The OPPF-UK is funded by the Medical Research Council, UK (grant MR/K018779/1) and the Membrane Protein Laboratory by the Wellcome Trust (grant 099165/Z/12/Z).

1. Konstruktion von Expressionsvektoren <ol><li> Verwenden PCR Infusion Klonen parallel mit den Vektoren pOPINE-3C-GFP und popin-N-GFP, die entweder spaltbare C-terminalen oder N-terminalen GFP-His6 Fusionen zu den Sequenzen 13 bzw. in den zu 96 Expressionsplasmide konstruieren up. Anmerkung: Die Wahl des Vektors wird durch die Topologie des Proteins diktiert, da die GFP muss im Cytosol exprimiert werden, wodurch die für ein Protein mit einer zytosolischen N-Terminus und C-Terminus der extrazellulären wir POPIN-N-GFP und verwenden würden einer extrazellulären N-Terminus und C-Terminus cytosolischen in wir pOPINE-3C-GFP verwenden würden. Wo beide Enden sind cytosolische wir pOPINE-3C-GFP verwenden würde, es sei denn funktionellen Gründen nicht auf den C-Terminus zu markieren. </li><li> Verstärken die DNA-Sequenzen, die Membranproteine ​​mit Primern unter Einbeziehung folgender gezeigt Erweiterungen Codierung: pOPINE-3C-GFP (Forward Primer - AGGAGATATACCATG; Rückwärtsprimer - CAGAACTTCCAGTTT) und popin-N-GFP (Vorwärtsprimer - AAGTTCTGTTTCAGGGCCCG; Rückwärtsprimer - ATGGTCTAGAAAGCTTTA). </li><li> Analyse der PCR-Reaktion durch Agarose-Gelelektrophorese. Einmal sauber PCR-Produkte erhalten wurden, fügen Sie 5 U DpnI in jede Vertiefung (Make-up in 5 ul 1x DpnI Reaktionspuffer). Aufreinigung der PCR-Produkte unter Verwendung von magnetischen Kügelchen in eine 96-Well-Format. Hinweis: DpnI hinzugefügt, um die Vorlage Vektor zu entfernen; Dieser Schritt ist nicht notwendig, wenn genomische DNA als Matrize verwendet. </li><li> 1 ul (100 ng) des geeigneten linearisierten Vektor an jede Vertiefung einer PCR-Platte. </li><li> Mit einer Mehrkanalpipette Add x ul des gereinigten PCR-einfügen in die entsprechenden Vertiefungen des PCR-Platte. Stellen Sie sicher, dass alle Produkte im Bereich von 10 bis 250 ng. </li><li> Hinzufügen (9-x) &amp; mgr; l Wasser zu dem gut und übertragen die gesamte 10 ul zu einem Röhrchen, das die Austrocknungs in-Fusions Reagenz. Lassen Sie für 30 Sekunden. </li><li> Mischen Sie Inhalte kurz durch Auf- und Abpipettieren. Transferdie Reaktionen wieder auf den ursprünglichen PCR-Platte und Dichtung. </li><li> Inkubieren für 30 min bei 42 ° C in einem Thermocycler. </li><li> Die Reaktionen auf Eis sofort übertragen, sobald die Reaktion vollständig ist, und fügen Sie 40 ul TE (10 mM Tris, pH 8,0, 1 mM EDTA). </li><li> Frieren Sie auf einmal oder zu transformieren in kompetente Zellen. Für die Transformation verwenden 3 ul der verdünnten Reaktions pro 50 ul-Aliquot hohe Kompetenz (&gt; 5 x 10 9 Transformanten / ug) kompetente E. coli-Zellen. </li><li> 1 ml LB-Agar mit 50 ug / ml Carbenicillin pro Vertiefung einer 24-Well-Gewebekulturplatte ergänzt (für das Klonen, bereiten Brunnen für 2 x Anzahl der Konstrukte). </li><li> Nach Auswachsen, Nach-Auswuchs Platte aus 25 ul und 25 ul einer 1: 5 Verdünnung der Kultur auf dem Agar-24-Well-Gewebekulturplatten. </li><li> Verbreiten Sie die Zellen durch leichtes Kippen der Platte. </li><li> Die Platte mit dem Deckel off für 10-15 Minuten bei 37 ° C oder in einem flow Abzug bei Raumtemperatur. </li><li> Setzen Sie den Deckel und drehen Sie die Platte auf den Kopf und Inkubation über Nacht bei 37 ° C. </li><li> Wählen Sie zwei Kolonien und Mini-Prep die Vektoren. </li><li> PCR überprüfen Sie die Konstrukte mit dem Konstrukt spezifische Reverse-Primer und einen Vektor spezifischen Vorwärtsprimer (zB pOPIN_FOR GAC CGA AAT TAA TAC GAC TCA CTA TAG GG). </li></ol> 2. Transformation von E. E-coli-Stämme xpression Anmerkung: Vor der Durchführung dieses Protokolls E. coli-kompetente Zellen werden hergestellt, aliquotiert und bei -80 ° C eingefroren, wie zuvor beschrieben 13. Membran-Protein-Expression wird routinemäßig in zwei Stämme gescreent Lemo21 (DE3) und C41 (DE3) pLysS. Zur Interpretation der Ergebnisse helfen kann es hilfreich sein, eine positive Kontrolle, beispielsweise ein Plasmid, die GFP oder ein Membranprotein mit GFP fusioniert bekannt zu äußern und einen leeren Vektor Negativkontrolle einzubeziehen. <ol><li> Auftauen aliquotted E. coli auf Eis. In 3 ul Mini vorbereitet Expressionsplasmid zu jedem Aliquot kompetenter Zellen. </li><li> Inkubieren Sie die Mischung auf Eis für 30 min. </li><li> Hitzeschock der Zellen für 30 Sekunden bei 42 ° C. </li><li> Sodass die Zellen auf Eis für 2 Minuten zu erholen, und dann werden 300 ul Kraftbrühe in jedes Röhrchen. </li><li> Inkubieren für 1 Stunde in einem 37 ° C statischen Inkubator. </li><li> Vorbereiten des LB-Agar in einer 24-Well-Gewebekulturplatte mit 50 ug / ml Carbenicillin und 35 ug / ml Chloramphenicol ergänzt. Hinzufügen Rhamnose zu einer Endkonzentration von 0,25 mM zu den Vertiefungen, die Lemo21 (DE3). Hinweis: Wenn das Produkt wahrscheinlich toxisch die Vertiefungen mit C41 zu sein (DE3) pLysS mit 1% (w / v) Glucose ergänzt werden. </li><li> Transfer 30 ul Zellen aus dem Transformationsgemisch auf LB-Agar-Platten. Verbreiten Sie und trocknen Sie die Platte nach 1,13-1,15 beschrieben. </li></ol> 3. Herstellung der Übernachtung Starterkulturen Hinweis: Immer Übernachtkulturen nach der Transformation noch nie von einem alten Transformationsplatte bereiten den Tag. <ol><li> Hinzufügen von 0,7 ml Netz Brühe in jede Vertiefung einer 96-well Deepwell-Platte mit 50 ug / ml Carbenicillin und 35 ug / ml Chloramphenicol ergänzt. Hinzufügen Rhamnose in die Vertiefungen enthaltenden Lemo21 (DE3) bis zu einer Endkonzentration von 0,25 mM. Optional ergänzen C41 (DE3) pLysS mit 1% (w / v) Glucose; siehe oben (2.6) verbindlich. </li><li> Wählen Sie eine Kolonie von den über Nacht Transformationsplatten in jede Vertiefung. Verschließen Sie den Block mit einem gasdurchlässigen Dichtung. </li><li> Rütteln des Blocks bei 250 Upm in einem Inkubator mit einer großen Wurf (zB ein 25 mm Umlaufbahn) oder mit 600 Upm in einem Inkubator mit einer geringen Schwingbewegung (zB 4,3 mm Bahn) bei 37 ° C über Nacht. </li></ol> 4. Wachstum und Induktion der Kulturen <ol><li> 3 ml Kraftbrühe mit 50 ug / ml Carbenicillin und 35 ug / ml Chloramphenicol zu jedem w ergänztell der 24-Loch-Deepwell-Platte. In L-Rhamnose (und Traubenzucker), wie in Abschnitt 3.1 beschrieben. Verwenden Sie 3 ml Kultur bis zur Ernte in zweifacher Ausfertigung zu ermöglichen und für einige Verdunstung von Wasser durch die gasdurchlässige Dichtung zu ermöglichen. </li><li> Bis die Expressionskulturen durch Zugabe von 150 ul Lemo21 (DE3) oder C41 (DE3) pLysS Übernachtkulturen in jede Vertiefung der 24-Loch-Deep-Well Blöcke gesetzt. </li><li> Schütteln Sie die Blöcke bei 37 ° C, bis die mittlere OD bei 595 nm ist ~ 0,5 durch die Platte. </li><li> Induzieren die Expression durch Zugabe von IPTG zu den Kulturen bis zu einer Endkonzentration von 1,0 mM IPTG. </li><li> Wachsen die Kulturen über Nacht (18-20 Stunden) bei 20 ° C schüttelnd. </li></ol> 5. Analyse der Expression von In-Gel-Fluoreszenz <ol><li> Ernte in zweifacher Ausfertigung. 1 ml der Kultur aus jeder Vertiefung in ein Quadrat gut, konischer Boden, 96-Loch-Deep-Well-Block. Hinweis: Ernte in zweifacher Ausfertigung bei Bruch des Blocks oder die Erprobung eines alternati ermöglichenve Reinigungsmittel, falls gewünscht. </li><li> Abdichten der Blöcke und Ernte der Zellen durch Zentrifugation bei 6.000 × g für 10 min. </li><li> Kehren Sie die Block und dekantiert die Medien. Tippen Sie auf den Block vorsichtig auf ein Papiertuch, Stoffreste abtropfen lassen. </li><li> Dichten Sie die Platten und bei -80 ° C für mindestens 20 min. Wahlweise lassen das Experiment an dieser Stelle und das verarbeitete wenn bequem Block. </li><li> De-Frost die Pellets für 20 min bei Raumtemperatur. </li><li> Entweder eine Mehrkanalpipette oder eines Orbitalschüttler (1.000 Upm für 10 min) bei 4 ° C, um die Zellen vollständig in 200 ul Lysepuffer (50 mM NaH 2 PO 4, 300 mM NaCl 10 mM Imidazol 1% v resuspendieren / v Tween 20, des pH auf 8,0 unter Verwendung von NaOH einzustellen). </li><li> Mit 20 ul der DLPI Lösung (20 &amp; mgr; l DNase I (4.000 Einheiten / ml), 20 mg Lysozym und 20 &amp; mgr; l Protease-Inhibitor-Cocktail in einem Endvolumen von 2 ml Wasser). Inkubieren für 10 min unter Schütteln (~ 1000 rpm) bei 4 ° C. </li><li&gt; Hinzufügen von 25 ul 10% n-Dodecyl-β-D-maltosid (DDM). </li><li> Inkubieren für 60 min unter Schütteln (~ 1000 rpm) bei 4 ° C. </li><li> Zentrifuge die Tief-Well-Block mit 6000 xg für 30 min bei 4 ° C. </li><li> Transfer 10 ul des geklärten Lysats, um eine Mikrotiterplatte und gibt 10 ul SDS-PAGE-Gel-Ladepuffer (100 mM Tris, pH 6.8, 4% w / v SDS, 0,2% w / v Bromphenol blau, 10% v / v β -Mercaptoethanol und 20% v / v Glycerol). VORSICHT! Nicht kochen die Probe. </li><li> Last 10 ul Probe aus Schritt 5.11 / Vertiefung auf SDS PAGE-Gel (e) und führen bei 100-120 V (konstante Spannung) in einen kalten Raum bis die Farbstoff-Front den Boden (2-2,5 h) erreicht. </li><li> Legen Sie das Gel auf einem Bildwandler (zB mit einem Blaulicht-Filter, um die GFP-Fusionsproteine ​​zu erkennen). Die Belichtungszeit wird so gewählt, dass die hellsten Bänder nicht gesättigt. </li></ol> 6. Scale-up von Zellkulturen <ol><li> Verwandeln Sie ein Aliquot zuständigen <em&gt; E. coli, wie in Kapitel 2 beschrieben. </li><li> Wählen Sie eine Kolonie in 10 ml Kraftbrühe (ergänzt, wie in Kapitel 3 beschrieben) und über Nacht wachsen bei 37 ° C. </li><li> 5 ml der Übernacht-Kultur in 500 ml Kraftbrühe. </li><li> Wachsen unter Schütteln bei 250 Upm bei 37 ° C, bis die OD bei 595 nm von ~ 0,5. </li><li> Induzieren die Expression durch Zugabe von IPTG bis zu einer Endkonzentration von 1,0 mM. </li><li> Wachsen über Nacht unter Schütteln bei 250 Upm bei 20 ° C. </li><li> Ernten der Zellen durch Zentrifugation bei 5.000 xg für 15 min. </li><li> Überstand verwerfen. Zellpellets bei -80 ° C gelagert werden. </li></ol> 7. Herstellung von Membranen <ol><li> Tau-Zellen (falls nötig) bei Raumtemperatur und resuspendieren in 1x PBS, pH 7,5, in einem Volumen von 5 ml pro Gramm Zellpellet; Lautstärke erhöhen wie nötig, bis die Viskosität reduziert, um eine laufende Konsistenz. Hinzufügen MgCl 2 bis zu einer Endkonzentration von 1 mM, DNAse I bis zu einer Endkonzentration von 10 ug / ml und einemabgepackte Proteaseinhibitor Tablette pro 20 g Zellpellet. Brechen Sie Zellen unter Verwendung eines gekühlten Zelle Disruptor bei einem Druck von 30 kpsi. </li><li> Pellet die nicht aufgebrochenen Zellen und Trümmer bei 30.000 g für 15 min bei 4 ° C. Überstand in einem Ultrazentrifugenröhrchen. </li><li> Sammeln Sie den gesamten Membranfraktion durch Abzentrifugieren des Überstandes in einer Ultrazentrifuge bei 200,000 × g für 1 h bei 4 ° C. </li><li> Überstand verwerfen. </li><li> Re-suspend die Membran Pellet in eiskaltem 10 ml PBS, pH 7,5, mit einem Zell Homogenisator. Für jedes Reinigungsmittel werden 1 ml resuspendiert Membranen erforderlich. Optional kann in diesem Stadium, Flash Einfrieren der Membransuspension in flüssigem Stickstoff und bei -80 ° C. </li></ol> 8. Solubilisierung und Analyse der Membranfraktion <ol><li> Tau-Membranfraktion (falls erforderlich), und für jede Reinigungsmittel für die Solubilisierung verwendet werden aliquote 900 ul der Membransuspension in ein 1,5 ml Polyallomer-Mikro centrifuge Rohr. </li><li> Füge 100 ul jeder frisch hergestellten Waschmittel (10% w / v Lösung von DDM, DM, Cymal-6 und LDAO) zu einer Endkonzentration von 1% zu der angegebenen 1,5-ml-Röhrchen. Zur Solubilisierung der eukaryontischen Membranproteine ​​Cholesterinhemisuccinat (0,2% Endkonzentration) kann den Waschmitteln zugesetzt werden. </li><li> Die Gemische Inkubieren bei 4 ° C für 1 Stunde unter leichtem Schütteln. </li><li> Pellewaschmittel unlöslichen Fraktion mit einer Tischultrazentrifuge, wodurch Rohre mindestens halb voll, bei 150000 g bei 4 ° C für 45 min und der Überstand behalten. Anmerkung: Die Wirksamkeit der Waschmittel Solubilisierung unter Verwendung eines Fluoreszenz-Plattenlesegerät durch Messen der GFP-Fluoreszenz der solubilisierten Membranen mit dem Waschmittel unlöslichen Fraktion in dem gleichen Volumen von PBS resuspendiert abschätzen. </li><li> Analyse der Monodispersionsgrad der verschiedenen Waschmittel: Membranproteinkomplexen unter Verwendung von Fluoreszenz-erfassten Größenausschlusschromatographie (FSEC). </li><li> Für FSEC Analyse äquilibrieren eine Grßenausschlusssäule mit breiter Fraktionierungsbereich, zB 5.000 bis 5.000.000 Molekulargewicht, mit Laufpuffer (20 mM Tris pH 7,5, 150 mM NaCl, 0,03% DDM) bei einer Flussrate von 0,3 ml / min . Verwenden dieses Puffers für alle Proben, dh es ist nicht für jeden getesteten Waschmittel verändert. </li><li> Injizieren 100 ul solubilisierter Membranen auf die Säule mit einer Fließgeschwindigkeit von 0,3 ml / min. Überwachen Elutionsprofil mit Fluoreszenzoptik (Anregung bei 488 nm und Emission bei 512 nm). Wenn ein Inline-Fluoreszenz-Monitor nicht verfügbar ist, sammeln die Fraktionen und lesen Sie die Fluoreszenz in einem Plattenlesegerät. </li><li> Import Elutionsvolumen und die Fluoreszenzintensität von Daten in ein Tabellenkalkulationsprogramm zur grafischen Darstellung. </li><li> Analyse verbleibenden solubilisierten Membranmaterial durch in-Gel-Fluoreszenz, wie in Abschnitt 5 beschrieben. </li></ol>

<ol>
	<li>Wallin, E., von Heijne, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+integral+membrane+proteins+from+eubacterial,+archaean,+and+eukaryotic+organisms.">Genome-wide analysis of integral membrane proteins from eubacterial, archaean, and eukaryotic organisms.</a> Protein Sci. 7 (4), 1029-1038 (1998).</li><li>Fagerberg, L., Jonasson, K., von Heijne, G., Uhlen, M., Berglund, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prediction+of+the+human+membrane+proteome.">Prediction of the human membrane proteome.</a> Proteomics. 10 (6), 1141-1149 (2010).</li><li>Okada, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-Ray+diffraction+analysis+of+three-dimensional+crystals+of+bovine+rhodopsin+obtained+from+mixed+micelles.">X-Ray diffraction analysis of three-dimensional crystals of bovine rhodopsin obtained from mixed micelles.</a> J Struct Biol. 130 (1), 73-80 (2000).</li><li>Palczewski, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+rhodopsin:+A+G+protein-coupled+receptor.">Crystal structure of rhodopsin: A G protein-coupled receptor.</a> Science. 289 (5480), 739-745 (2000).</li><li>Miroux, B., Walker, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Over-production+of+proteins+in+Escherichia+coli:+mutant+hosts+that+allow+synthesis+of+some+membrane+proteins+and+globular+proteins+at+high+levels.">Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels.</a> J Mol Biol. 260 (3), 289-298 (1996).</li><li>Wagner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tuning+Escherichia+coli+for+membrane+protein+overexpression.">Tuning Escherichia coli for membrane protein overexpression.</a> Proc Natl Acad Sci U S A. 105 (38), 14371-14376 (2008).</li><li>Schlegel, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+membrane+protein+overexpression+in+the+Escherichia+coli+strain+Lemo21(DE3).">Optimizing membrane protein overexpression in the Escherichia coli strain Lemo21(DE3).</a> J Mol Biol. 423 (4), 648-659 (2012).</li><li>Chun, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+partner+toolchest+for+the+stabilization+and+crystallization+of+G+protein-coupled+receptors.">Fusion partner toolchest for the stabilization and crystallization of G protein-coupled receptors.</a> Structure. 20 (6), 967-976 (2012).</li><li>Drew, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP-based+optimization+scheme+for+the+overexpression+and+purification+of+eukaryotic+membrane+proteins+in+Saccharomyces+cerevisiae.">GFP-based optimization scheme for the overexpression and purification of eukaryotic membrane proteins in Saccharomyces cerevisiae.</a> Nat Protoc. 3 (5), 784-798 (2008).</li><li>Drew, D. E., von Heijne, G., Nordlund, P., de Gier, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Green+fluorescent+protein+as+an+indicator+to+monitor+membrane+protein+overexpression+in+Escherichia+coli.">Green fluorescent protein as an indicator to monitor membrane protein overexpression in Escherichia coli.</a> FEBS Lett. 507 (2), 220-224 (2001).</li><li>Kawate, T., Gouaux, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence-detection+size-exclusion+chromatography+for+precrystallization+screening+of+integral+membrane+proteins.">Fluorescence-detection size-exclusion chromatography for precrystallization screening of integral membrane proteins.</a> Structure. 14 (4), 673-681 (2006).</li><li>Newstead, S., Kim, H., von Heijne, G., Iwata, S., Drew, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+fluorescent-based+optimization+of+eukaryotic+membrane+protein+overexpression+and+purification+in+Saccharomyces+cerevisiae.">High-throughput fluorescent-based optimization of eukaryotic membrane protein overexpression and purification in Saccharomyces cerevisiae.</a> Proc Natl Acad Sci U S A. 104 (35), 13936-13941 (2007).</li><li>Busso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+protein+complexes+using+multiple+Escherichia+coli+protein+co-expression+systems:+a+benchmarking+study.">Expression of protein complexes using multiple Escherichia coli protein co-expression systems: a benchmarking study.</a> J Struct Biol. 175 (2), 159-170 (2011).</li><li>Sonoda, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Benchmarking+membrane+protein+detergent+stability+for+improving+throughput+of+high-resolution+X-ray+structures.">Benchmarking membrane protein detergent stability for improving throughput of high-resolution X-ray structures.</a> Structure. 19 (1), 17-25 (2011).</li><li>Low, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+analytical+gel+filtration+screening+of+integral+membrane+proteins+for+structural+studies.">High-throughput analytical gel filtration screening of integral membrane proteins for structural studies.</a> Biochim Biophys Acta. 1830 (6), 3497-3508 (2013).</li></ol>

The authors have nothing to disclose.

Bei der in diesem Artikel beschriebenen Protokoll wird Ligierung unabhängigen Klonen in einen GFP-Reporter-Vektor mit Fluoreszenzdetektion kombiniert, um schnellen Screening der relativen Expression mehrerer Membranproteine ​​in E. coli. Vektoren können in vier Arbeitstagen mit primären Ausdruck Screening unter eine weitere Woche durchgeführt werden. In-Gel-Fluoreszenz Detergenslysate ganzer Zellen wird verwendet, um Rang Ausdruck trifft zur weiteren Analyse in einem sekundären Bildschirm. Der primäre Ausdruck Bildschirm präsentiert keine spezielle Ausrüstung abgesehen von einem Schüttelinkubator für wachsende Zellen in tiefen Brunnen Bausteine ​​benötigen. Alle anderen Flüssigkeitshandhabungs mit 96 Vertiefungen SBS Platten kann unter Verwendung von Mehrkanalpipetten erfolgen. Das Protokoll kann leicht modifiziert werden, um andere E. coli-Stämme unter verschiedenen Expressionsbedingungen (zB niedrigere Temperatur) angebaut sind. In dem Fall des LEMO21 (DE3) Titrieren der Ebene von Rhamnose (0 bis 2,0 mM)zugegeben, um die Rate der Transkription modulieren, kann die Höhe der Expression einiger Membranproteinen 7 erhöhen. Außer DDM Waschmittel könnten für die Extraktion in der primären Bildschirm verwendet wenn härtere Waschmittel können Proteine ​​aus Einschlusskörper löslich und somit liefern falsche Positivmeldungen werden. Es ist klar, desto umfangreicher der Startbildschirm wird, desto mehr Zeit in Anspruch, das Experiment. Der sekundäre Bildschirm ist die Vorbereitung einer Gesamtmembranfraktion aus den Expressions Treffer im primären Screening identifiziert. Dies ist ein entscheidender Schritt, da sie die Lokalisierung des Fusionsproteine ​​an der Membran des E. bestätigen coli-Zellen. Nachfolgende Extraktion der GFP-Fusionsproteins in verschiedenen Waschmitteln durch fluoreszenz detektiert Grßenausschlußchromatographie solubilisiertes Material überwacht, um das mono-Dispersität der Waschmittel-Protein-Komplexe zu beurteilen. Dies ist ein weiterer wichtiger Schritt, da sie die am besten geeigneten Waschmittel für die identifiziertSolubilisierung des Membranproteins zur nachfolgenden Weiterverarbeitung. Die Erfahrung zeigt jedoch, daß eine weitere Optimierung der Wahl des Waschmittels (en) enthalten, während der Reinigung und Kristallisation erforderlich. Beweise einheitliches Verhalten in verschiedenen Waschmitteln einschließlich solcher mit einem relativ kleinen Micellen Größe (zB LDAO) scheint guter Indikator einer Neigung zur Bildung gut streuenden Kristallen mindestens für prokaryotische Membranproteine ​​14 zu sein. In dieser Hinsicht scheint der für das Membranprotein in 2B dargestellte Profil sehr günstig. Der Hauptvorteil der Verwendung eines GFP-Reporter ist, dass es eine schnelle Auslesung der Expression in nicht-gereinigten Proben. Ein Nachteil ist, dass das GFP-Fusionsprotein, die während der Reinigung des Proteins zur Kristallisation entfernt werden. Im Falle der hier verwendeten Vektoren, Rhinovirus 3C Protease eine Website ermöglicht die Spaltung der GFP. Alternativ dazu ist es einfachum Kandidatenproteine, in dem Bildschirm identifiziert-Klon wieder in Vektoren, die nur einen Polyhistidin oder andere Affinität Tag hinzuzufügen für anschließende Reinigung. Dies setzt voraus, dass die Fusion mit GFP ist nicht für die Expression erforderlich. Die wichtigste Alternative zur Verwendung von Fusions GFP zum Nachweis von Membranprotein-Expression und Solubilisierung ist, nur einen Histidin-Tag hinzuzufügen. Allerdings erfordert diese Vorgehensweise in der Regel beginnend mit einer Membranfraktion 15, die für die Auswertung von vielen Varianten wäre sehr zeitaufwendig geworden. Zusammenfassend ist der Hauptzweck des in diesem Artikel beschriebenen Protokoll zu ermöglichen, eine große Anzahl von Membranproteinsequenzvarianten schnell im Ausdruck und Waschmittel Solubilisierung ausgewertet und für tiefere Analyse priorisiert werden.

Es wurde geschätzt, dass die Membranproteine ​​machen etwa 20-30% der Gene in allen sequenzierten Genomen 1, einschließlich des menschlichen Genoms 2 codiert. Aufgrund ihrer kritischen Rolle in vielen biologischen Prozessen, beispielsweise Transport von Metaboliten, die Energieerzeugung und als Arzneimitteltargets besteht großes Interesse an der Bestimmung ihrer dreidimensionalen Struktur. Doch im Vergleich zu löslichen Proteine ​​sind Membranproteine ​​stark unterrepräsentiert in der Proteindatenbank. In der Tat, der 99.624 freigegebenen Strukturen in der PDB ( <a href="http://www.rcsb.org/pdb/">http://www.rcsb.org/pdb/</a> ) nur 471 ( <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> ) als Membranproteine ​​eingestuft. Dies entspricht den technischen Schwierigkeiten bei der Arbeit mit Membranproteinen, die von Natur aus bei relativ niedrigen Niveaus exprimiert werden; Rhodopsin ist eine der wenigen Ausnahmen 3,4. Überexpression von rekombinanter Versions in heterologen Zellen führt oft zu Fehlfaltung und schlechte Ausrichtung auf die Membran, die das Gesamtniveau der Produktion begrenzt. Die Auswahl der besten Reinigungsmittel für die Extraktion und Solubilisierung eines Membranproteins einmal ausgedrückt macht anschließende Reinigung schwierig und erfordert eine sorgfältige Optimierung. Escherichia coli bleibt das am häufigsten verwendete Expressionswirt für Membranproteine ​​Anteil von 72% ( <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> ) von Strukturen bisher fast ausschließlich aus Bakterienquellen sind gelöst. Spezifische E. coli-Stämme, C41 (DE3) und C43 (DE3), wurden isoliert, die nicht auf die Überexpression von Membran Proteins führen und somit die Auswirkungen der Toxizität für andere Stämme BL21 beobachtet 5,6 zu vermeiden. Tuning das Niveau der rekombinanten Membranproteinexpression scheint entscheidend für die Optimierung der Produktionsniveau 6,7 sein. <p class=&quot;Jove_content&quot;&gt; Vielfach erfolgreiche Herstellung von Membranproteinen zur Strukturbestimmung hat die Auswertung von mehreren Versionen einschließlich Amino- und Carboxy-terminalen Deletionen, mehrfache Orthologe natürlichen Sequenzvariation und verschiedene Fusionsproteine ​​6-8 auszunutzen erforderlich. Daher ist ein Verfahren zur Expression Untersuchung von zahlreichen Membranproteinen parallel wesentlich. Eine üblicherweise verwendete Ansatz besteht darin, das Protein das grün fluoreszierende Protein (GFP) ermöglicht Ausdruck zu verschmelzen, ohne die Notwendigkeit, das Protein zu reinigen, verfolgt werden. Auf diese Weise können Informationen über die Expressionsstärke, Stabilität und Verhalten in verschiedenen Waschmitteln mit geringen Mengen an nicht-gereinigte Material 9-12 bewerten. In diesem Artikel wird eine optimierte Protokoll für Klonierungs- und Expressions-Screening von Membranproteinen in E. beschreiben wir coli mittels Fusion mit GFP als Reporter der Produktion und die anschließende Charakterisierung der Reinigungsmittel: Protein-Datei herunterladenLexes (Abbildung 1).

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Name of Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
		</tr>
		<tr>
			<td>pOPIN-N-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>pOPINE-3C-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>C41(DE3)pLysS</td>
			<td>Lucigen (http://lucigen.com/</td>
			<td>60444-1</td>
		</tr>
		<tr>
			<td>LEMO21(DE3)</td>
			<td>New England Biolabs</td>
			<td>C2528H</td>
		</tr>
		<tr>
			<td>In-Fusion HD EcoDry Cloning System, 96 Rxns</td>
			<td>Clontech/Takara</td>
			<td>639688</td>
		</tr>
		<tr>
			<td>Power broth</td>
			<td>Molecular Dimensions (http://www.moleculardimensions.com/)</td>
			<td>MD12-106-1</td>
		</tr>
		<tr>
			<td>Protease Inhibitor tablets</td>
			<td>Roche</td>
			<td>11697498001</td>
		</tr>
		<tr>
			<td>cOmplete, Mini, EDTA-Free; Protease Inhibitor Cocktail&#160;</td>
			<td>Roche</td>
			<td>11836170001</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma-Aldrich</td>
			<td>83650</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P8849</td>
		</tr>
		<tr>
			<td>DNAse 1</td>
			<td>Sigma-Aldrich</td>
			<td>DN25</td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td>L7651</td>
		</tr>
		<tr>
			<td>Cholesterol hemisuccinate</td>
			<td>Sigma-Aldrich</td>
			<td>C6512</td>
		</tr>
		<tr>
			<td>CYMAL-6 ( 6-Cyclohexyl-1-Hexyl-&#946;-D-Maltoside)</td>
			<td>Anatrace</td>
			<td>C326</td>
		</tr>
		<tr>
			<td>DDM ( n-Dodecyl &#223;-maltoside )</td>
			<td>Generon</td>
			<td>D97002</td>
		</tr>
		<tr>
			<td>DM (n-Decyl &#223;-maltoside)</td>
			<td>Generon</td>
			<td>D99003</td>
		</tr>
		<tr>
			<td>LDAO ( N,N-Dimethyl-n-dodecylamine N-oxide)</td>
			<td>Generon</td>
			<td>D71111</td>
		</tr>
		<tr>
			<td>E1 ClipTip Eq384 8 channel 1-30 ul&#160;</td>
			<td>Thermo Scientific&#160;</td>
			<td>4672030</td>
		</tr>
		<tr>
			<td>Rainin Pipette Pipet-Lite XLS 6ch 100-1200&#181;L LTS Spacer</td>
			<td>Anachem</td>
			<td>LA6-300XLS</td>
		</tr>
		<tr>
			<td>Rainin Pipette Light XLS+ 8ch 2-20&#181;L LTS</td>
			<td>Anachem</td>
			<td>L8-20XLSPLUS</td>
		</tr>
		<tr>
			<td>Pipette Pipet-Lite XLS 8ch 100-1200&#181;L LTS Tip</td>
			<td>Anachem</td>
			<td>L8-1200XLS</td>
		</tr>
		<tr>
			<td>24 well V bottom deep well blocks</td>
			<td>Porvair sciences</td>
			<td>360115</td>
		</tr>
		<tr>
			<td>BenchMark Fluorescent Protein Standard</td>
			<td>Life Technologies</td>
			<td>LC5928</td>
		</tr>
		<tr>
			<td>NuPAGE Novex 10% Bis-Tris Midi Protein Gels, 26 well</td>
			<td>Life Technologies</td>
			<td>WG1203BOX</td>
		</tr>
		<tr>
			<td>XCell4 SureLock Midi-Cell</td>
			<td>Life Technologies</td>
			<td>WR0100</td>
		</tr>
		<tr>
			<td>Vibramax 100</td>
			<td>Heidolph</td>
			<td>544-21200-00</td>
		</tr>
		<tr>
			<td>Tension rollers attachment</td>
			<td>Heidolph</td>
			<td>549-81000-00</td>
		</tr>
		<tr>
			<td>ptima L-100 Ultracentrifuge running 45-Ti rotor</td>
			<td>Beckman Coulter</td>
			<td>393253</td>
		</tr>
		<tr>
			<td>Optima Max-XP ultracentrifuge running TLA-55 rotor</td>
			<td>Beckman Coulter</td>
			<td>393315</td>
		</tr>
		<tr>
			<td>Floor standing centrifuge, Avanti J-26S XPI running JA-17 and JS-5.3 rotors&#160;</td>
			<td>Beckman Coulter</td>
			<td>B14535</td>
		</tr>
		<tr>
			<td>Prominence UFLC with RF-20A Fluorescence detector</td>
			<td>Shimadzu</td>
			<td></td>
		</tr>
		<tr>
			<td>Sepharose 6 10/300 GL size exclusion column</td>
			<td>GE Healthcare</td>
			<td>17-5172-01&#160;</td>
		</tr>
		<tr>
			<td>SSI5R-HS SHEL LAB Floor Model Shaking Incubator, 5 Cu.Ft. (144 L), 30-850 RPMs</td>
			<td>Shel Lab&#160;</td>
			<td>SSI5R-HS</td>
		</tr>
		<tr>
			<td>Innova44R incubator</td>
			<td>New Brunswick /Eppendorf</td>
			<td>Innova44R</td>
		</tr>
		<tr>
			<td>TS SERIES 0.75KW DISRUPTER 230V 50HZ 1PH (40KPSI)</td>
			<td>Constant systems</td>
			<td>PL083016</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma</td>
			<td>83650</td>
		</tr>
	</tbody>
</table>

green fluorescent protein-based expression screening of membrane proteins in escherichia coli

Die Produktion von rekombinanten Membranproteine ​​für strukturelle und funktionelle Studien bleibt technisch anspruchsvolle aufgrund der niedrigen Expressionsniveaus und der inhärenten Instabilität vieler Membranproteine ​​einmal in Reinigungsmitteln gelöst. Ein Protokoll wird beschrieben, daß nach Ligierung unabhängiges Klonen von Membranproteinen als GFP-Fusionen mit Expression in Escherichia coli durch GFP-Fluoreszenz nachgewiesen verbindet. Dies ermöglicht die Konstruktion und Expression Screening mehrerer Membranprotein / Varianten, Kandidaten für weitere Investitionen an Zeit und Mühe zu identifizieren. Die GFP-Reporter wird in einem primären Screening der Expression durch Visualisierung GFP-Fluoreszenz nach SDS-Polyacrylamid-Gelelektrophorese (SDS-PAGE) verwendet. Membranproteine, wie durch das Fehlen von freien GFP angegeben sowohl eine hohe Expressionsniveau mit minimalem Abbau zeigen, einen zweiten Bildschirm ausgewählt. Diese Konstrukte werden skaliert und einem Gesamtmembranfraktion hergestellt und löslich zu machend in vier verschiedenen Reinigungsmitteln. Nach Ultrazentrifugation Waschmittel unlösliches Material zu entfernen, werden Lysaten durch Fluoreszenzdetektion Größenausschlusschromatographie (FSEC) analysiert. Die Überwachung der Größenausschluss-Profil von GFP-Fluoreszenz liefert Informationen über die Monodispersionsgrad und die Integrität der Membranproteine ​​in verschiedenen Reinigungsmitteln. Protein: Waschmittelkombinationen, die mit einem symmetrischen Peak mit wenig oder kein freies GFP und minimale Aggregation eluieren sind Kandidaten für die nachfolgende Reinigung. Unter Verwendung der obigen Methode, die heterologe Expression in E. coli der SED (Form, Dehnung, Division und Sporenbildung) Proteine ​​aus 47 verschiedenen Arten von Bakterien untersucht. Diese Proteine ​​haben in der Regel zehn Transmembrandomänen und sind für die Zellteilung. Die Ergebnisse zeigen, dass die Herstellung der SEDs Orthologe in E. coli war sehr variabel in Bezug auf die Expressionsniveaus und der Integrität der GFP-Fusionsproteine. Das Experiment identified eine Teilmenge zur weiteren Untersuchung.

Das SEDS-Proteinfamilie (Form, Dehnung, Division und Sporenbildung) ist von wesentlicher Bedeutung für die bakterielle Zellteilung. Diese integralen Proteine ​​haben typischerweise zehn Transmembrandomänen mit beiden Amino- und Carboxy-Termini in der Zelle. Um das oben beschriebene Protokoll zu illustrieren, wurden 47 SEDs Orthologe in den Vektor pOPINE-3C-eGFP kloniert. Eine kleine Stufendarstellung Bildschirm der Konstrukte wurde in zwei E .coli Stämmen durchgeführt, Lemo21 (DE3) in Gegenwart von 0,25 mM gezüchtet Rhamnose undichte Expression und C41 (DE3) pLysS, das routinemäßig für die Expression von Membran verwendet werden, zu blockieren Proteine ​​8.5. Detergens solubilisiert Lysaten von induzierten Kulturen wurden durch SDS-Polyacrylamid-Elektrophorese analysiert. Unter Verwendung von in-Gel-Fluoreszenz zu visualisieren GFP exprimierten Fusionsproteine ​​zeigten, daß zwischen den beiden Stämmen 38 aus den 47 SEDs Konstrukte hergestellt wurden. Interessanterweise gibt es Unterschiede zwischen den beiden Expressionsstämmen. Von den 38 zum Ausdruck Konstrukte wurden nur 18 in beiden Stämmen, 14 in Lemo21 (DE3) und 6 nur in C41 (DE3) pLysS nur ausgedrückt produziert. Insgesamt gab es eine höhere Erfolgsrate für die Lemo21 (DE3), verglichen mit dem C41 (DE3) pLysS (38 vs. 24). Allerdings ist die Beobachtung, dass einige Proteine ​​schien Stamm genau zu sein bedeutet, dass das Screening sowohl sinnvoll ist. Repräsentative Daten für 24 von den 47 SEDs Konstrukte sind in Abbildung 1 dargestellt. Die Intensität der Banden geben einen Hinweis auf das Ausmaß der Expression, beispielsweise das Fusionsprotein in und C4 in Figur 1A und 1B ist in beiden Stämmen sind jedoch die zusätzlichen exprimiert Untermolekularen Banden nahe, dass das Protein teilweise abgebaut. In vielen Gassen gibt es eine Band, die in Größe allein entspricht GFP. Eine qualitative Bewertung der Integrität des Proteins kann, indem man die Intensität des Fusionsproteins gegenüber dem freien GFP durchgeführt werden;zB G4 und H4 sind komplett auf freie GFP in C41 (DE3) pLysS (1B), während in der Lemo21 (DE3) gebrochen es einige intakte Protein (Abbildung 1A). 14 der 38 exprimierten Proteine ​​die Intensität des freien GFP Band ist ähnlich der des Fusionsproteins, 21 die Intensität des freien GFP Band größer ist als die des Fusionsproteins und einer Minderheit der Fusionsproteine ​​(3 / 38 ausgedrückt) zB F6 und G6 in 1A gegenüber dem Fusionsprotein haben relativ wenig freies GFP. Zwei der Konstrukte, die auch in den primären Screen B5 (Hochintensitätsbändern kostenlos GFP und Fusionsproteine) und G6 (wenig freies GFP) exprimiert wurden und eine Gesamtmembranfraktion aus 500 ml Zellkultur hergestellt ausgedrückt. Resuspendierten Membranen in Aliquote aufgeteilt und durch Fluoreszenz-erfassten Größenausschlusschromatographie (FSEC) analysiert. Die FSEC Profile sind in Figur präsentiertE 2A und 2B und zeigen, dass die beiden SEDs Proteine ​​in den vier untersuchten Reinigungsmittel verhalten sich anders. In einem Fall (Abbildung 2A: Probe B5) das Protein nur ergab ein symmetrischer Peak mit wenig Aggregation im DDM die daher das Reinigungsmittel der Wahl für die anschließende Reinigung wäre. Im Gegensatz dazu der andere Fusionsprotein (2B: Probe G6) hat ein ähnliches Profil in allen getesteten Waschmitteln. <img alt="Figur 1" src="/files/ftp_upload/52357/52357fig1highres.jpg" width="700px" /> Abbildung 1: Schematische Darstellung der Arbeitsabläufe für das Screening von Membranproteinexpression in E. coli mit einem GFP-Reporter. <img alt="Abbildung 2" src="/files/ftp_upload/52357/52357fig2highres.jpg" /> Abbildung 2: Primäre Bildschirm von Membranproteinexpression mittels in-Gel-Fluoreszenz. </strong&gt; Reinigungsmittel Lysaten von E. coli-Zellen wurden durch SDS-PAGE analysiert und die Gele aufgenommen mit Blau Epi-Beleuchtung und einen 530/28 Filter. Die Ergebnisse sind für 24-Konstrukte (bezeichnet A4-H6 basierend auf ihrer Lage in einer 96-Well-Platte) gezeigt. Die Positionen der Banden für freies GFP und GFP-Fusionsproteine ​​(A) Proteine ​​in Lemo21 (DE3). (B) Proteine ​​in C41 (DE3) pLysS exprimiert angegeben.. <img alt="Figur 3" src="/files/ftp_upload/52357/52357fig3highres.jpg" /> Fig. 3: ein zweites Display Membranprotein-Expression unter Verwendung von Fluoreszenz-erfassten Größenausschlusschromatographie (FSEC) Gesamtmembran-Fraktionen wurden in vier verschiedenen Detergentien extrahiert und die solubilisierte Membranproteine ​​analysiert durch Grßenausschlußchromatographie unter Verwendung eines FPLC-Systems zu einem Fluoreszenzdetektor gekoppelt ist. FSEC Profile für (A) Membranprotein B5 und (B) </strong&gt; Membranprotein G6. Die Position der Peaks, die aggregierte Protein solubilisierten GFP-Fusionsprotein und freie GFP sind angegeben. Die getesteten Detergenzien unter den Profilen angedeutet.

Watch this Scientific Journal Video about Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli at JoVE.com

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Weg zur Rationalisierung der Screening für die Expression des rekombinanten Membranproteine ​​in Escherichia coli, basierend auf Fusions grün fluoreszierendes Protein dargestellt.

Green Fluorescent Protein-basierte Screening Expression von Membranproteinen in<em&gt; Escherichia coli</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

green-fluorescent-protein-based-expression-screening-membrane

Research

JoVE Journal

Biology

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

32.4K Aufrufe.  Research Complex at Harwell.  Weg zur Rationalisierung der Screening für die Expression des rekombinanten Membranproteine ​​in Escherichia coli, basierend auf Fusions grün fluoreszierendes Protein dargestellt. 

Serie: Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

Färbung von Proteinen in Gelen mit Coomassie G-250 ohne organische Lösungsmittel und Essigsäure

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

Forschung

Biologie

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme acid stresses including passage through the mammalian stomach where the pH can fall to as low as pH 1 - 22. To enable such a broad range of acidic pH survival, E. coli possesses four different inducible amino acid decarboxylases that decarboxylate their substrate amino acids in a proton-dependent manner thus raising the internal pH. The decarboxylases include the glutamic acid decarboxylases GadA and GadB3, the arginine decarboxylase AdiA4, the lysine decarboxylase LdcI5, 6 and the ornithine decarboxylase SpeF7. All of these enzymes utilize pyridoxal-5'-phospate as a co-factor8 and function together with inner-membrane substrate-product antiporters that remove decarboxylation products to the external medium in exchange for fresh substrate2. In the case of LdcI, the lysine-cadaverine antiporter is called CadB. Recently, we determined the X-ray crystal structure of LdcI to 2.0 &#197;, and we discovered a novel small-molecule bound to LdcI the stringent response regulator guanosine 5'-diphosphate,3'-diphosphate (ppGpp) 14. The stringent response occurs when exponentially growing cells experience nutrient deprivation or one of a number of other stresses9. As a result, cells produce ppGpp which leads to a signaling cascade culminating in the shift from exponential growth to stationary phase growth10. We have demonstrated that ppGpp is a specific inhibitor of LdcI 14. Here we describe the lysine decarboxylase assay, modified from the assay developed by Phan et al.11, that we have used to determine the activity of LdcI and the effect of pppGpp/ppGpp on that activity. The LdcI decarboxylation reaction removes the &alpha;-carboxy group of L-lysine and produces carbon dioxide and the polyamine cadaverine (1,5-diaminopentane)5. L-lysine and cadaverine can be reacted with 2,4,6-trinitrobenzensulfonic acid (TNBS) at high pH to generate N,N'-bistrinitrophenylcadaverine (TNP-cadaverine) and N,N&#8242;-bistrinitrophenyllysine (TNP-lysine), respectively11. The TNP-cadaverine can be separated from the TNP-lysine as the former is soluble in organic solvents such as toluene while the latter is not (See Figure 1). The linear range of the assay was determined empirically using purified cadaverine.

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

The activity of the inducible lysine decarboxylase is monitored by reacting the substrate L-lysine and the product cadaverine with 2,4,6-trinitrobenzensulfonic acid to form adducts that have differential solubility in toluene.

Ein Assay zur Messung der Aktivität von Escherichia coli Inducible Lysin Decarboxyase

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme ...

Crystallization of Membrane Proteins in Lipidic Mesophases

Membrane proteins perform critical functions in living cells related to signal transduction, transport and energy transformations, and, as such, are implicated in a multitude of malfunctions and diseases. However, a structural and functional understanding of membrane proteins is strongly lagging behind that of their soluble partners, mainly, due to difficulties associated with their solubilization and generation of diffraction quality crystals. Crystallization in lipidic mesophases (also known as in meso or LCP crystallization) is a promising technique which was successfully applied to obtain high resolution structures of microbial rhodopsins, photosynthetic proteins, outer membrane beta barrels and G protein-coupled receptors. In meso crystallization takes advantage of a native-like membrane environment and typically produces crystals with lower solvent content and better ordering as compared to traditional crystallization from detergent solutions. The method is not difficult, but requires an understanding of lipid phase behavior and practice in handling viscous mesophase materials. Here we demonstrate a simple and efficient way of making LCP and reconstituting a membrane protein in the lipid bilayer of LCP using a syringe mixer, followed by dispensing nanoliter portions of LCP into an assay or crystallization plate, conducting pre-crystallization assays and harvesting crystals from the LCP matrix. These protocols provide a basic guide for approaching in meso crystallization trials; however, as with any crystallization experiment, extensive screening and optimization are required, and a successful outcome is not necessarily guaranteed.

The protocols describe the essential steps for obtaining diffraction quality crystals of a membrane protein starting from reconstitution of the protein in a lipidic cubic phase (LCP), finding initial conditions with LCP-FRAP pre-crystallization assays, setting up LCP crystallization trials and harvesting crystals.

Die Kristallisation von Membranproteinen in Lipidische Mesophasen

Membrane proteins perform critical functions in living cells related to signal transduction, transport and energy transformations, and, as such, are ...

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted into fuel alcohols1. The potential for enzymatic hydrolysis of cellulosic biomass to provide renewable energy has intensified efforts to engineer cellulases for economical fuel production2. Of particular interest are fungal cellulases3-8, which are already being used industrially for foods and textiles processing.
Identifying active variants among a library of mutant cellulases is critical to the engineering process; active mutants can be further tested for improved properties and/or subjected to additional mutagenesis. Efficient engineering of fungal cellulases has been hampered by a lack of genetic tools for native organisms and by difficulties in expressing the enzymes in heterologous hosts. Recently, Morikawa and coworkers developed a method for expressing in E. coli the catalytic domains of endoglucanases from H. jecorina3,9, an important industrial fungus with the capacity to secrete cellulases in large quantities. Functional E. coli expression has also been reported for cellulases from other fungi, including Macrophomina phaseolina10 and Phanerochaete chrysosporium11-12. 
We present a method for high throughput screening of fungal endoglucanase activity in E. coli. (Fig 1) This method uses the common microbial dye Congo Red (CR) to visualize enzymatic degradation of carboxymethyl cellulose (CMC) by cells growing on solid medium. The activity assay requires inexpensive reagents, minimal manipulation, and gives unambiguous results as zones of degradation (&#x201C;halos&#x201D;) at the colony site. Although a quantitative measure of enzymatic activity cannot be determined by this method, we have found that halo size correlates with total enzymatic activity in the cell. Further characterization of individual positive clones will determine , relative protein fitness. 
Traditional bacterial whole cell CMC/CR activity assays13 involve pouring agar containing CMC onto colonies, which is subject to cross-contamination, or incubating cultures in CMC agar wells, which is less amenable to large-scale experimentation. Here we report an improved protocol that modifies existing wash methods14 for cellulase activity: cells grown on CMC agar plates are removed prior to CR staining. Our protocol significantly reduces cross-contamination and is highly scalable, allowing the rapid screening of thousands of clones. In addition to H. jecorina enzymes, we have expressed and screened endoglucanase variants from the Thermoascus aurantiacus and Penicillium decumbens (shown in Figure 2), suggesting that this protocol is applicable to enzymes from a range of organisms.

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

We describe a low cost, high throughput method to screen for fungal endoglucanase activity in E. coli. The method relies on a simple visual readout of substrate degradation, does not require enzyme purification, and is highly scalable. This allows for the rapid screening of large libraries of enzyme variants.

High Throughput Screening von Fungal Endoglucanaseaktivität in Escherichia coli</em

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through macromolecular X-ray crystallography (MX). An essential ingredient of MX is a steady supply of ideally diffraction-quality crystals. The in meso or lipidic cubic phase (LCP) method for crystallizing membrane proteins is one of several methods available for crystallizing membrane proteins. It makes use of a bicontinuous mesophase in which to grow crystals. As a method, it has had some spectacular successes of late and has attracted much attention with many research groups now interested in using it. One of the challenges associated with the method is that the hosting mesophase is extremely viscous and sticky, reminiscent of a thick toothpaste. Thus, dispensing it manually in a reproducible manner in small volumes into crystallization wells requires skill, patience and a steady hand. A protocol for doing just that was developed in the Membrane Structural &amp; Functional Biology (MS&amp;FB) Group1-3. JoVE video articles describing the method are available1,4. 
The manual approach for setting up in meso trials has distinct advantages with specialty applications, such as crystal optimization and derivatization. It does however suffer from being a low throughput method. Here, we demonstrate a protocol for performing in meso crystallization trials robotically. A robot offers the advantages of speed, accuracy, precision, miniaturization and being able to work continuously for extended periods under what could be regarded as hostile conditions such as in the dark, in a reducing atmosphere or at low or high temperatures. An in meso robot, when used properly, can greatly improve the productivity of membrane protein structure and function research by facilitating crystallization which is one of the slow steps in the overall structure determination pipeline. 
In this video article, we demonstrate the use of three commercially available robots that can dispense the viscous and sticky mesophase integral to in meso crystallogenesis. The first robot was developed in the MS&amp;FB Group5,6. The other two have recently become available and are included here for completeness.	
An overview of the protocol covered in this article is presented in Figure 1. All manipulations were performed at room temperature (~20 &deg;C) under ambient conditions.

Herein is described a robotic approach to high-throughput crystallization of membrane proteins in lipidic mesophases for use in structure determination using macromolecular X-ray crystallography. Three robots capable of handling the viscous and sticky protein-laden mesophase integral to the method are introduced.

Einsatz eines Roboters für High-Throughput-Kristallisation von Membranproteinen in Lipidische Mesophasen

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Intravital Microscopy for Imaging Subcellular Structures in Live Mice Expressing Fluorescent Proteins

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, we use the salivary glands of live mice since they provide several advantages. First, they can be easily exposed to enable access to the optics, and stabilized to facilitate the reduction of the motion artifacts due to heartbeat and respiration. This significantly facilitates imaging and tracking small subcellular structures. Second, most of the cell populations of the salivary glands are accessible from the surface of the organ. This permits the use of confocal microscopy that has a higher spatial resolution than other techniques that have been used for in vivo imaging, such as two-photon microscopy. Finally, salivary glands can be easily manipulated pharmacologically and genetically, thus providing a robust system to investigate biological processes at a molecular level.
In this study we focus on a protocol designed to follow the kinetics of the exocytosis of secretory granules in acinar cells and the dynamics of the apical plasma membrane where the secretory granules fuse upon stimulation of the beta-adrenergic receptors. Specifically, we used a transgenic mouse that co-expresses cytosolic GFP and a membrane-targeted peptide fused with the fluorescent protein tandem-Tomato. However, the procedures that we used to stabilize and image the salivary glands can be extended to other mouse models and coupled to other approaches to label in vivo cellular components, enabling the visualization of various subcellular structures, such as endosomes, lysosomes, mitochondria, and the actin cytoskeleton.

Intravital microscopy is a powerful tool that enables imaging various biological processes in live animals. In this article, we present a detailed method for imaging the dynamics of subcellular structures, such as the secretory granules, in the salivary glands of live mice.

Intravitalmikroskopie zur Imaging subzellulärer Strukturen in lebenden Mäusen Ausdruck Fluoreszierende Proteine

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

Protokolle für die Implementierung einer<em&gt; Escherichia coli</em&gt; Basierend TX-TL Zellfreie Expression System für Synthetische Biologie

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. However, purifying proteins is sometimes challenging since many proteins are expressed in an insoluble form. When working with difficult or multiple targets it is therefore recommended to use high throughput (HTP) protein expression screening on a small scale (1-4&#160;ml cultures) to quickly identify conditions for soluble expression. To cope with the various structural genomics programs of the lab, a quantitative (within a range of 0.1-100 mg/L culture of recombinant protein) and HTP protein expression screening protocol was implemented and validated on thousands of proteins. The protocols were automated with the use of a liquid handling robot but can also be performed manually without specialized equipment.
Disulfide-rich venom proteins are gaining increasing recognition for their potential as therapeutic drug leads. They can be highly potent and selective, but their complex disulfide bond networks make them challenging to produce. As a member of the FP7 European Venomics project (<a href="http://www.venomics.eu">www.venomics.eu</a>), our challenge is to develop successful production strategies with the aim of producing thousands of novel venom proteins for functional characterization. Aided by the redox properties of disulfide bond isomerase DsbC, we adapted our HTP production pipeline for the expression of oxidized, functional venom peptides in the E. coli cytoplasm. The protocols are also applicable to the production of diverse disulfide-rich proteins. Here we demonstrate our pipeline applied to the production of animal venom proteins. With the protocols described herein it is likely that soluble disulfide-rich proteins will be obtained in as little as a week. Even from a small scale, there is the potential to use the purified proteins for validating the oxidation state by mass spectrometry, for characterization in pilot studies, or for sensitive micro-assays.

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

A protocol for the quantitative, high throughput expression screening and analytical purification of fusion proteins from small-scale Escherichia coli cultures is described and applied to the expression of disulfide-rich animal venom protein targets.

Hochdurchsatz-Screening Quantitative Expression und Aufreinigung rekombinanter zu Disulfid-reichen Proteine ​​Venom Produziert in Applied<em&gt; E. coli</em

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. ...

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Elastin-like polypeptides are repetitive biopolymers that exhibit a lower critical solution temperature phase transition behavior, existing as soluble unimers below a characteristic transition temperature and aggregating into micron-scale coacervates above their transition temperature. The design of elastin-like polypeptides at the genetic level permits precise control of their sequence and length, which dictates their thermal properties. Elastin-like polypeptides are used in a variety of applications including biosensing, tissue engineering, and drug delivery, where the transition temperature and biopolymer architecture of the ELP can be tuned for the specific application of interest. Furthermore, the lower critical solution temperature phase transition behavior of elastin-like polypeptides allows their purification by their thermal response, such that their selective coacervation and resolubilization allows the removal of both soluble and insoluble contaminants following expression in Escherichia coli. This approach can be used for the purification of elastin-like polypeptides alone or as a purification tool for peptide or protein fusions where recombinant peptides or proteins genetically appended to elastin-like polypeptide tags can be purified without chromatography. This protocol describes the purification of elastin-like polypeptides and their peptide or protein fusions and discusses basic characterization techniques to assess the thermal behavior of pure elastin-like polypeptide products.

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Elastin-like polypeptides are stimulus-responsive biopolymers with applications ranging from recombinant protein purification to drug delivery. This protocol describes the purification and characterization of elastin-like polypeptides and their peptide or protein fusions from Escherichia coli using their lower critical solution temperature phase transition behavior as a simple alternative to chromatography.

Nicht-chromatographischen Reinigung von rekombinantem Elastin-ähnliche Polypeptide und deren Fusionen mit Peptiden und Proteinen aus<em&gt; Escherichia coli</em

Elastin-like polypeptides are repetitive biopolymers that exhibit a lower critical solution temperature phase transition behavior, existing as soluble ...

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in vitro. In particular, we show that the poor solubility of Escherichia coli DNA polymerase III &#949; subunit (featuring 3&#8217;-5&#8217; exonuclease activity) is highly improved when the same protein is co-expressed with the &#945; and &#952; subunits (featuring DNA polymerase activity and stabilizing &#949;, respectively). We also show that protein co-expression in E. coli can be used to efficiently test the competence of subunits from different bacterial species to associate in a functional protein complex. We indeed show that the &#945; subunit of Deinococcus radiodurans DNA polymerase III can be co-expressed in vivo with the &#949; subunit of E. coli. In addition, we report on the use of protein co-expression to modulate mutation frequency in E. coli. By expressing the wild-type &#949; subunit under the control of the araBAD promoter (arabinose-inducible), and co-expressing the mutagenic D12A variant of the same protein, under the control of the lac promoter (inducible by isopropyl-thio-&#946;-D-galactopyranoside, IPTG), we were able to alter the E. coli mutation frequency using appropriate concentrations of the inducers arabinose and IPTG. Finally, we discuss recent advances and future challenges of protein co-expression in E. coli.

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

Protein co-expression is a powerful alternative to the reconstitution in vitro of protein complexes, and is of help in performing biochemical and genetic tests in vivo. Here we report on the use of protein co-expression in Escherichia coli to obtain protein complexes, and to tune the mutation frequency of cells.

Die vielfältigen Vorteile von Protein Co-expression in<em&gt; Escherichia coli</em

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in ...