Diese Arbeit wurde vom National Institutes of Health (NIH) unterstützt Grants CA127231 und The Damon Runyon Stiftung Clinical Investigator Award (CI 1502) (SM). Wir möchten Professor Zdenek Dvorak danken von Palacky Universität Olomouc, Tschechische Republik für seine hilfreiche Einblicke in Diskussion Tragbarkeit dieser Technik auf ihre Institution und Standardisierung von Protokoll.

1. Bau von PXR und SRC-1-Fusionen in Hefe-Vektoren <ol><li> PCR-Amplifikation der Menschen PXR LBD (107-434 Aminosäuren) und Menschen SRC-1 voller Länge (1 bis 1401 Aminosäuren). <ol><li> Verwenden pSG5-hPXR Plasmid 8 als PXR LBD-Vorlage, verwenden Sie pCMX SRC1-Plasmid als SRC-1-Vorlagen. </li><li> Tauwetter SuperMix PCR, DNA-Template und Primer (siehe Materialien), halten Sie sie auf Eis. </li><li> In 0,25 ug / ul ul DNA-Vorlage 1, 10 mM Primerpaare jeweils 2 ul, 45 ul PCR SuperMix und fügen H 2 O auf ein Gesamtvolumen von 50 ul zu bringen. </li><li> Eingestellt PCR bei einem Zyklus von 94 ° C für 2 min, 20 Zyklen von 94 ° C für 30 sec, 55 ° C für 30 sec und 72 ° C für 2 min, dann einen Zyklus von 72 ° C für 10 min zur Erweiterung. Überprüfen PCR-Produkte von über 1% Agarose-Gel läuft. </li></ol></li><li> PCR-Produkte, die Klonierung in Y2H Vektoren. <ol><li> Reinige PCR-Produkten aus 1% Agarose-Gel. Digest PXR, LBD, PCR und Y2H Vektor pSH2-1 mitBamHI und SalI; verdauen SRC-1 PCR und Y2H Vektor pGADNOT mit NotΙ und SalΙ. Um dies zu tun, fügen Sie 1 ug DNA, 3 ul 10x Reaktionspuffer, 1 ul Restriktionsenzymen und schließlich H 2 O auf ein Gesamtvolumen von 30 ul zu bringen. </li><li> Setzen Verdauung Proben in 37 ° C Wasserbad für 1 Stunde. Überprüfen Verdauung durch auf 1% Agarose-Gel läuft. </li><li> Reinige Verdauung Proben aus 1% Agarosegel, Ligat verdauten PCR-Produkte und Y2H Vektoren und Transformation auf DH5 &amp;agr; kompetente Zellen. </li><li> Wählen Sie die Kolonien und Isolierung der Plasmid-DNA. </li></ol></li><li> Identifizieren pSH2-1-PXR Plasmid-DNA durch BamHI / SalI Verdauung, identifizieren pGADNOT-SRC-1 Plasmid-DNA durch NotI / SalI Verdauung. Überprüfen Sie alle positiven Plasmid-DNA durch Sequenzierung. </li></ol> 2. Hefe-Zwei-Hybrid-Assays <ol><li> Impfen den Hefestamm in 5 ml YPAD und Inkubation über Nacht von ständigem Rühren (220 UpM bei 30 ° C). Hinweis: Der Saccharomyces cerevisiae-Stamm war CTY10-5d(MAT ein ade2 trp 1-901 leu2-3, 112-200-ga his3 l4 - GAL80 - URA3 :: lexA-lacZ), die eine integrierte GAL1-lacZ-Gen mit lexA Betreiber 10 enthält. Um lebensfähigen Hefezellen resistent gegen Ketoconazol erhalten, sondern diejenigen, die nicht-Transporter Veränderungen als Ursache von Azol-Widerstand 18-20, neue Stämme von CTY10-5d Hefe tragen hatten, wurden durch erste Lösch ERG3 (ERG3 Δ) erhalten und dann die Einführung zusätzlicher Deletion in ERG11 (ERG3 Δ / Δ ERG11)-Gene durch homologe Rekombination. Die konstruktiven Details wurden in einer zuvor veröffentlichten Manuskript 6 beschrieben. </li><li> Am nächsten Tag (morgens), impfen Hefe (1:20) in 5 ml YAPD und Inkubation eine OD 600 ~ 0,2 von ständigem Rühren (220 UpM bei 30 ° C) zu erhalten. </li><li> Pellet die Zellen bei 2000 rpm in einer Mikrozentrifuge für 2 min und den Überstand verwerfen. Dann waschen Sie die pellet zweimal mit autoklaviertem Wasser und einmal mit 0,1 M LiAc. </li><li> Nach dem letzten Waschüberstand verwerfen und fügen Sie die folgenden Reagenzien zu dem Zellpellet: 240 ul PEG 3500 50% w / v, 36 ul 1 M LiAc, 50 ul 2 mg / ml Lachssperma-ssDNA gekocht, H 2 O 34 ul. Vortex zu mischen, 1 ug PSH-PXR und 1 ug pGADNOT-SRC-1-DNA und mischen. </li><li> Übertragen Sie die Mischung auf Rundrohr (bei 30 ° C 220 rpm) für 30 min Polystyrol, agitieren die Transformation, mischen. Bewegen Sie das Rohr auf 42 ° C Wasserbad inkubiert und für weitere 30 min. </li><li> Zentrifugieren bei 2.000 rpm für 2 min und Überstand. Einmal waschen Pellet mit autoklaviertem Wasser. </li><li> Je 100 ul sterilem Wasser in das Rohr, erneut zu suspendieren, die Zellen durch leichtes Fingertippen und Pipettieren, dann auf Platten von -His/-Leu Dropout Medium (Formulierung pro Liter -His/-Leu Dropout-Medium-Platte: 20 g Dextrose, 1,7 g YNB, 0,67 g CSM-His/-Leu, 5 g Ammoniumsulfat, 1,5% Agar) und incUbate bei 30 ° C für 3-4 Tage, um Trans isolieren. </li></ol> 3. X-gal-Filter-Assay <ol><li> Geschnitten Nitrocellulosemembran auf die Größe des Teils der Petrischale. Beschriften Sie die Nitrocellulose-Membran, um die Orientierung zu markieren. </li><li> Zeigen vormarkierten Nitrozellulosemembran auf Hefe-Kolonien, stellen Sie sicher, dass die Membran in Kontakt mit der Oberfläche der Platte Medium. </li><li> Entfernen Sie die Membran, legen Sie sie Kolonieseite nach oben auf einem 3 mm Filterpapier und legen Sie die Membran und das Filterpapier bei -80 ° C für 15 min. </li><li> Stellen Sie X-gal-Lösung. Dann werden 50 &amp;mgr; l 20 mg / ml X-gal und 15 ul β-Mercaptoethanol auf 5 ml Z-Puffer (1 l Puffer enthält 16,1 g Na 2 HPO 4 · 7H 2 O, 5,5 g NaH 2 PO 4 H 2 O, 0,75 g KCl, 0,25 g MgSO 4 • 7H 2 O). Wenn Z-Puffer wurde bei 4 º C gehalten wurde, bringen es auf Raumtemperatur vor der Zugabe dieser Reagenzien. </li><li> Legen Sie zwei Kreise von 3 mm Filterpapierin einer Petrischale und genießen sie mit 5 ml X-gal-Lösung. Überschüssiges Puffer aus der Petrischale und legen Sie die Nitrocellulosemembran mit der Kolonieseite nach oben. </li><li> Schließen Sie den Deckel, sicherzustellen, dass die Membran macht vollständigen Kontakt mit dem Filterpapier und es ist völlig nass ist. Wickeln die Petrischale in Folie und bei 37 ° C für 30 min bis über Nacht. </li></ol> 4. Flüssig β-Gal-Assay <ol><li> Wachsen Hefe in -His/-Leu Dropout flüssigen Medium bis DA 600 0,7. </li><li> 1 ml Medium in ein 1,5 ml Mikrozentrifugenröhrchen und Zentrifuge bei 3.000 Upm 2 min. Überstand verwerfen. </li><li> 1 ml Z-Puffer, um das Pellet, Zentrifuge bei 3.000 Upm für 2 Minuten wieder zu resuspendieren. Überstand verwerfen. </li><li> In 150 ul Z-Puffer mit 2ME, um die Zellpellet resuspendieren, mischen dann fügen Sie 50 ul Chloroform und 20 ul 0,1% SDS. Kräftig vortexen die Probe für 15 Sekunden. </li><li> Add 700 ul ONPG-Lösung (1 mg / ml in Z buffer). Stellen Sie den Timer, Inkubation bei 30 ° C lange genug, damit die gelbe Farbe zu entwickeln und zu beachten Gesamtreaktionszeit. </li><li> Gib 500 &amp;mgr; l 1 M Na 2 CO 3, um die Reaktion zu stoppen, und wird die Absorption bei 420 nm auf. Der Rohling wird 700 ul ONPG-Lösung plus 500 ul 1 M Na 2 CO 3. </li></ol> Berechnen Miller Einheiten wie folgt: Miller Units = (A420 * 1000) / (A600 * min * ml) A420: Absorptionseinheiten bei 420 Nanometern; A600: Absorptionseinheiten bei 600 Nanometer; min: die Reaktionszeit in Minuten; ml: Reaktionsvolumen in ml

<ol>
	<li>Kliewer, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+orphan+nuclear+receptor+activated+by+pregnanes+defines+a+novel+steroid+signaling+pathway.">An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway.</a> Cell. 92 (1), 73-82 (1998).</li><li>Blumberg, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+novel+steroid+and+xenobiotic-sensing+nuclear+receptor.">a novel steroid and xenobiotic-sensing nuclear receptor.</a> Genes Dev. 12 (20), 3195-3205 (1998).</li><li>Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+the+'Jekyll+and+Hyde'+Nature+of+PXR:+The+Case+for+Discovering+Antagonists.">Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists.</a> Pharm. Res. 26 (8), 1807-1815 (2009).</li><li>Pondugula, S. R., Mani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pregnane+xenobiotic+receptor+in+cancer+pathogenesis+and+therapeutic+response.">Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response.</a> Cancer Lett. 328 (1), 1-9 (2013).</li><li>Mani, S., Dou, V., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PXR+antagonists+and+implications+for+drug+metabolism.">PXR antagonists and implications for drug metabolism.</a> Drug Metab. Rev. 45 (1), 60-72 (2013).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Yeast-Based+Strategy+Unveils+Antagonist+Binding+Regions+on+the+Nuclear+Xenobiotic+Receptor+PXR.">Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR.</a> J. Biol. Chem. 288 (19), 13655-13668 (2013).</li><li>Hollenberg, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+new+family+of+tissue-specific+basic+helix-loop-helix+proteins+with+a+two-hybrid+system.">Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.</a> Mol. Cell. Biol. 15 (7), 3813-3822 (1995).</li><li>Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+Ras+interacts+directly+with+the+serine/threonine+kinase+Raf.">Mammalian Ras interacts directly with the serine/threonine kinase Raf.</a> Cell. 74 (1), 205-214 (1993).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phytoestrogen+coumestrol+is+a+naturally+occurring+antagonist+of+the+human+pregnane+X+receptor.">The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor.</a> Mol. Endocrinol. 22 (4), 838-857 (2008).</li><li>Kalpana, G. V., Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+homomeric+interactions+of+human+immunodeficiency+virus+type+1+integrase+using+the+yeast+two-hybrid+system.">Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.</a> Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).</li><li>Hamdi, A., Colas, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+two-hybrid+methods+and+their+applications+in+drug+discovery.">Yeast two-hybrid methods and their applications in drug discovery.</a> TiPS. 33 (2), 109-118 (2012).</li><li>Battesti, A., Bouveret, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bacterial+two-hybrid+system+based+on+adenylate+cyclase+reconstitution+in+Escherichia+coli.">The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli.</a> Methods. 58 (4), 325-334 (2012).</li><li>Caufield, J. H., Sakhawalkar, N., Uetz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+and+optimization+of+yeast+two-hybrid+systems.">A comparison and optimization of yeast two-hybrid systems.</a> Methods. 58 (4), 317-324 (2012).</li><li>Albers, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+yeast+two-hybrid+screening+for+nuclear+receptor-interacting+proteins.">Automated yeast two-hybrid screening for nuclear receptor-interacting proteins.</a> Mol. Cell Proteomics. 4 (2), 205-213 (2005).</li><li>Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+role+of+the+orphan+nuclear+receptor+SXR+(steroid+and+xenobiotic+receptor)+in+the+mechanism+of+CYP3A4+inhibition+by+xenobiotics.">Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics.</a> J. Biol. Chem. 277 (36), 32453-32458 (2002).</li><li>Huang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+drug+metabolism+by+blocking+the+activation+of+nuclear+receptors+by+ketoconazole.">Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole.</a> Oncogene. 26 (2), 258-268 (2007).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activated+pregnenolone+X-+receptor+is+a+target+for+ketoconazole+and+Its+analogs.">Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs.</a> Clin. Cancer Res. 13 (8), 2488-2495 (2007).</li><li>Ghannoum, M. A., Rice, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antifungal+agents:+mode+of+action,+mechanisms+of+resistance,+and+correlation+of+these+mechanisms+with+bacterial+resistance.">Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance.</a> Clin. Microbiol. Rev. 12 (4), 501-517 (1999).</li><li>Kaur, R., Bachhawat, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+yeast+multidrug+resistance+pump,+Pdr5p,+confers+reduced+drug+resistance+in+erg+mutants+of+Saccharomyces+cerevisiae.">The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae.</a> Microbiology. 145, 809-818 (1999).</li><li>White, T. C., Marr, K. A., Bowden, R. A., cellular, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical,+cellular,+and+molecular+factors+that+contribute+to+antifungal+drug+resistance.">Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.</a> Clin. Microbiol. Rev. 11 (2), 382-402 (1998).</li><li>Serebriiskii, I. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+peptides,+proteins,+and+drugs+that+selectively+interact+with+protein+targets.">Detection of peptides, proteins, and drugs that selectively interact with protein targets.</a> Genome Res. 12, 1785-1791 (2002).</li><li>Yang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+role+for+PELP1+in+nonandrogenic+activation+of+the+androgen+receptor+in+prostate+cancer.">Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer.</a> Mol Endocrinol. 26 (4), 550-561 (2012).</li><li>Zhan, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+orphan+nuclear+receptor+Nur77+regulates+LKB1+localization+and+activates+AMPK.">The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK.</a> Nat Chem Biol. 8 (11), 897-904 (2012).</li></ol>

Keine Interessenskonflikte erklärt.

In unserer modifizierten Y2H-Assay haben wir wichtige Reste für Ketoconazol Interaktionen auf PXR 6 identifiziert. Seit SRC-1 ist ein Co-Aktivator (und wurde in die pGADNot kloniert), haben wir auch getestet, ob SRC-1 könnte lacZ-Expression, wenn sie in der PSH-Vektorsystem kloniert aktivieren und ob dies die Aktivierungsprofil ändern und / oder auf die Undichtigkeit die Hefe-Zwei-Hybrid-Assay. Mit unserem neu gestalteten Plasmide wir in ERG3 Δ / Δ ERG11 Hefe-Zwei-Hybrid-geführt Assays...

Das Hefe-Zwei-Hybrid (Y2H) Assay wird häufig verwendet, um Protein-Protein-Wechselwirkungen zu entdecken und vor kurzem zur Entdeckung von neuen kleinen Molekülen, die Protein-Protein-Wechselwirkung Komplexe 7, 8, 9, 10, 11 zu stören. Die herkömmlichen Ansätze dieses Tests, für die Wirkstoffforschung oder &quot;Treffer&quot; verwendet werden, nicht für die Detektion von allosterischen Interaktion Rückstände von Chemikalien, Verbindungen, die in Protein-Protein-Oberflächen, ermöglichen, dass, wenn noch verändert interagieren und ermöglichen eine Abfrage der geänderten Reste 11 . Tatsächlich ist ein solches Verfahren (e), wenn möglich, zu entwickeln, würde eine lenkbar Hefe-System für die Bewertung der allosterische Wechselwirkung Reste kritisch für die Protein-Protein-Wechselwirkung Unterbrechung zu ermöglichen. Im Rahmen der Wirkstoffentwicklung, würde der direkteste Weg zur Wechselwirkung der Verbindungen mit Proteinen herzustellen beinhalten Strukturbestimmung (z. B. Kristallisation von Protein-Inhibitor-Komplexes). Diese Methoden sind cumbersome verwenden aufwendigen Ressourcen und es technisch nicht möglich, Strukturuntersuchungen an jedem Protein durchzuführen. Tractable genetische Wirkstoff-Screening-Systeme in Bakterien 1, 2 und andere Modellsysteme wie Säugetier-Zwei-Hybrid etabliert. Allerdings müssen diese Systeme Optimierung und alternative Systeme wie Y2H sind immer noch die am meisten in der Wirkstoffforschung getestet. Es gibt Grenzen, die geringe Empfindlichkeit und Zuverlässigkeit der Wechselwirkungen mit singulären Methoden 13 enthalten, auf eine einzige Y2H-Assay modifiziert werden, um spezielle Fragen zu beantworten Interaktion Rückstände. Im Bereich der Kernrezeptorforschung Y2H wurde verwendet, um interagierende Proteine ​​14 definieren, jedoch sind diese Protein-Wechselwirkungen wurden selten verwendet worden, um die Art, in der die Liganden / Antagonisten die Interaktion mit nukleären Rezeptor-Protein-Komplexe bilden. Somit unserem Labor konzentriert Bemühungen auf eine Methode zu definieren, vor allem für Rezeptorproteine, die nichtleicht zu einer Proteom-basierte Verfahren, das wäre neuartige Ligand / Antagonist Interaktion Rückstände mit einem Reverse-Discovery-Plattform basierend Y2H auszugraben. Aufgrund unserer bisherigen Erkenntnis, dass Ketoconazol stört PXR und seine Aktivator SRC-1, entwickelten wir eine neuartige Umkehr Y2H System, das uns ermöglichen, auf PXR 6 zu definieren und zu verhören Ketoconazol Interaktion Rückstände. Unser Verfahren basiert auf den Eigenschaften des Hefe-GAL4-Protein, das von trennbaren Domänen für die DNA-Bindung und Transkriptionsaktivierung verantwortlich besteht basiert. PXR LBD-Protein als Fusion mit dem LexA-DNA-Bindungsdomäne (DNA-BD) ausgedrückt, während die volle Länge Coaktivatoren SRC-1 (Steroid-Rezeptor-Coaktivator 1) Proteine ​​als Fusionen mit der GAL4-Aktivierungsdomäne exprimiert (AD ). Die Interaktion zwischen PXR und SRC-1-Fusionsproteinen führt zur Transkriptionsaktivierung von GAL4-Bindungsstellen enthält Reportergen β-Lac Z, die in den Hefe-Genom integriert istE. Ketoconazol, ein PXR-Antagonisten, stört PXR und SRC-1-Wechselwirkung 15, 16, 17, und wir können die Wechselwirkung von PXR in Gegenwart oder Abwesenheit von Ketoconazol nach Färbung Kolonien auf den Filtern für die X-gal-Aktivität nachzuweisen und SRC-1. Das Prinzip der Y2H ist in Fig. 1 dargestellt und das experimentelle Verfahren ist in Fig. 2 zusammengefaßt.

<table border="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Yeast Strain CTY10-5d erg3&#916;/erg11&#916;</td>
			<td>Our lab</td>
			<td></td>
			<td>CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3&#916;/erg11&#916;) genes6 .</td>
		</tr>
		<tr>
			<td>YPD Growth Medium</td>
			<td>BD Biosciences</td>
			<td>630409</td>
			<td></td>
		</tr>
		<tr>
			<td>Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate</td>
			<td>BD Biosciences</td>
			<td>233520</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacto Agar</td>
			<td>BD Biosciences</td>
			<td>214010</td>
			<td></td>
		</tr>
		<tr>
			<td>CSM-His/-Leu Complete Supplement Mixture</td>
			<td>MP Biomedicals</td>
			<td>4250-412</td>
			<td></td>
		</tr>
		<tr>
			<td>ONPG (o-Nitrophenyl &#914;-D- Galactopyranoside).</td>
			<td>Sigma-Aldrich</td>
			<td>N1127</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Luria Broth (LB)</td>
			<td>Sigma-Aldrich</td>
			<td>L3022</td>
			<td></td>
		</tr>
		<tr>
			<td>X-Gal</td>
			<td>Fisher</td>
			<td>BP-1615</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicated Salmon Sperm DNA boiled (10 mg/ml)</td>
			<td>Life Technology</td>
			<td>156-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Acros Organics</td>
			<td>61177</td>
			<td></td>
		</tr>
		<tr>
			<td>Ketoconazole</td>
			<td>Sigma-Aldrich</td>
			<td>K1003</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N-Dimethylformamide</td>
			<td>Acros Organics</td>
			<td>326871000</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Sigma-Aldrich</td>
			<td>L4158</td>
			<td></td>
		</tr>
		<tr>
			<td>50% PEG-3350 solution, filter-sterilized</td>
			<td>Sigma-Aldrich</td>
			<td>P-3640</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose Membrane</td>
			<td>Whatman</td>
			<td>10402091</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm Petri Dish</td>
			<td>Fisher</td>
			<td>875712</td>
			<td></td>
		</tr>
		<tr>
		</tr>
	</tbody>
</table>

<table border="1">
	<tbody>
		<tr>
			<td>5&#39;-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD forward primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-AGAGTCGACTCAGCTA CCTGTGATGCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD reverse primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 forward primer for pGADNOT</td>
		</tr>
		<tr>
			<td>5&#39;-GCGGTCGACTTATTCAGTCA GTAGCTG -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 reverse primer for pGADNOT</td>
		</tr>
		<tr>
			<td>Platinum PCR Supermix</td>
			<td>Invitrogen</td>
			<td>11306-016</td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>our lab</td>
			<td>R0136</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>our lab</td>
			<td>R0138</td>
			<td></td>
		</tr>
		<tr>
			<td>NotI</td>
			<td>our lab</td>
			<td>R0189</td>
			<td></td>
		</tr>
	</tbody>
</table>

reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists

Als ein entscheidender Regulator des Arzneimittelstoffwechsel und Entzündung, Pregnane X-Rezeptor (PXR), spielt eine wichtige Rolle in der Pathophysiologie Krankheit Verknüpfung Stoffwechsel und Entzündungen (z. B. Fettleber) 1,2. Es hat viele Fortschritte bei der Identifizierung von Liganden für PXR-Agonisten, jedoch gibt es begrenzte Beschreibungen arzneimittelähnlichen Antagonisten und ihre Bindungsstellen auf PXR 3,4,5. Ein kritisches Hindernis war die Unfähigkeit, effizient reinigen Protein voller Länge für Strukturuntersuchungen mit Antagonisten obwohl PXR wurde 1998 kloniert und charakterisiert. Unser Labor entwickelt einen neuartigen Hochdurchsatz-Hefe-basierten Zwei-Hybrid-, ein Antagonist, Ketoconazol definieren, Bindungsreste auf PXR 6. Unsere Methode umfasst das Erstellen Mutations Bibliotheken, die die Wirkung der einzelnen Mutationen auf die AF-2 Oberfläche des PXR erwartet, dass mit Ketoconazol interagieren zu retten wäre. Rettung oder &quot;Gain-of-function&quot; second Mutationen vorgenommen, so daß Rückschlüsse auf die genetische Interaktion von Ketoconazol und der Oberflächenrest (e) auf PXR realisierbar werden. So entwickelten wir einen hohen Durchsatz Hefe-Zwei-Hybrid-Bildschirm des PXR Mutanten die Interaktion mit seinen Co-Aktivator, SRC-1. Mit diesem Ansatz, bei dem die Hefe wurde modifiziert, um die Untersuchung des Antimykotikums, Ketoconazol aufnehmen, könnten wir bestimmte Mutationen auf PXR in Klonen nicht auf Ketoconazol binden angereichert demonstrieren. Durch die umgekehrte Logik schließen wir, dass die Original-Reste sind direkte Interaktion Reste mit Ketoconazol. Dieser Test stellt eine neuartige, gefügig genetischen Test zum Screening auf-Antagonist-Bindungsstellen auf Kernrezeptor-Oberflächen. Dieser Assay kann zu jedem Medikament unabhängig von seiner zytotoxischen Potential, Hefe sowie zur zellulären Protein (e), die unter Verwendung von Standardstrukturbiologie oder Proteom-basierte Verfahren nicht untersucht werden können, angewendet werden. Mögliche Fallstricke beinhalten Interpretation der Daten (komplementäre Methoden sinnvoll), Zuverlässigkeitrung auf einzelne Y2H Verfahren, Know-how im Umgang mit Hefe-oder Durchführen Hefe-Zwei-Hybrid-Assays und Assay-Optimierung.

Wir führten einen Test, um zu sehen, ob wir ein farbmetrische Auslesen der Vereinigung von PXR und Steroid-Rezeptor Co-Aktivator-1 (SRC-1) zu erkennen. Da Hefe signifikante Sterol-Produktion, ist früher gezeigt worden, dass die lacZ-Expression in Hefe kann ohne die Notwendigkeit für zusätzliche exogene Liganden induziert werden. Wir fanden, dass lacZ-Expression (blaue Kolonien) ist auch in den Hefestamm mit PXR und SRC-1 transformiert induziert, jedoch gibt es keine Induktion des LacZ-Expression (weiße Kolonien) in...

Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Ketoconazol bindet und antagonisiert Pregnane X-Rezeptor (PXR) Aktivierung. Hefe-Hochdurchsatz-Screening von Mutanten PXR definieren eine einzigartige Region für Ketoconazol verbindlich. Diese Hefe-basierten genetischen Methode entdeckt neue Kernrezeptor-Interaktionen mit Liganden, die mit Oberflächenbindungsstellen zuordnen.

Reverse-Hefe-Zwei-Hybrid-System an Säugetier Nuclear Receptor Rückstände Identifizieren Sie, dass Interagieren Sie mit Liganden und / oder Antagonisten

As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking ...

reverse-yeast-two-hybrid-system-to-identify-mammalian-nuclear

Research

JoVE Journal

Biology

12.7K Aufrufe.  Albert Einstein College of Medicine.  Ketoconazol bindet und antagonisiert Pregnane X-Rezeptor (PXR) Aktivierung. Hefe-Hochdurchsatz-Screening von Mutanten PXR definieren eine einzigartige Region für Ketoconazol verbindlich. Diese Hefe-basierten genetischen Methode entdeckt neue Kernrezeptor-Interaktionen mit Liganden, die mit Oberflächenbindungsstellen zuordnen. 

Serie: Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Proteomics to Identify Proteins Interacting with P2X2 Ligand-Gated Cation Channels

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys loop, the glutamate-gated and the P2X receptor channels2. In each case binding of transmitter leads to the opening of a pore through which ions flow down their electrochemical gradients. Many ligand-gated channels are also permeable to calcium ions3, 4, which have downstream signaling roles5 (e.g. gene regulation) that may exceed the duration of channel opening. Thus ligand-gated channels can signal over broad time scales ranging from a few milliseconds to days. Given these important roles it is necessary to understand how ligand-gated ion channels themselves are regulated by proteins, and how these proteins may tune signaling. Recent studies suggest that many, if not all, channels may be part of protein signaling complexes6. In this article we explain how to identify the proteins that bind to the C-terminal aspects of the P2X2 receptor cytosolic domain.
P2X receptors are ATP-gated cation channels and consist of seven subunits (P2X1-P2X7). P2X receptors are widely expressed in the brain, where they mediate excitatory synaptic transmission and presynaptic facilitation of neurotransmitter release7. P2X receptors are found in excitable and non-excitable cells and mediate key roles in neuronal signaling, inflammation and cardiovascular function8. P2X2 receptors are abundant in the nervous system9 and are the focus of this study. Each P2X subunit is thought to possess two membrane spanning segments (TM1 &amp; TM2) separated by an extracellular region7 and intracellular N and C termini (Fig 1a)7. P2X subunits10 (P2X1-P2X7) show 30-50% sequence homology at the amino acid level11. P2X receptors contain only three subunits, which is the simplest stoichiometry among ionotropic receptors. The P2X2 C-terminus consists of 120 amino acids (Fig 1b) and contains several protein docking consensus sites, supporting the hypothesis that P2X2 receptor may be part of signaling complexes. However, although several functions have been attributed to the C-terminus of P2X2 receptors9 no study has described the molecular partners that couple to the intracellular side of this protein via the full length C-terminus. In this methods paper we describe a proteomic approach to identify the proteins which interact with the full length C-terminus of P2X2 receptors.

We describe a simple protocol to identify brain proteins that bind to the full length C terminus of ATP-gated P2X2 receptors. The extension and systematic application of this approach to all P2X receptors is expected to lead to a better understanding of P2X receptor signaling.

Proteomics, um Proteine ​​interagieren mit P2X2 Ligand-Gated Kationenkanäle Identifizieren

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys ...

Forschung

Biologie

Split-Ubiquitin Based Membrane Yeast Two-Hybrid (MYTH) System: A Powerful Tool For Identifying Protein-Protein Interactions

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput identification of protein-protein interactions (PPI) for full-length transmembrane proteins. To this end, our lab developed the split-ubiquitin based Membrane Yeast Two-Hybrid (MYTH) system. This technology allows for the sensitive detection of transient and stable protein interactions using Saccharomyces cerevisiae as a host organism. MYTH takes advantage of the observation that ubiquitin can be separated into two stable moieties: the C-terminal half of yeast ubiquitin (Cub) and the N-terminal half of the ubiquitin moiety (Nub). In MYTH, this principle is adapted for use as a 'sensor' of protein-protein interactions. Briefly, the integral membrane bait protein is fused to Cub which is linked to an artificial transcription factor. Prey proteins, either in individual or library format, are fused to the Nub moiety. Protein interaction between the bait and prey leads to reconstitution of the ubiquitin moieties, forming a full-length 'pseudo-ubiquitin' molecule. This molecule is in turn recognized by cytosolic deubiquitinating enzymes, resulting in cleavage of the transcription factor, and subsequent induction of reporter gene expression. The system is highly adaptable, and is particularly well-suited to high-throughput screening. It has been successfully employed to investigate interactions using integral membrane proteins from both yeast and other organisms.

Split-Ubiquitin Based Membrane Yeast Two-Hybrid MYTH System: A Powerful Tool For Identifying Protein-Protein Interactions

MYTH allows the sensitive detection of transient and stable interactions between proteins that are expressed in the model organism Saccharomyces cerevisiae. It has been successfully applied to study exogenous and yeast integral membrane proteins in order to identify their interacting partners in a high throughput manner.

Split-Ubiquitin Basierend Membrane Yeast Two-Hybrid (Mythos) System: Ein wirksames Instrument zur Ermittlung von Protein-Protein-Wechselwirkungen

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although the nuclear export of mRNA has been studied extensively in Xenopus oocytes1 and genetically tractable organisms such as yeast2 and the Drosophila derived S2 cell line3, few studies had been conducted in mammalian cells. Furthermore the kinetics of mRNA export in mammalian somatic cells could only be inferred indirectly4,5. In order to measure the nuclear export kinetics of mRNA in mammalian tissue culture cells, we have developed an assay that employs the power of microinjection coupled with fluorescent in situ hybridization (FISH). These assays have been used to demonstrate that in mammalian cells, the majority of mRNAs are exported in a splicing dependent manner6,7, or in manner that requires specific RNA sequences such as the signal sequence coding region (SSCR) 6. In this assay, cells are microinjected with either in vitro synthesized mRNA or plasmid DNA containing the gene of interest. The microinjected cells are incubated for various time points then fixed and the sub-cellular localization of RNA is assessed using FISH. In contrast to transfection, where transcription occurs several hours after the addition of nucleic acids, microinjection of DNA or mRNA allows for rapid expression and allows for the generation of precise kinetic data.

Here we describe an assay that employs the power of microinjection coupled with fluorescent in situ hybridization in order to accurately measure the nuclear export kinetics of mRNA in mammalian somatic cells.

Die Analyse der mRNA Nuclear Export Kinetics in Säugerzellen durch Mikroinjektion

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated tools and resources for studies in this system are facilitating continued discovery of genes with more subtle phenotypes or roles. 
Here we present a generalized protocol we adapted for identifying C. elegans genes with postembryonic phenotypes of interest using RNAi2. This procedure is easily modified to assay the phenotype of choice, whether by light or fluorescence optics on a dissecting or compound microscope. This screening protocol capitalizes on the physical assets of the organism and molecular tools the C. elegans research community has produced. As an example, we demonstrate the use of an integrated transgene that expresses a fluorescent product in an RNAi screen to identify genes required for the normal localization of this product in late stage larvae and adults. First, we used a commercially available genomic RNAi library with full-length cDNA inserts. This library facilitates the rapid identification of multiple candidates by RNAi reduction of the candidate gene product. Second, we generated an integrated transgene that expresses our fluorecently tagged protein of interest in an RNAi-sensitive background. Third, by exposing hatched animals to RNAi, this screen permits identification of gene products that have a vital embryonic role that would otherwise mask a post-embryonic role in regulating the protein of interest. Lastly, this screen uses a compound microscope equipped for single cell resolution.

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

We describe a sensitized method to identify postembryonic regulators of protein expression and localization in C. elegans using an RNAi-based genomic screen and an integrated transgene that expresses a functional, fluorescently tagged protein.

RNAi-Screening auf postembryonalen Phänotypen in Identifizieren C elegans</em

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated ...

Modified Yeast-Two-Hybrid System to Identify Proteins Interacting with the Growth Factor Progranulin

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role in a variety of physiologic and disease processes, including early embryogenesis, wound healing 1, inflammation 2, 3, and host defense 4. PGRN also functions as a neurotrophic factor 5, and mutations in the PGRN gene resulting in partial loss of the PGRN protein cause frontotemporal dementia 6, 7. Our recent studies have led to the isolation of PGRN as an important regulator of cartilage development and degradation 8-11. Although PGRN, discovered nearly two decades ago, plays crucial roles in multiple physiological and pathological conditions, efforts to exploit the actions of PGRN and understand the mechanisms involved have been significantly hampered by our inability to identify its binding receptor(s). To address this issue, we developed a modified yeast two-hybrid (MY2H) approach based on the most commonly used GAL4 based 2-hybrid system. Compared with the conventional yeast two-hybrid screen, MY2H dramatically shortens the screen process and reduces the number of false positive clones. In addition, this approach is reproducible and reliable, and we have successfully employed this system in isolating the binding proteins of various baits, including ion channel 12, extracellular matrix protein 10, 13, and growth factor14. In this paper, we describe this MY2H experimental procedure in detail using PGRN as an example that led to the identification of TNFR2 as the first known PGRN-associated receptor 14, 15.

We have modified the conventional yeast two-hybrid screening, an effective genetic tool in identifying protein interaction. This modification markedly shortens the process, reduces the workload, and most importantly, reduces the number of false positives. In addition, this approach is reproducible and reliable.

Modifizierten Hefe-Zwei-Hybrid-System, um Proteine ​​interagieren mit dem Growth Factor Progranulin Identifizieren

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

siRNA Screening zu Ubiquitin und Ubiquitin-ähnlichen System Regler der biologischen Stoffwechselwege in kultivierten Säugerzellen identifizieren

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine disruption. Estrogenic ligands include both natural and manmade &#34;Environmental Estrogens&#34; (EEs) found in many consumer goods including Personal Care Products (PCPs), plastics, pesticides, and foods. EEs disrupt hormone signaling in humans and other animals, potentially reducing fertility and increasing disease risk. Despite the importance of EEs and other Endocrine Disrupting Chemicals (EDCs) to public health, endocrine disruption is not typically included in undergraduate curricula. This shortcoming is partly due to a lack of relevant laboratory activities that illustrate the principles involved while also being accessible to undergraduate students. This article presents an optimized YES for quantifying ligands in personal care products that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates one of the two colorimetric substrates (ortho-nitrophenyl-&#946;-D-galactopyranoside (ONPG) or chlorophenol red-&#946;-D-galactopyranoside (CPRG)) that are cleaved by &#946;-galactosidase, a 6-day refrigerated incubation step to facilitate use in undergraduate laboratory courses, an automated application for LacZ calculations, and R code for the associated 4-parameter logistic regression analysis. The protocol has been designed to allow undergraduate students to develop and conduct experiments in which they screen products of their choosing for estrogen mimics. In the process, they learn about endocrine disruption, cell culture, receptor binding, enzyme activity, genetic engineering, statistics, and experimental design. Simultaneously, they also practice fundamental and broadly applicable laboratory skills, such as: calculating concentrations; making solutions; demonstrating sterile technique; serially diluting standards; constructing and interpolating standard curves; identifying variables and controls; collecting, organizing, and analyzing data; constructing and interpreting graphs; and using common laboratory equipment such as micropipettors and spectrophotometers. Thus, implementing this assay encourages students to engage in inquiry-based learning while exploring emerging issues in environmental science and health.

This article presents an optimized yeast estrogen screen for quantifying ligands in Personal Care Products (PCPs) that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates two colorimetric substrate options, a six-day refrigerated incubation for use in undergraduate courses, and statistical tools for data analysis.

Nachweis Estrogenic Liganden in Körperpflege-Produkte mit einer Hefe Östrogen Bildschirm optimiert für Undergraduate Teaching Labor

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine ...

A Flow Cytometry-based Assay to Identify Compounds That Disrupt Binding of Fluorescently-labeled CXC Chemokine Ligand 12 to CXC Chemokine Receptor 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling contributes to the progression of many diseases. The ligand/receptor pair CXC chemokine ligand 12 (CXCL12)/CXC chemokine receptor 4 (CXCR4) has raised significant clinical interest, for instance as a potential target for the treatment of cancer and inflammatory diseases. Small molecules as well as therapeutic antibodies that specifically target CXCR4 and inhibit the receptor&#39;s function are therefore considered to be valuable pharmacological tools. Here, a flow cytometry-based cellular assay that allows identification of compounds (e.g., small molecules) that abrogate CXCL12 binding to CXCR4, is described. Essentially, the assay relies on the competition for receptor binding between a fixed amount of fluorescently labeled CXCL12, the natural chemokine agonist for CXCR4, and unlabeled compounds. Hence, the undesirable use of radioactively labeled probes is avoided in this assay. In addition, living cells are used as the source of receptor (CXCR4) instead of cell membrane preparations. This allows easy adaptation of the assay to a plate format, which increases the throughput. This assay has been shown to be a valuable generic drug discovery assay to identify CXCR4-targeting compounds. The protocol can likely be adapted to other GPCRs, at least if fluorescently labeled ligands are available or can be generated. Prior knowledge concerning the intracellular signaling pathways that are induced upon activation of these GPCRs, is not required.

A flow cytometry-based cellular binding assay is described that is primarily used as a screening tool to identify compounds that inhibit the binding of a fluorescently labeled CXC chemokine ligand 12 (CXCL12) to the CXC chemokine receptor 4 (CXCR4).

Ein Flow Cytometry-basierte Assay, Verbindungen zu identifizieren, die Bindung von Eindringmittel beschriftet CXC-Chemokin-Liganden 12 an CXC-Chemokin-Rezeptor 4 stören

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling ...

Examination of Mitotic and Meiotic Fission Yeast Nuclear Dynamics by Fluorescence Live-cell Microscopy

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does not interfere with cell physiology, and requires minimal experimental handling. The low levels of technical interference enable researchers to study cells across multiple cycles of mitosis and to observe meiosis from beginning to end. Using fluorescent tags such as Green Fluorescent Protein (GFP) and Red Fluorescent Protein (RFP), researchers can analyze different factors whose functions are important for processes like transcription, DNA replication, cohesion, and segregation. Coupled with data analysis using Fiji (a free, optimized ImageJ version), live-cell imaging offers various ways of assessing protein movement, localization, stability, and timing, as well as nuclear dynamics and chromosome segregation. However, as is the case with other microscopy methods, live-cell imaging is limited by the intrinsic properties of light, which put a limit to the resolution power at high magnifications, and is also sensitive to photobleaching or phototoxicity at high wavelength frequencies. However, with some care, investigators can bypass these physical limitations by carefully choosing the right conditions, strains, and fluorescent markers to allow for the appropriate visualization of mitotic and meiotic events.

Here, we present live-cell imaging which is a non-toxic microscopy method that allows researchers to study protein behavior and nuclear dynamics in living fission yeast cells during mitosis and meiosis.

Untersuchung der Mitotic and Meiotic Fission Yeast Nuclear Dynamics durch Fluoreszenz-Livezellmikroskopie

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does ...

A Two-Step Strategy that Combines Epigenetic Modification and Biomechanical Cues to Generate Mammalian Pluripotent Cells

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe a new strategy that combines the use of chemical epigenetic erasing with mechanosensing-related cues, to generate mammalian pluripotent cells. Two main steps are required. In the first step, adult mature (terminally differentiated) cells are exposed to the epigenetic eraser 5-aza-cytidine to drive them into a pluripotent state. This part of the protocol was developed, based on the increasing understanding of the epigenetic mechanisms controlling cell fate and differentiation, and involves the use of the epigenetic modifier to erase cell differentiated state and then drive into a transient high plasticity window.
In the second step, erased cells are encapsulated in polytetrafluoroethylene (PTFE) micro-bioreactors, also known as Liquid Marbles, to promote 3D cell rearrangement to extend and stably maintain the acquired high plasticity. PTFE is a non-reactive hydrophobic synthetic compound and its use permits the creation of a cellular microenvironment, which cannot be achieved in traditional 2D culture systems. This system encourages and boosts the maintenance of pluripotency though bio-mechanosensing-related cues.
The technical procedures described here are simple strategies to allow for the induction and maintenance of a high plasticity state in adult somatic cells. The protocol allowed the derivation of high plasticity cells in all mammalian species tested. Since it does not involve the use of gene transfection and is free of viral vectors, it may represent a notable technological advance for translational medicine applications. Furthermore, the micro-bioreactor system provides a notable advancement in stem cell organoid technology by in vitro re-creating a specific micro-environment that allows for the long-term culture of high plasticity cells, namely as ESCs, iPSCs, epigenetically erased cells and MSCs.

We here present a method that combines the use of chemical epigenetic erasing with mechanosensing-related cues to efficiently generate mammalian pluripotent cells, without the need of gene transfection or retroviral vectors. This strategy is, therefore, promising for translational medicine and represents a notable advancement in stem cell organoid technology.

Eine zweistufige Strategie, die epigenetische Modifikation und biomechanische Hinweise kombiniert, um pluripotente Zellen von Säugetieren zu erzeugen

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe ...