenetische Analyse der DNA wurde mit Pyrosequenzierung, die hohe Auflösung und Genauigkeit bei der Identifizierung von Insektendarmbakteriengemeinschaft erlaubt getan. Als Hauptsubstrat wurde 13 C-markierter Glukose in den Experimenten verwendet. Das Substrat wurde auf die Insekten mit einer künstlichen Nahrung gefüttert.

Um eine ausreichende Markierung der im Insektendarm vorliegenden metabolisch aktiver Bakterien zu erreichen, muß das Insekt die 13 C-reiche Substrat für einen vorher optimierten ausreichenden Zeitraum, um die Trennung des markierten schwerere Fraktion leicht von der unmarkierten leichtere ermöglichen ausgesetzt werden. In unserem Fall wurde 13 C-Glucose in der künstlichen Ernährung bei einer Endkonzentration von 10 mM für 1 Tag (1A) ergänzt. Die gleiche Menge an normalen Glu...

Watch this Scientific Journal Video about Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose at JoVE.co

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

Die aktive Bakteriengemeinschaft mit dem Darm von Spodoptera littoralis verbunden sind, wurde von stabilen Isotopen-Probing (SIP) zu Pyrosequenzierung gekoppelt bestimmt. Mit dieser Methode wurde die Identifizierung der metabolisch aktiven Bakterienarten innerhalb der Gemeinde mit hoher Auflösung und Genauigkeit durchgeführt.

Bezeichnung des metabolisch aktiven Bakterien im Darm der Generalist<em&gt; Spodoptera littoralis</em&gt; Über DNA Stable Isotope Probing Mit<sup&gt; 13</sup&gt; C-Glucose

Guts of most insects are inhabited by complex communities of symbiotic nonpathogenic bacteria. Within such microbial communities it is possible to ...

identification-metabolically-active-bacteria-gut-generalist

Research

JoVE Journal

Biology

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

15.2K Aufrufe.  Max Planck Institute for Chemical Ecology.  Die aktive Bakteriengemeinschaft mit dem Darm von Spodoptera littoralis verbunden sind, wurde von stabilen Isotopen-Probing (SIP) zu Pyrosequenzierung gekoppelt bestimmt. Mit dieser Methode wurde die Identifizierung der metabolisch aktiven Bakterienarten innerhalb der Gemeinde mit hoher Auflösung und Genauigkeit durchgeführt. 

Serie: Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

Extracting DNA from the Gut Microbes of the Termite (Zootermopsis Angusticollis) and Visualizing Gut Microbes

Termites are among the few animals known to have the capacity to subsist solely by consuming wood.  The termite gut tract contains a dense and species-rich microbial population that assists in the degradation of lignocellulose predominantly into acetate, the key nutrient fueling termite metabolism (Odelson &amp; Breznak, 1983).  Within these microbial populations are bacteria, methanogenic archaea and, in some ("lower") termites, eukaryotic protozoa. Thus, termites are excellent research subjects for studying the interactions among microbial species and the numerous biochemical functions they perform to the benefit of their host.  The species composition of microbial populations in termite guts as well as key genes involved in various biochemical processes has been explored using molecular techniques (Kudo et al., 1998; Schmit-Wagner et al., 2003; Salmassi &amp; Leadbetter, 2003). These techniques depend on the extraction and purification of high-quality nucleic acids from the termite gut environment.  The extraction technique described in this video is a modified compilation of protocols developed for extraction and purification of nucleic acids from environmental samples (Mor  et al., 1994; Berthelet et al., 1996; Purdy et al., 1996; Salmassi &amp; Leadbetter, 2003; Ottesen et al. 2006) and it produces DNA from termite hindgut material suitable for use as template for polymerase chain reaction (PCR).

Extracting DNA from the Gut Microbes of the Termite Zootermopsis Angusticollis and Visualizing Gut Microbes

This video illustrates the technique for extracting DNA from the species of microbes resident in the termite hindgut. The preparation of a wet mount slide, which is useful for visualizing the gut microbial community is also illustrated, and a tour through the species-rich gut environment is given.

Extrahieren von DNA aus dem Gut Mikroben der Termite (Zootermopsis Angusticollis) und visualisieren Gut Mikroben

Termites are among the few animals known to have the capacity to subsist solely by consuming wood.  The termite gut tract contains a dense and ...

Forschung

Biologie

DNA Stable-Isotope Probing (DNA-SIP)

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

DNA Stable-Isotope Probing DNA-SIP

DNA stable-isotope probing is a cultivation-independent method to identify and characterize active communities of microorganisms that are capable of utilizing specific substrates. Assimilation of substrate enriched in heavy isotope leads to incorporation of labelled atoms into microbial biomass. Density gradient ultracentrifugation retrieves labelled DNA for downstream molecular analyses.

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

In vitro Rekonstitution der Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Visualization of DNA Replication in the Vertebrate Model System DT40 using the DNA Fiber Technique

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not only ensure faithful genome duplication in the face of endogenous and exogenous DNA damage but also prevent genomic instability, a recognized causative factor in tumor development.
Here, we describe a simple and cost-effective fluorescence microscopy-based method to visualize DNA replication in the avian B-cell line DT40. This cell line provides a powerful tool to investigate protein function in vivo by reverse genetics in vertebrate cells1. DNA fiber fluorography in DT40 cells lacking a specific gene allows one to elucidate the function of this gene product in DNA replication and genome stability. Traditional methods to analyze replication fork dynamics in vertebrate cells rely on measuring the overall rate of DNA synthesis in a population of pulse-labeled cells. This is a quantitative approach and does not allow for qualitative analysis of parameters that influence DNA synthesis. In contrast, the rate of movement of active forks can be followed directly when using the DNA fiber technique2-4. In this approach, nascent DNA is labeled in vivo by incorporation of halogenated nucleotides (Fig 1A). Subsequently, individual fibers are stretched onto a microscope slide, and the labeled DNA replication tracts are stained with specific antibodies and visualized by fluorescence microscopy (Fig 1B). Initiation of replication as well as fork directionality is determined by the consecutive use of two differently modified analogues. Furthermore, the dual-labeling approach allows for quantitative analysis of parameters that influence DNA synthesis during the S-phase, i.e. replication structures such as ongoing and stalled forks, replication origin density as well as fork terminations. Finally, the experimental procedure can be accomplished within a day, and requires only general laboratory equipment and a fluorescence microscope.

DT40, a model vertebrate genetic system, provides a powerful tool to analyze protein function. Here we describe a simple method that allows qualitative analysis of parameters that influence DNA synthesis during the S-phase in DT40 cells at the single molecule level.

Visualisierung der DNA-Replikation in den Wirbeltier-Modellsystem DT40 mit der DNA Fiber-Technik

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

Bezeichnung des Post-translationale Modifikationen von Pflanzenproteinkomplexe

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

Chromatinimmunpräzipitation Assay zur Identifizierung von Arabidopsis-Protein-DNA-Wechselwirkungen<em&gt; In-vivo-</em

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Amplification, Next-Generation-Sequenzierung und genomischer DNA Mapping von Retrovirale Integration Seiten

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ecologically-important endpoints, though they are rarely considered in toxicological studies. D. melanogaster is emerging as a toxicology model for the behavioral, neurological, and genetic impacts of toxicants, to name a few. More importantly, species in the genus Drosophila can be utilized as a model system for an integrative framework approach to incorporate emergent properties and answer ecologically-relevant questions in&#160;toxicology research. The aim of this paper is to provide a protocol for exposing species in the genus Drosophila to pollutants to be used as a model system for a range of phenotypic outputs and ecologically-relevant questions. More specifically, this protocol can be used to 1) link multiple biological levels of organization and understand the impact of toxicants on both individual- and population-level fitness; 2) test the impact of toxicants at different stages of developmental exposure; 3) test multigenerational and evolutionary implications of pollutants; and 4) test multiple contaminants and stressors simultaneously.

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

In this paper, we provide a detailed protocol for exposing species in the genus Drosophila to pollutants with the goal of studying the impact of exposure on a range of phenotypic outputs at different developmental stages and for more than one generation.

Experimentelles Protokoll für die Verwendung von Drosophila als ein Wirbellosen Modellsystem für Toxizitätstests im Labor

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ...

Establishing Stable Binary Cultures of Symbiotic Saccharibacteria from the Oral Cavity

Many bacterial species cannot be cultured in the laboratory using standard methods, posing a significant barrier to studying the majority of microbial diversity on earth. Novel approaches are required to culture these uncultured bacteria so that investigators can effectively study their physiology and lifestyle using the powerful tools available in the laboratory. The Candidate Phyla Radiation (CPR) is one of the largest groups of uncultivated bacteria, comprising ~15% of the living diversity on earth. The first isolate of this group was a member of the Saccharibacteria phylum, 'Nanosynbacter lyticus' strain TM7x. TM7x is an unusually small bacterium that lives as a symbiont in direct contact with a bacterial host, Schaalia odontolytica, strain XH001. Taking advantage of the unusually small cell size and its lifestyle as a symbiotic organism, we developed a protocol to rapidly culture Saccharibacteria from dental plaque. This protocol will show how to filter a suspension of dental plaque through a 0.2 &#181;m filter, then concentrate the collected Saccharibacteria cells and infect a culture of host organisms. The resulting coculture can be passaged as any normal bacterial culture and infection is confirmed by PCR. The resulting binary culture can be maintained in the laboratory and used for future experiments. While contamination is a possibility, the binary culture can be purified by either further filtering and reinfection of host, or by plating the binary culture and screening for infected colonies. We hope this protocol can be expanded to other sample types and environments, leading to the cultivation of many more species in the CPR.

We demonstrate a method for isolating difficult-to-grow members of the novel bacterial phylum, Saccharibacteria, by filtering dental plaque and co-culturing with host bacteria.

Etablierung stabiler binärer Kulturen symbiotischer Saccharibakterien aus der Mundhöhle

Many bacterial species cannot be cultured in the laboratory using standard methods, posing a significant barrier to studying the majority of microbial ...

Identification of Alternative Splicing and Polyadenylation in RNA-seq Data

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also be utilized to explore other complex regulatory mechanisms at the exon level. Alternative splicing and polyadenylation play a crucial role in the functional diversity of a gene by generating different isoforms to regulate gene expression at the post-transcriptional level, and limiting analyses to the whole gene level can miss this important regulatory layer. Here, we demonstrate detailed step by step analyses for identification and visualization of differential exon and polyadenylation site usage across conditions, using Bioconductor and other packages and functions, including DEXSeq, diffSplice from the Limma package, and rMATS.

Alternative splicing (AS) and alternative polyadenylation (APA) expand the diversity of transcript isoforms and their products. Here, we describe bioinformatic protocols to analyze bulk RNA-seq and 3' end sequencing assays to detect and visualize AS and APA varying across experimental conditions.

Identifizierung von alternativem Spleißen und Polyadenylierung in RNA-seq-Daten

As well as the typical analysis of RNA-Seq to measure differential gene expression (DGE) across experimental/biological conditions, RNA-seq data can also ...