Die Autoren erkennen die Robert W. Deutsch-Stiftung, die Defense Threat Reduction Agency (DTRA) und der National Science Foundation Frontiers in Schwellen Forschung und Innovation (EFRI) für finanzielle Unterstützung. Die Autoren danken auch dem Maryland und seine Nanocenter FabLab für Reinraumanlage Unterstützung.

1. Mikrofabrikation des mikrofluidischen Chips <ol><li> Bereiten Elektrochemische Chip <ol><li> Muster Goldelektroden <ol><li> Spülen Sie ein leeres 4 &#39;&#39; Silizium-Wafer (Grade-Qualität prime) mit Aceton, Methanol und Isopropanol (&quot;AMI&quot; sauber). Spülen Sie das Isopropanol aus dem Wafer mit deionisiertem Wasser (DI), gefolgt von Trocknen mit N 2 Pistole. </li><li> Wachsen eine 1 um dicke SiO 2-Passivierungsschicht mit plasmaunterstützte chemische Gasphasenabscheidung (PECVD)-Tool. Zahlen Sie 200 Å dicke Schicht aus Chrom, gefolgt von einer 2000 Å dicken Schicht aus Gold mit einem DC-Sputtern Werkzeug. </li><li> Spin &quot;PR1&quot; positive Photoresist (Spinnparameter: 3000 rpm, 1000 rpm / s, 30 s), um gleichmäßigen Film ~ 1,6 um dick zu erstellen. Pre-Bake-Wafers für 1 min bei 100 ° C auf einer heißen Platte. </li><li> Aussetzen des Wafers mit 190 mJ / cm 2 bei 405 nm durch eine Photomaske. Entwickeln Sie die Wafer für 30 Sekunden in 352 Entwicklereloper und spülen Sie die Wafer mit DI und trocken mit N 2 Pistole. </li><li> Ätzen der Gold mit Ätzmittel für 1,5 min. Ätzen der Chrom mit Chrom Ätzmittel für ~ 30 sek. Spülen des Wafers mit DI und trocken mit N 2 Pistole. </li><li> Streifen der Photolack mit &quot;AMI&quot; saubere Verfahren. HINWEIS: starkes Oxidationsmittel und potenziell explosiv. </li><li> Reinigen des Wafers mit 4: 1 H 2 SO 4: H 2 O 2-Gemisch (&quot;Piranha&quot; clean) für 1 min. Spülen des Wafers mit DI und trocken mit N 2 Pistole. </li></ol></li><li> Muster Platinelektroden <ol><li> Spin &quot;PR2&quot; positive Photoresist (Spinnparameter: 3000 rpm, 1000 rpm / s, 30 s), um gleichmäßigen Film ~ 1,4 um dick zu erstellen. Pre-Bake-Wafers für 1 min bei 100 ° C auf einer heißen Platte. </li><li> Aussetzen des Wafers mit 30 mJ / cm 2 bei 405 nm durch eine Photomaske. Backen Sie die Wafer für 45 Sekunden bei 125 ° C auf einer heißen Platte. Hochwasser aussetzender Wafer mit 1.000 mJ / cm 2 bei 405 nm Wellenlänge ohne eine Photomaske. Entwickeln Sie die Wafer für 2 min in 6: 1 AZ400K Entwickler und spülen Sie die Wafer mit DI und trocken mit N 2 Pistole. </li><li> Zahlen Sie 400 Å dicke Schicht aus Titan, gefolgt von einer 1600 Å dicken Schicht aus Platin mit einem Elektronenstrahl-Verdampfungssystem. </li><li> Abheben Photoresist in einem Acetonbad ultraschall für 5 Minuten, gefolgt von Spülen mit Aceton und Isopropanol. Spülen des Wafers mit DI und trocken mit N 2 Pistole. </li></ol></li></ol></li><li> Bereiten Assay Kanäle <ol><li> Bereiten Form für Assay-Kanäle <ol><li> Spülen Sie ein leeres 4 &#39;&#39; Silizium-Wafer (Test-Grade-Qualität) mit &quot;AMI&quot; saubere Verfahren. Spülen Sie das Isopropanol aus dem Wafer mit DI, gefolgt von Trocknen mit N 2 Pistole. </li><li> Spin &quot;PR3&quot; negative Photolack (2-Schritt-Spinnparameter:. Schritt eins - 600 min, 120 U / sec, 10 sec Schritt zwei - 1.150 rpm, 383 rpm / sec,27 sec) zu einheitlichen Film ~ 100 um dick zu erstellen. Pre-Bake-Wafers auf einer heißen Platte (2-Schritt-Backparameter:. Schritt eins - Rampe von Raumtemperatur bis 65 ° C bei 300 ° C / h, die Temperatur für 10 min Schritt 2 - Rampe bis zu 95 ° C bei 300 ° C / h, die Temperatur 30 min). </li><li> Aussetzen des Wafers mit 2500 mJ / cm 2 bei 405 nm durch eine Photomaske. Post-Bake-Wafers durch Rampen bis zu 95 ° C bei 300 ° C / h, die Temperatur für 10 min auf einer heißen Platte. Entwickeln Sie die Wafer für 10 min in Propylenglykolmonomethyletheracetat (PGMEA) Entwickler. Spülen Sie die Wafer mit Isopropanol reinigen und mit N 2 Pistole. </li></ol></li><li> Herzustellen Assay Kanäle <ol><li> Herstellung von 10: 1 Polydimethylsiloxan (PDMS)-Gemisch (20 g Elastomer, 2 g Härter) und vollständig entgasen in einer Vakuumkammer für 20 min. </li><li> Definieren Sie ein Gehäuse um die Form-Wafer mit Aluminiumfolie und gießen Sie langsam das nicht ausgehärtete PDMSüber die Form. </li><li> Backen Sie die Form mit den PDMS in einem Kammerofen (2-Schritt-Backparameter:. Schritt eins - 5 min Rampe von Raumtemperatur bis 80 ° C Schritt 2 - halten bei 80 ° C für 17 min). </li><li> Abziehen der PDMS von der Form nehmen und auf Aluminiumfolie. Schneiden Sie die Test-Chips mit einem Chirurgen Messer, definieren Löcher mit einer Biopsie-Stanzwerkzeug. </li></ol></li></ol></li></ol> 2. Bauen Sie die Geräte- <ol><li> Manuell ausrichten PDMS-Assay-Kanäle mit den Arbeitselektroden auf die elektrochemische Chip. PDMS haftet gut auf die elektrochemische Chip, Abdichten der Kanäle und verhindert Leckagen. </li><li> Schließen Sie einen flexiblen Schlauch (OD 0,087 &#39;und 0,015 ID&#39; &#39;), um ein Kunststoff Ellenbogen oder gerader Stecker mit einem kurzen flexiblen Schlauch als Adapter (OD 0,1875&#39; &#39;und 0,0625 ID&#39; &#39;). Befestigen Anschlüsse an jede der gelochten Einlässe in das Gerät. </li><li> Eine Spritze am anderen Endedie Schläuche und legen Sie die Spritze in einer Spritzenpumpe. Alternativ kann die Menge von einer Spritze, einem Rohr und einem Verbinder gemß der erforderlichen Verfahrensschritt in Abschnitt 3 und der entsprechenden Lösung zu ändern. </li></ol> 3. Analysieren DNA-Hybridisierung HINWEIS: Führen jedes Lösung langsam in den Kanal bei einer Fließgeschwindigkeit von 200 ul / h bis der gesamte Kanal gefüllt. <ol><li> Funktionalisieren jede vertikale Mikrokanal mit einer anderen ssDNA Sondensequenz (zuführen parallel zu den 3 separate vertikale Mikro): <ol><li> In jede Mikrokanal mit einer anderen ssDNA-Sonde inkubiert Lösung (10 mM Phosphatpuffer, 100 mM NaCl, 10 uM Tris (2-carboxyethyl) phosphin (TCEP) und 1 uM Sonde ssDNA), und Inkubation für 1 h, gefolgt von Spülen der Mikrokanal mit PBS. </li><li> Füllen des Mikrokanals mit einer Lösung, enthaltend 1 mM 6-Mercapto-1-hexanol (MCH) in einem Puffer aus 10 mM PBS, 100 mM NaCl und 1,395 mM TCEP und incuBeize für 1 h, gefolgt von Spülen der Mikrokanal mit PBS. </li></ol></li><li> Heben Sie die PDMS, um 90 ° in eine horizontale Ausrichtung, und legen bis zu getrennten Reihen von Reaktionskammern mit jeder Zeile mit einer eindeutigen Zähler und Referenzelektrode (Abbildung S1) aus. </li><li> Füllen Sie die Mikrokanäle mit Steuermesslösung von 4x konzentrierte Salz-Natriumcitrat (SSC)-Puffer und Inkubation für 20 min. </li><li> Hintergrundmessung: Füllen Sie die Mikrokanäle mit 5 mM Ferricyanid / 5 mM Ferrocyanid in PBS-Lösung und notieren Sie die Impedanzwerte der elektrochemischen System für verschiedene Frequenzen (elektrochemische Impedanzspektroskopie, EIS) mit Hilfe eines Potentiostaten an die Arbeits, Zähler verbunden und Referenzelektroden ( EIS-Parameter: Frequenzbereich von 1 MHz bis 0,1 Hz, 10 Frequenzdatenpunkte pro Jahrzehnt, 25 mV Amplitude, 5 mV Polarisation gegenüber der Referenzelektrode). Wiederholen Sie diese Messung für jeden Arbeitselektrode in den Mikrokanälen. </li&gt; <li> Messung der DNA-Hybridisierung (zuführen für jede nicht-komplementären und komplementären ssDNA-Ziel). <ol><li> Füllen Sie die Mikrokanäle mit Ziel ssDNA Messlösung von 4x konzentriert SSC-Puffer mit 1 uM der Ziel ssDNA, und Inkubation für 20 min. Messung der DNA nach Schritt 3.4. </li></ol></li></ol>

<ol>
	<li>Hong, J., Edel, J. B., deMello, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micro-+and+nanofluidic+systems+for+high-throughput+biological+screening.">Micro- and nanofluidic systems for high-throughput biological screening.</a> Drug Discov. Today. 14, 134-146 (2009).</li><li>Sun, Y., Kwok, Y. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymeric+microfluidic+system+for+DNA+analysis.">Polymeric microfluidic system for DNA analysis.</a> Anal. Chim. Acta. 556, 80-96 (2006).</li><li>Xu, Y., Yang, X., Wang, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review:+aptamers+in+microfluidic+chips.">Review: aptamers in microfluidic chips.</a> Anal. Chim. Acta. 683, 12-20 (2010).</li><li>Yang, W., Woolley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+multiprocess+microfluidic+systems+for+automating+analysis.">Integrated multiprocess microfluidic systems for automating analysis.</a> J. Lab. Automat. 15, 198-209 (2010).</li><li>Gervais, T., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mass+transport+and+surface+reactions+in+micro&#64258;uidic+systems.">Mass transport and surface reactions in micro&#64258;uidic systems.</a> Chem. Eng. Sci. 61, 1102-1121 (2006).</li><li>Song, H., Ismagilov, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond+kinetics+on+a+microfluidic+chip+using+nanoliters+of+reagents.">Millisecond kinetics on a microfluidic chip using nanoliters of reagents.</a> J. Am. Chem. Soc. 125, 14613-14619 (2003).</li><li>Jiang, H., Weng, X. A., Li, D. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+whole-blood+immunoassays.">Microfluidic whole-blood immunoassays.</a> Microfluid. Nanofluid. 10, 941-964 (2011).</li><li>Dutse, S. W., Yusof, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics-based+lab-on-chip+systems+in+DNA-based+biosensing:+an+overview.">Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview.</a> Sensors. 11, 5754-5768 (2011).</li><li>Dittrich, P. S., Manz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lab-on-a-chip:+microfluidics+in+drug+discovery.">Lab-on-a-chip: microfluidics in drug discovery.</a> Nat. Rev. Drug Discov. 5, 210-218 (2006).</li><li>Craighead, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Future+lab-on-a-chip+technologies+for+interrogating+individual+molecules.">Future lab-on-a-chip technologies for interrogating individual molecules.</a> Nature. 442, 387-393 (2006).</li><li>Hunt, H. K., Armani, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+biological+and+chemical+sensors.">Label-free biological and chemical sensors.</a> Nanoscale. 2, 1544-1559 (2010).</li><li>Dukkipati, V. R., Pang, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+microfluidic+system+for+DNA+analysis.">Integrated microfluidic system for DNA analysis.</a> IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).</li><li>Fang, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+microfluidic+devices+with+concurrent+electrochemical+detection.">Real-time PCR microfluidic devices with concurrent electrochemical detection.</a> Biosens. Bioelectron. 24, 2131-2136 (2009).</li><li>Pavlovic, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+device+architecture+for+electrochemical+patterning+and+detection+of+multiple+DNA+sequences.">Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences.</a> Langmuir. 24, 1102-1107 (2008).</li><li>Xu, X., Zhang, S., Chen, H., Kong, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+electrochemistry+in+micro-total+analysis+systems+for+biochemical+assays:+recent+developments.">Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments.</a> Talanta. 80, 8-18 (2009).</li><li>Cai, H., Lee, T. M. -. H., Hsing, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+protein+recognition+using+an+aptamer-based+impedance+measurement+assay.">Label-free protein recognition using an aptamer-based impedance measurement assay.</a> Sensor. Actuat. B-Chem. 114, 433-437 (2006).</li><li>Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic+device+for+impedance+spectroscopy+analysis+of+biological+samples.">A Microfluidic device for impedance spectroscopy analysis of biological samples.</a> Sensor. Actuat. B-Chem. 123, 168-176 (2007).</li><li>Prakash, S. B., Abshire, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+cancer+cell+proliferation+on+a+CMOS+capacitance+sensor+chip.">Tracking cancer cell proliferation on a CMOS capacitance sensor chip.</a> Biosens. Bioelectron. 23, 1449-1457 (2008).</li><li>Yamaguchi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+fabrication+of+electrochemical+enzyme+sensor+chip+using+polydimethylsiloxane+microfluidic+channel.">Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel.</a> Anal. Chim. Acta. 468, 143-152 (2002).</li><li>Beebe, D. J., Mensing, G. A., Walker, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physics+and+applications+of+microfluidics+in+biology.">Physics and applications of microfluidics in biology.</a> Annu. Rev. Biomed. Eng. 4, 261-286 (2002).</li><li>Mariella, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preparation:+the+weak+link+in+microfluidics-based+biodetection.">Sample preparation: the weak link in microfluidics-based biodetection.</a> Biomed. Microdevices. 10, 777-784 (2008).</li><li>Bhushan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Springer handbook of nanotechnology. , (2010).</li><li>Ghallab, Y. H., Badawy, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab-on-a-chip: Techniques, circuits, and biomedical applications. , (2010).</li><li>Chee, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accessing+genetic+information+with+high-density+DNA+arrays.">Accessing genetic information with high-density DNA arrays.</a> Science. 25, 610-614 (1996).</li><li>Ma, K. -. S., Zhou, H., Zoval, J., Madou, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+hybridization+detection+by+label+free+versus+impedance+amplifying+label+with+impedance+spectroscopy.">DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy.</a> Sensor. Actuat. B-Chem. 114, 58-64 (2006).</li><li>Ito, T., Hosokawa, K., Maeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+single-base+mismatch+at+distal+end+of+DNA+duplex+by+electrochemical+impedance+spectroscopy.">Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy.</a> Biosens. Bioelectron. 22, 1816-1819 (2007).</li><li>Kao, L. T. -. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+detection+and+differentiation+of+the+DNA+strains+for+influenza+A+(H1N1+2009)+using+a+silicon-based+microfluidic+system.">Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system.</a> Biosens. Bioelectron. 26, 2006-2011 (2011).</li><li>Li, J., Chen, S., Evans, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Typing+and+subtyping+influenza+virus+using+DNA+microarrays+and+multiplex+reverse+transcriptase+PCR.">Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR.</a> J. Clin. Microbiol. 39, 696-704 (2001).</li><li>Gautier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybridization-induced+interfacial+changes+detected+by+non-faradaic+impedimetric+measurements+compared+to+faradaic+approach.">Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach.</a> J. Electroanal. Chem. 610, 227-233 (2007).</li><li>Ma, Y., Jiao, K., Yang, T., Sun, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensitive+PAT+gene+sequence+detection+by+nano-SiO2/p-aminothiophenol+self-assembled+films+DNA+electrochemical+biosensor+based+on+impedance+measurement.">Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement.</a> Sensor. Actuat. B-Chem. 131, 565-571 (2008).</li><li>Kim, J. H. -. S., Marafie, A., Jia, X. -. Y., Zoval, J. V., Madou, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+DNA+hybridization+kinetics+in+a+microfluidic+flow+channel.">Characterization of DNA hybridization kinetics in a microfluidic flow channel.</a> Sensor. Actuat. B-Chem. 113, 281-289 (2006).</li><li>Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+electrochemical+sensor+array+for+characterizing+protein+interactions+with+various+functionalized+surfaces.">Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces.</a> Anal. Chem. 83, 5920-5927 (2011).</li><li>Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic-based+electrochemical+biochip+for+label-free+diffusion-restricted+DNA+hybridization+analysis.">A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis.</a> Biosens. Bioelectron. 38, 114-120 (2012).</li><li>Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-assembled+monolayers+for+biosensors.">Self-assembled monolayers for biosensors.</a> Analyst. 122, 43R-50R (1997).</li><li>McEwen, G. D., Chen, F., Zhou, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization,+hybridization,+and+oxidation+of+synthetic+DNA+on+gold+surface:+Electron+transfer+investigated+by+electrochemistry+and+scanning+tunneling+microscopy.">Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy.</a> Anal. Chim. Acta. 643, 26-37 (2009).</li><li>Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+surface+charging+during+the+coadsorption+of+mercaptohexanol+to+DNA+layers+on+gold:+Direct+observation+of+desorption+and+layer+reorientation.">The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation.</a> Langmuir. 22, 5560-5562 (2006).</li><li>Katz, E., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+biomolecular+interactions+at+conductive+and+semiconductive+surfaces+by+impedance+spectroscopy:+Routes+to+impedimetric+immunosensors,+DNA-sensors,+and+enzyme+biosensors.">Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors.</a> Electroanalysis. 15, 913-947 (2003).</li></ol>

Die Autoren haben nichts zu offenbaren.

Unsere Verfahren zeigen die Herstellung eines mikrofluidischen Basis elektro Biochip und seine Verwendung für die DNA-Hybridisierungsereignissen Analyse. Durch eine hohe Ausbeute gesteuert Mikroprozess entwickeln wir ein Gerät der Mikrokanäle mit einer Reihe von elektrochemischen Wandler integriert zusammen. Wir haben gesteuerten Bearbeitungsparameter für die Photolithographie Verfahren der elektrochemischen Chip und der mikrofluidischen Kanal Form durch einen iterativen Ansatz entwickelt. Diese Schritte stellen Lei...

Mikrofluidischen Lab-on-a-Chip (LOC)-Geräte bieten zahlreiche Vorteile in der klinischen Diagnostik, der Umweltüberwachung und der biomedizinischen Forschung. Diese Vorrichtungen verwenden mikrofluidische Kanäle, um eine Fluidströmung zu Bereichen des Chips, wo eine Vielzahl von Verfahren, einschließlich Mischen Reagens, bezogen Affinität bindende, Signaltransduktion und der Zellkulti 1-4 erfolgen steuern. Mikrofluidik bietet viele Vorteile gegenüber herkömmlichen klinischen Diagnosewerkzeuge wie Mikrotiterplatte Leser oder Elektrophorese-Gel-Shift-Assays. Mikrofluidik-Vorrichtungen erfordern 2 bis 3 Grßenordnungen (Nanolitern, im Gegensatz zu Mikroliter) weniger Reagenzien ähnliche Tests durchzuführen. Auch können diese Geräte die Geschwindigkeit, mit der einige biologische Ereignisse aufgrund der kleineren Haft der Arten innerhalb der Kanäle 5,6 zu erhöhen. Drittens können Sensoren in Mikrofluidikeinheiten mittels Lithographie und Ätzverfahren, die markierungsfreie Erken bieten können integriert werdenn. Schließlich sind diese Vorrichtungen kostengünstig in der Herstellung und erfordern wenig Aufwand seitens des Technikers zu bedienen 7-10. Markierungsfreien Detektion wird typischerweise unter Verwendung eines optischen oder elektrischen Wandlers. Optische Vorrichtungen besser Sensorleistung aufgrund der geringeren Beeinträchtigung Analyten in der Probe vorliegt. Dennoch ist ihre Leistung in Fällen, in denen die Proben Hintergrund die gleiche Resonanzwellenlänge als Sensor 11 beeinträchtigt werden. Es gibt viele Vorteile bei der Verwendung von elektrischen Signalen, um biologische und chemische Nachweis in mikrofluidischen Systemen durchzuführen. Die Herstellung von sich aus weniger kompliziert, da diese Sensoren in der Regel nur erforderlich strukturierten Elektroden zu bedienen. Zusätzlich können elektrische Signale direkt mit den meisten Messvorrichtung verbunden werden, während eine andere Signal Modalitäten kann ein Wandler erforderlich, um das Signal umzuwandeln 12-15. Elektrische Sensoren häufig Veränderungen in impedanc messenE 16,17, Kapazität 18, 19 oder Redox-Aktivität. Allerdings werden vor neue Herausforderungen gestellt, wie diese Systeme miniaturisiert werden. Die wichtigsten Herausforderungen zu meistern sind: Probenvorbereitung und Mischen von Flüssigkeiten (aufgrund der geringen Probenvolumen und Reynolds-Zahl), physikalische und chemische Effekte (einschließlich Kapillarkräfte, Oberflächenrauhigkeit, chemische Wechselwirkungen zwischen Baumaterialien und Analyten), niedrige signal Rausch-Verhältnis 20-23 und mögliche Interferenz von elektroaktiven Analyten in komplexen biologischen Proben (zB Blut und Speichel) (durch die verringerte Oberfläche und Volumen) gemessen. Weitere Untersuchungen dieser Effekte wird Richtlinien für eine genaue Fertigung und des Betriebs dieser Geräte in einer reproduzierbaren Art und Weise, auf die Gesamtleistung verbessern würde. DNA-Hybridisierungsdetektion wird weitgehend verwendet, um genetische Erkrankungen 24,25 und verschiedene Formen von Canc diagnostizierenER 26. Jedes Jahr werden mehrere Stämme der Influenza bei Patienten, die Ergebnisse von DNA-Hybridisierungstechniken 27 identifiziert. Das Influenza-Virus allein entfallen 36.000 Todesfälle pro Jahr in den Vereinigten Staaten 28. Solche Beispiele könnten von einer Tisch-Mikrofluid-Vorrichtung, die die gleichen Testverfahren wie einem Plattenleser oder ein Gel-Shift-Assay mit geringen Probenvolumen und zu einem Bruchteil der Kosten, ohne die Empfindlichkeit oder Spezifität führen kann profitieren. Aufgrund der vielen Vorteile der markierungsfreien elektrochemischen Sensor, es wurde ausgiebig für den Nachweis von DNA-Hybridisierungsereignissen 29,30 verwendet. Ein Setup, wo Makro-Skala Elektroden (im Millimeterbereich) in Bechergläser mit der Lösung von Interesse getaucht werden können, verwendet werden, um sehr sensible Daten über die Bindung Kinetik von Einzelstrang-DNA-Sequenzen auf ihre passenden komplementären Sequenzen liefern. Kürzlich gab es ein paar Fortschritte bei der Einbeziehung elektrochemischen Mess in MICRofluidics für die DNA-Hybridisierung. Es wurden Studien durchgeführt über Hybridisierungskinetik 31 und Integration von Sensoren für die Erkennung 15 in mikrofluidischen Kanälen. Allerdings gibt es immer noch einen Bedarf für eine schnelle Hochdurchsatz-Mikrofluid-Gerät, das DNA-Hybridisierungsereignisse parallel analysieren kann, ohne komplizierte Probenvorbereitungsschritte. Die in dieser Arbeit vorgestellten Vorrichtung ist eine Plattform, die mehrere Wechselwirkungen, die parallel und ohne aufwendige Probenvorbereitungsschritte durchmustert werden können. Unser Protokoll zeigt, wie Mikrofluidik-basierten elektrochemische Biochips sind mit mikroelektromechanische Systeme (MEMS)-Technologie 32,33 mikrofabriziert. Wir beschreiben den Herstellungsprozeß sowohl des mikrofluidischen Chips von Polydimethylsiloxan (PDMS) und die elektrochemische Chip, der eine Anordnung von Elektroden umfasst. Die chemische Funktionalisierung des Biochips mit ssDNA-Sonden wird ebenfalls angesprochen. Schließlich wird die Abilkeit des Biosensors speziell zu erkennen und zu analysieren, ssDNA Ziele demonstriert. Insgesamt ist die mikrofluidische Basis elektro Biochip eine schnelle und hohe Durchsatzanalyse-Technik. Es kann verwendet werden, um Wechselwirkungen zwischen biologischen Molekülen und Durchführung Wandler zu untersuchen, und können in einer Vielzahl von Lab-on-a-Chip-Anwendungen verwendet werden.

<table border="0" cellpadding="0" cellspacing="0" width="765">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:155px;">Company</td>
			<td style="width:227px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Material</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4&#39;&#39; Silicon wafer</td>
			<td style="width:155px;">Ultrasil</td>
			<td style="width:227px;">4-5664</td>
			<td>Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm*cm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Shipley 1813 photoresist (&#34;PR1&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">AZ5214 photoresist (&#34;PR2&#34;)</td>
			<td style="width:155px;">Hoechst Celanse</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SU-8 50 photoresist (&#34;PR3&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">negative photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gold etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">TFA</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chromium etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">1020AC</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS elastomer</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097366 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS curing agent</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097358 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Biopsy punching tool</td>
			<td style="width:155px;">Healthlink</td>
			<td style="width:227px;">BP20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible tubing</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">R 3603</td>
			<td>.015&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible adapter</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">06417-41</td>
			<td>.0625&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">1 mL syringe</td>
			<td style="width:155px;">Beckton-Dickenson</td>
			<td align="right" style="width:227px;">301025</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Monobasic potassium phosphate</td>
			<td style="width:155px;">Fluka</td>
			<td align="right" style="width:227px;">1551139</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium phosphate dibasic anhydrous</td>
			<td style="width:155px;">Sigma</td>
			<td style="width:227px;">RES20765-A7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium chloride</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:227px;">S7653</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">tris(2-carboxyethyl)phosphine</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">C4706</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">6-mercapto-1-hexanol</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">451088</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">20x concentrated saline-sodium citrate buffer</td>
			<td style="width:155px;">Sigma</td>
			<td align="right" style="width:227px;">93017</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium hexacyanoferrate(III)</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">455946</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium ferrocyanide</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">CDS001589</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/AAAGCTCCGATAGCGCTCCG 
			TGGACGTCCC-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-GGGACGTCCACGGAGCGCTA 
			TCGGAGCTTT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA 
			ATCGATGAGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-ACTCATCGATTCGTCAATGA 
			CCTGACCCGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA 
			CCCATGATGA-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-TCATCATGGGTCTAACTACT 
			GGATCTAGGT-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Instrument</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Plasma Enhanced Chemical Vapor Deposition (PECVD)</td>
			<td style="width:155px;">Oxford Instruments</td>
			<td style="width:227px;">PlasmaLab System 100</td>
			<td>Chamber pressure 1000 mTorr, Tempreture 200 celsius degrees, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Angstrom/minute.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DC sputtering unit</td>
			<td style="width:155px;">AJA International</td>
			<td style="width:227px;">ATC 1800-V</td>
			<td>For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">E-beam evaporation system</td>
			<td style="width:155px;">Denton</td>
			<td style="width:227px;">Custom-built</td>
			<td>For Titanium: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 6-10 Angstrom/second. For Platinum: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 2-3 Angstrom/second.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Potentiostat</td>
			<td style="width:155px;">CH Instruments</td>
			<td style="width:227px;">660D</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Syringe pump</td>
			<td style="width:155px;">KD Scientific</td>
			<td style="width:227px;">KDS230</td>
			<td></td>
		</tr>
	</tbody>
</table>

a microfluidic-based electrochemical biochip for label-free dna hybridization analysis

Miniaturisierung von analytischen Laborbedingungen in den Mikromaßstab bietet erhebliche Vorteile in Bezug auf die Reaktionszeit, der Kosten und der Integration von Vorverarbeitungsschritte. Verwendung dieser Vorrichtungen zur Analyse von DNA-Hybridisierungsereignisse ist wichtig, weil es eine Technologie zur Echtzeit-Beurteilung von Biomarkern am Point-of-Care für verschiedene Krankheiten. Wenn die Vorrichtung Grundfläche verringert jedoch die Dominanz der verschiedenen physikalischen Erscheinungen zu. Diese Phänomene beeinflussen die Fertigungsgenauigkeit und Betriebssicherheit der Vorrichtung. Daher besteht ein großer Bedarf zur genauen Herstellung und Betrieb dieser Geräte in einer reproduzierbaren Weise, um die Gesamtleistung zu verbessern. Hier beschreiben wir die Protokolle und die für die Herstellung und den Betrieb eines Mikrofluidbasis elektro Biochips für die genaue Analyse von DNA-Hybridisierungsereignissen Methoden. Der Biochip besteht aus zwei Teilen: einem Mikrofluid-Chip mitdrei parallele Mikrokanäle aus Polydimethylsiloxan (PDMS) hergestellt, und ein 3 x 3 Feld aus elektrochemischen Mikrochip. Die DNA-Hybridisierungsereignisse werden durch elektrochemische Impedanzspektroskopie (EIS)-Analyse nachgewiesen. Die EIS-Analyse ermöglicht die Überwachung Variationen der Eigenschaften des elektrochemischen Systems, das dominant in diesen Längenskalen sind. Mit der Fähigkeit, Änderungen sowohl Ladungstransfer und Diffusionswiderstand mit dem Biosensor zu überwachen, die Selektivität für komplementäre ssDNA Ziele, eine berechnete Nachweisgrenze von 3,8 nm und eine 13% Kreuzreaktivität mit anderen, nicht-komplementäre ssDNA folgenden 20 min zeigen wir, Inkubation. Diese Methode kann die Leistung von miniaturisierten Geräten durch die Aufklärung über das Verhalten der Diffusion auf der Mikroskala Regime und durch Aktivieren der Untersuchung von DNA-Hybridisierungsereignissen zu verbessern.

Eine steuerbare und genaue Herstellungsverfahren für die Versuchsvorrichtung ist wesentlich, in der Forschung. Es erlaubt Forschern, reproduzierbare und Hochdurchsatz-Experimenten erhalten. Hier haben wir eine hohe Ausbeute, hohe Reproduzierbarkeit Mikroprozess eines mikrofluidischen Biochip-basierten elektrochemischen (Abbildung 1) gezeigt. Mit einer niedrigen Ausfallrate haben nur wenige Geräte Haft Fragen, die Leckage Lösung führen gezeigt. Um die elektrochemische Aktivität des Biochips zu valid...

Watch this Scientific Journal Video about A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis at JoVE.com

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Wir präsentieren einen mikrofluidischen Biochip-basierten elektrochemischen DNA-Hybridisierung für Erkennung. Folgende ssDNA-Sonde Funktionalisierung werden die Spezifität, Empfindlichkeit und Nachweisgrenze mit komplementären und nicht-komplementären ssDNA Ziele untersucht. Ergebnisse veranschaulichen den Einfluss der DNA-Hybridisierungsereignisse auf dem elektrochemischen System, mit einer Nachweisgrenze von 3,8 nM.

Einem mikrofluidischen Biochip-basierte Elektrochemische für Markierungsfreie DNA-Hybridisierungsanalyse

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

a-microfluidic-based-electrochemical-biochip-for-label-free-dna

Research

JoVE Journal

Bioengineering

17.0K Aufrufe.  University of Maryland.  Wir präsentieren einen mikrofluidischen Biochip-basierten elektrochemischen DNA-Hybridisierung für Erkennung. Folgende ssDNA-Sonde Funktionalisierung werden die Spezifität, Empfindlichkeit und Nachweisgrenze mit komplementären und nicht-komplementären ssDNA Ziele untersucht. Ergebnisse veranschaulichen den Einfluss der DNA-Hybridisierungsereignisse auf dem elektrochemischen System, mit einer Nachweisgrenze von 3,8 nM. 

Serie: A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

A Microfluidic-based Hydrodynamic Trap for Single Particles

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science. Methods for particle trapping based on optical, magnetic, electrokinetic, and acoustic techniques have led to major advancements in physics and biology ranging from the molecular to cellular level. In this article, we introduce a new microfluidic-based technique for particle trapping and manipulation based solely on hydrodynamic fluid flow. Using this method, we demonstrate trapping of micro- and nano-scale particles in aqueous solutions for long time scales. The hydrodynamic trap consists of an integrated microfluidic device with a cross-slot channel geometry where two opposing laminar streams converge, thereby generating a planar extensional flow with a fluid stagnation point (zero-velocity point). In this device, particles are confined at the trap center by active control of the flow field to maintain particle position at the fluid stagnation point. In this manner, particles are effectively trapped in free solution using a feedback control algorithm implemented with a custom-built LabVIEW code. The control algorithm consists of image acquisition for a particle in the microfluidic device, followed by particle tracking, determination of particle centroid position, and active adjustment of fluid flow by regulating the pressure applied to an on-chip pneumatic valve using a pressure regulator. In this way, the on-chip dynamic metering valve functions to regulate the relative flow rates in the outlet channels, thereby enabling fine-scale control of stagnation point position and particle trapping. The microfluidic-based hydrodynamic trap exhibits several advantages as a method for particle trapping. Hydrodynamic trapping is possible for any arbitrary particle without specific requirements on the physical or chemical properties of the trapped object. In addition, hydrodynamic trapping enables confinement of a "single" target object in concentrated or crowded particle suspensions, which is difficult using alternative force field-based trapping methods. The hydrodynamic trap is user-friendly, straightforward to implement and may be added to existing microfluidic devices to facilitate trapping and long-time analysis of particles. Overall, the hydrodynamic trap is a new platform for confinement, micromanipulation, and observation of particles without surface immobilization and eliminates the need for potentially perturbative optical, magnetic, and electric fields in the free-solution trapping of small particles.

In this article, we present a microfluidic-based method for particle confinement based on hydrodynamic flow. We demonstrate stable particle trapping at a fluid stagnation point using a feedback control mechanism, thereby enabling confinement and micromanipulation of arbitrary particles in an integrated microdevice.

Einem mikrofluidischen-basierte Hydrodynamische Trap für einzelne Teilchen

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Forschung

Biotechnik

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

Herstellung von elektrochemischen DNA Biosensoren für die Reagenzienfreier Nachweis von Nukleinsäuren, Proteinen und kleinen Molekülen

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Non-contact, Label-free Monitoring of Cells and Extracellular Matrix using Raman Spectroscopy

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, currently available routine methods require processing steps and alter sample integrity. Raman spectroscopy is a fast method that enables the measurement of biological samples without the need for further processing steps. This laser-based technology detects the inelastic scattering of monochromatic light.6 As every chemical vibration is assigned to a specific Raman band (wavenumber in cm-1), each biological sample features a typical spectral pattern due to their inherent biochemical composition.7-9 Within Raman spectra, the peak intensities correlate with the amount of the present molecular bonds.1 Similarities and differences of the spectral data sets can be detected by employing a multivariate analysis (e.g. principal component analysis (PCA)).10
Here, we perform Raman spectroscopy of living cells and native tissues. Cells are either seeded on glass bottom dishes or kept in suspension under normal cell culture conditions (37 &deg;C, 5% CO2) before measurement. Native tissues are dissected and stored in phosphate buffered saline (PBS) at 4 &deg;C prior measurements. Depending on our experimental set up, we then either focused on the cell nucleus or extracellular matrix (ECM) proteins such as elastin and collagen. For all studies, a minimum of 30 cells or 30 random points of interest within the ECM are measured. Data processing steps included background subtraction and normalization.

Raman spectroscopy is a suitable technique for the non-contact, label-free analysis of living cells, tissue-engineered constructs and native tissues. Source-specific spectral fingerprints can be generated and analyzed using multivariate analysis.

Berührungslose, Label-freie Überwachung von Zellen und extrazellulären Matrix mittels Raman-Spektroskopie

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, ...

Hollow Microneedle-based Sensor for Multiplexed Transdermal Electrochemical Sensing

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals suffering from chronic medical conditions facile assessment of their immediate physiological state. Furthermore, it could serve as a research tool for analysis of complex, multifactorial medical conditions. In order for such a multianalyte sensor to be realized, it must be minimally invasive, sampling of interstitial fluid must occur without pain or harm to the user, and analysis must be rapid as well as selective.
Initially developed for pain-free drug delivery, microneedles have been used to deliver vaccines and pharmacologic agents (e.g., insulin) through the skin.1-2 Since these devices access the interstitial space, microneedles that are integrated with microelectrodes can be used as transdermal electrochemical sensors. Selective detection of glucose, glutamate, lactate, hydrogen peroxide, and ascorbic acid has been demonstrated using integrated microneedle-electrode devices with carbon fibers, modified carbon pastes, and platinum-coated polymer microneedles serving as transducing elements.3-7,8
This microneedle sensor technology has enabled a novel and sophisticated analytical approach for in situ and simultaneous detection of multiple analytes. Multiplexing offers the possibility of monitoring complex microenvironments, which are otherwise difficult to characterize in a rapid and minimally invasive manner. For example, this technology could be utilized for simultaneous monitoring of extracellular levels of, glucose, lactate and pH,9 which are important metabolic indicators of disease states7,10-14 (e.g., cancer proliferation) and exercise-induced acidosis.15

This article details the construction of a multiplexed microneedle-based sensor. The device is being developed for in situ sampling and electrochemical analysis of multiple analytes in a rapid and selective manner. We envision clinical medicine and biomedical research uses for these microneedle-based sensors.

Hohle Mikronadel-basierten Sensor für Multiplex Transdermale elektrochemische Nachweis

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

Bakterielle Erkennung und Identifizierung mit elektrochemischen Sensoren

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Multi-analyte Biochip (MAB) Based on All-solid-state Ion-selective Electrodes (ASSISE) for Physiological Research

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) that can withstand prolonged storage in complex biological media 1-4. An all-solid-state ion-selective-electrode (ASSISE) is especially attractive for the aforementioned applications. The electrode should have the following favorable characteristics: easy construction, low maintenance, and (potential for) miniaturization, allowing for batch processing. A microfabricated ASSISE intended for quantifying H+, Ca2+, and CO32- ions was constructed. It consists of a noble-metal electrode layer (i.e. Pt), a transduction layer, and an ion-selective membrane (ISM) layer. The transduction layer functions to transduce the concentration-dependent chemical potential of the ion-selective membrane into a measurable electrical signal.
The lifetime of an ASSISE is found to depend on maintaining the potential at the conductive layer/membrane interface 5-7. To extend the ASSISE working lifetime and thereby maintain stable potentials at the interfacial layers, we utilized the conductive polymer (CP) poly(3,4-ethylenedioxythiophene) (PEDOT) 7-9 in place of silver/silver chloride (Ag/AgCl) as the transducer layer. We constructed the ASSISE in a lab-on-a-chip format, which we called the multi-analyte biochip (MAB) (Figure 1).
Calibrations in test solutions demonstrated that the MAB can monitor pH (operational range pH 4-9), CO32- (measured range 0.01 mM - 1 mM), and Ca2+ (log-linear range 0.01 mM to 1 mM). The MAB for pH provides a near-Nernstian slope response after almost one month storage in algal medium. The carbonate biochips show a potentiometric profile similar to that of a conventional ion-selective electrode. Physiological measurements were employed to monitor biological activity of the model system, the microalga Chlorella vulgaris.
The MAB conveys an advantage in size, versatility, and multiplexed analyte sensing capability, making it applicable to many confined monitoring situations, on Earth or in space.
Biochip Design and Experimental Methods
The biochip is 10 x 11 mm in dimension and has 9 ASSISEs designated as working electrodes (WEs) and 5 Ag/AgCl reference electrodes (REs). Each working electrode (WE) is 240 &mu;m in diameter and is equally spaced at 1.4 mm from the REs, which are 480 &mu;m in diameter. These electrodes are connected to electrical contact pads with a dimension of 0.5 mm x 0.5 mm. The schematic is shown in Figure 2.
Cyclic voltammetry (CV) and galvanostatic deposition methods are used to electropolymerize the PEDOT films using a Bioanalytical Systems Inc. (BASI) C3 cell stand (Figure 3). The counter-ion for the PEDOT film is tailored to suit the analyte ion of interest. A PEDOT with poly(styrenesulfonate) counter ion (PEDOT/PSS) is utilized for H+ and CO32-, while one with sulphate (added to the solution as CaSO4) is utilized for Ca2+. The electrochemical properties of the PEDOT-coated WE is analyzed using CVs in redox-active solution (i.e. 2 mM potassium ferricyanide (K3Fe(CN)6)). Based on the CV profile, Randles-Sevcik analysis was used to determine the effective surface area 10. Spin-coating at 1,500 rpm is used to cast ~2 &mu;m thick ion-selective membranes (ISMs) on the MAB working electrodes (WEs).
The MAB is contained in a microfluidic flow-cell chamber filled with a 150 &mu;l volume of algal medium; the contact pads are electrically connected to the BASI system (Figure 4). The photosynthetic activity of Chlorella vulgaris is monitored in ambient light and dark conditions.

Multi-analyte Biochip MAB Based on All-solid-state Ion-selective Electrodes ASSISE for Physiological Research

All-solid-state ion-selective electrodes (ASSISEs) constructed from a conductive polymer (CP) transducer provide several months of functional lifetime in liquid media. Here, we describe the fabrication and calibration process of ASSISEs in a lab-on-a-chip format. The ASSISE is demonstrated to have maintained a near-Nernstian slope profile after prolonged storage in complex biological media.

Multi-Analyt-Biochip (MAB) auf All-Solid-State-Ionen-selektiven Elektroden (ASSISE) für physiologische Forschung Grundlage

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) ...

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans' Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and pathways as well as its ease of cultivation. Several C. elegans disease models have been reported, including neurodegenerative disorders such as Parkinson's disease (PD), which involves the degeneration of dopaminergic (DA) neurons 1. Both transgenes and neurotoxic chemicals have been used to induce DA neurodegeneration and consequent movement defects in worms, allowing for investigations into the basis of neurodegeneration and screens for neuroprotective genes and compounds 2,3.
Screens in lower eukaryotes like C. elegans provide an efficient and economical means to identify compounds and genes affecting neuronal signaling. Conventional screens are typically performed manually and scored by visual inspection; consequently, they are time-consuming and prone to human errors. Additionally, most focus on cellular level analysis while ignoring locomotion, which is an especially important parameter for movement disorders.
We have developed a novel microfluidic screening system (Figure 1) that controls and quantifies C. elegans' locomotion using electric field stimuli inside microchannels. We have shown that a Direct Current (DC) field can robustly induce on-demand locomotion towards the cathode ("electrotaxis") 4. Reversing the field's polarity causes the worm to quickly reverse its direction as well. We have also shown that defects in dopaminergic and other sensory neurons alter the swimming response 5. Therefore, abnormalities in neuronal signaling can be determined using locomotion as a read-out. The movement response can be accurately quantified using a range of parameters such as swimming speed, body bending frequency and reversal time.
Our work has revealed that the electrotactic response varies with age. Specifically, young adults respond to a lower range of electric fields and move faster compared to larvae 4. These findings led us to design a new microfluidic device to passively sort worms by age and phenotype 6.
We have also tested the response of worms to pulsed DC and Alternating Current (AC) electric fields. Pulsed DC fields of various duty cycles effectively generated electrotaxis in both C. elegans and its cousin C. briggsae 7. In another experiment, symmetrical AC fields with frequencies ranging from 1 Hz to 3 KHz immobilized worms inside the channel 8.
Implementation of the electric field in a microfluidic environment enables rapid and automated execution of the electrotaxis assay. This approach promises to facilitate high-throughput genetic and chemical screens for factors affecting neuronal function and viability.

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans&#039; Locomotion

A semi-automated micro-electro-fluidic method to induce on-demand locomotion in Caenorhabditis elegans is described. This method is based on the neurophysiologic phenomenon of worms responding to mild electric fields (&#x201C;electrotaxis&#x201D;) inside microfluidic channels. Microfluidic electrotaxis serves as a rapid, sensitive, low-cost, and scalable technique to screen for factors affecting neuronal health.

Mikrofluidik-basierten electrotaxis für On-Demand-Quantitative Analyse von<em&gt; Caenorhabditis elegans</em&gt; &#39;Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and ...

Use of Label-free Optical Biosensors to Detect Modulation of Potassium Channels by G-protein Coupled Receptors

Ion channels control the electrical properties of neurons and other excitable cell types by selectively allowing ions to flow through the plasma membrane1. To regulate neuronal excitability, the biophysical properties of ion channels are modified by signaling proteins and molecules, which often bind to the channels themselves to form a heteromeric channel complex2,3. Traditional assays examining the interaction between channels and regulatory proteins require exogenous labels that can potentially alter the protein&#39;s behavior and decrease the physiological relevance of the target, while providing little information on the time course of interactions in living cells. Optical biosensors, such as the X-BODY Biosciences BIND Scanner system, use a novel label-free technology, resonance wavelength grating (RWG) optical biosensors, to detect changes in resonant reflected light near the biosensor. This assay allows the detection of the relative change in mass within the bottom portion of living cells adherent to the biosensor surface resulting from ligand induced changes in cell adhesion and spreading, toxicity, proliferation, and changes in protein-protein interactions near the plasma membrane. RWG optical biosensors have been used to detect changes in mass near the plasma membrane of cells following activation of G protein-coupled receptors (GPCRs), receptor tyrosine kinases, and other cell surface receptors. Ligand-induced changes in ion channel-protein interactions can also be studied using this assay. In this paper, we will describe the experimental procedure used to detect the modulation of Slack-B sodium-activated potassium (KNa) channels by GPCRs.

Optical biosensor techniques can detect changes in mass near the plasma membrane in living cells and allow one to follow cellular responses in both individual cells and populations of cells. This protocol will describe detection of the modulation of potassium channels by G-protein coupled receptors in intact cells using this approach.

Verwenden von Label-freien optischen Biosensoren zur Modulation von Kaliumkanälen durch G-Protein-gekoppelte Rezeptoren erkennen

Ion channels control the electrical properties of neurons and other excitable cell types by selectively allowing ions to flow through the plasma ...

A Label-free Technique for the Spatio-temporal Imaging of Single Cell Secretions

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning of such signaling can lead to many disorders. To understand cell-to-cell signaling, it is essential to study the spatial and temporal nature of the secreted molecules from the cell without disturbing the local environment. Various assays have been developed to study protein secretion, however, these methods are typically based on fluorescent probes which disrupt the relevant signaling pathways. To overcome this limitation, a label-free technique is required.
In this paper, we describe the fabrication and application of a label-free localized surface plasmon resonance imaging (LSPRi) technology capable of detecting protein secretions from a single cell. The plasmonic nanostructures are lithographically patterned onto a standard glass coverslip and can be excited using visible light on commercially available light microscopes. Only a small fraction of the coverslip is covered by the nanostructures and hence this technique is well suited for combining common techniques such as fluorescence and bright-field imaging.
A multidisciplinary approach is used in this protocol which incorporates sensor nanofabrication and subsequent biofunctionalization, binding kinetics characterization of ligand and analyte, the integration of the chip and live cells, and the analysis of the measured signal. As a whole, this technology enables a general label-free approach towards mapping cellular secretions and correlating them with the responses of nearby cells.

Inter-cellular communication is critical for controlling various physiological activities within and outside the cell. This paper describes a protocol for measuring the spatio-temporal nature of single cell secretions. To achieve this, a multidisciplinary approach is used which integrates label-free nanoplasmonic sensing with live cell imaging.

Ein Markierungsfreie Technik für die Raum-zeitliche Imaging von Single Cell Sekrete

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning ...

Label-free Single Molecule Detection Using Microtoroid Optical Resonators

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental studies on the behavior of molecules. Single molecule detection techniques commonly utilize labels such as fluorescent tags or quantum dots, however, labels are not always available, increase cost and complexity, and can perturb the events being studied. Optical resonators have emerged as a promising means to detect single molecules without the use of labels. Currently the smallest particle detected by a non-plasmonically-enhanced bare optical resonator system in solution is a 25 nm polystyrene sphere1. We have developed a technique known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that can surpass this limit and achieve label-free single molecule detection in aqueous solution2. As signal strength scales with particle volume, our work represents a &#62; 100x improvement in the signal to noise ratio (SNR) over the current state of the art. Here the procedures behind FLOWER are presented in an effort to increase its usage in the field.

We have developed a label-free biosensing system based on optical resonator technology known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that is capable of detecting single molecules in solution. Here the procedures behind this work are described and presented.

Markierungsfreie Einzelmoleküldetektion Mit Mikrotoroid optischen Resonatoren

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental ...