Diese Forschung wurde von der National Science Foundation Grant IOS-1025642 (GBM) unterstützt. Wir danken Maria Harrison für den ARqua1 Stamm bereitstellt.

1. Leitfaden RNA Entwurf und Vektorkonstruktion <ol><li> Identifizieren Sie Zielsequenzen für die Gene von Interesse. Es gibt eine Vielzahl von Online - CRISPR Zielfindungsprogramme geeignet für diesen Schritt 13,14. HINWEIS: Hier verwenden wir den GN 20 GG Zielmotiv, aber andere Konstruktionen geeignet sein können , abhängig von der Anwendung oder Vektorsystem verwendet wird . </li><li> Design 60-mer gRNA Oligos der GN 19 Teil der Zielmotive von 5 &#39;und 3&#39; 20-nt - Sequenzen flankiert umfassen , die für die DNA - Anordnung erforderlich sind. Das endgültige 60-mer - Motiv ist: 5&#39;-TCAAGCGAACCAGTAGGCTT-GN 19 -GTTTTAGAGCTAGAAATAGC-3 &#39;. HINWEIS: Standard, entsalzt Primer funktionieren. </li><li> Bereiten Sie die vier DNAs für die Montage (Figur 1). Siehe ergänzende Datei für DNA-Sequenzen. <ol><li> Digest von 1 bis 5 &amp; mgr; g p201N: Cas9 10 Plasmid mit dem Restriktionsenzym Spe I in 1x Puffer 4 bei 37 ° C für 2 Stunden. Column-reinigen die eine verdauenL aut den Anweisungen des Herstellers. Resuspendieren in ~ 15 &amp; mgr; l 10 mM Tris-HCl, und Quantifizierung durch UV-Spektrophotometrie. </li><li> Durchführen einer zweiten mit dem Restriktionsenzym Swa I in 1x Puffer 3,1 bei 25 ° C für 2 Stunden zu verdauen. Überprüfen 100-200 ng auf einem 0,8% Agarosegel vollständige Verdauung zu bestätigen. HINWEIS: Ein richtig verdaute Plasmid wird bei 14.313 bp eine einzelne Bande haben. Anmerkung: Die Hitzeinaktivierung des Enzyms und Dephosphorylierung sind nicht erforderlich. Verdauten Plasmid kann bei -20 ° C gelagert werden. </li><li> PCR - Amplifikation der Medicago truncatula (Mt) U6 - Promotor und Gerüst DNAs aus dem pUC gRNA Shuttle 10 - Plasmid der Primer Swa I_MtU6F / MtU6R und ScaffoldF / Spe I_ScaffoldR jeweils unter Verwendung. Verwenden, um eine High-Fidelity-Polymerase mit den PCR-Bedingungen: 95 ° C für 3 min; 31 Zyklen (98 ° C für 20 sec, 60 ° C für 15 sec, 72 ° C für 30 sec); und 72 ° C für 5 min. <ol><li> Visualisieren ~ 3 ul Aliquots der PCR-products auf einem 1% Agarosegel der Amplifikation zu bestätigen. Die MtU6 Amplikon beträgt 377 bp und das Gerüst Amplikon beträgt 106 bp. Column-reinigen die verbleibenden PCR-Produkte gemäß den Anweisungen des Herstellers, zu quantifizieren durch UV-Spektrometrie und bei -20 ° C. </li></ol></li><li> Resuspendieren das gesamte Rohr von gRNA Oligos bis 100 &amp; mgr; M in Laborqualität Wasser. 1 ul 100 uM Oligo 500 ul 1x Buffer 2.1. Gut mischen. Wenn mehrere Oligos Pooling, fügen 1 ul jeder 100 &amp; mgr; M Oligo zum 1x Buffer 2.1 Rohr. Verwässertes Oligos können bei -20 ° C gelagert werden. </li></ol></li><li> Programmieren Sie einen Thermocycler bei 50 ° C zu halten, einen beheizten Deckel verwenden. Kombinieren von 100 ng (0,011 pmol) des linearisierten Vektor, 50 ng (0,2 pMol) von MtU6 Promotor, 12 ng (0,2 pMol) des Gerüsts, 1 ul (0,2 pmol) verdünntes gRNA oligo (n) und Wasser auf ein Volumen von 5 &amp; ​​mgr; l. In 5 ul 2x High-Fidelity DNA Montage Master-Mix, gut mischen und Spin-down. Inkubieren Reaktion für 60 min in der50 ° C Thermocycler. Dann legen Sie die Reaktion auf Eis. Hinweis: Die Reaktionsvolumina erhöht werden niedrige DNA-Ausbeuten zu werden. </li><li> Transformieren 2 &amp; mgr; l der Reaktion in kompetente E. coli - Zellen unter Verwendung von Standardtechniken und Platte auf LB , ergänzt mit 50 mg L -1 Kanamycin (Kan 50). Wachsen kontaktierten Zellen bei 37 ° C über Nacht. Speichern Sie die verbleibende DNA Montage Reaktion bei -20 ° C. </li><li> Colony Bildschirm durch PCR der Primer StUbi3P218R und ISceIR verwenden. Einen aliquoten der verbleibenden DNA-Baugruppe Reaktion mit Wasser 1: 5. Verwenden Sie 1 ul als positive Kontrolle für die Kolonie-Bildschirm und 1 ng Kreis p201N: Cas9 Plasmid als no-Insert Kontrolle. <ol><li> PCR amplifizieren unter den Bedingungen; 95 ° C für 3 min; 31 Zyklen (95 ° C für 30 sec, 58 ° C für 30 sec, 72 ° C für 30 sec); und bei 72 ° C für 5 min. Visualisieren PCR-Produkte auf einem 1% Agarosegel. Stellen Sie sicher, dass die korrekte Einfügungen haben eine Bande bei 725 bp und Vektoren Witzhout Einsätze (zB ungeschnittenen Vektor) wird eine 310-bp - Bande. </li></ol></li><li> Wachsen positive Kolonien in LB Kan 50 Flüssigkulturen über Nacht bei 37 ° C und reinigen Plasmide gemäß den Anweisungen des Herstellers. Sanger-Sequenz Plasmide mit dem StUbi3P218R Primer und richten Chromatogramme zu den MtU6 Promotor, Ziel und Gerüstsequenzen keine Fehler zu gewährleisten, wurden während der Klonierung. </li><li> Führen Sie Diagnose ein verdauen durch ~ 1 ug Plasmid Verdauen mit Eco RV und Sty I. Visualisierung auf einem 0,8% Agarosegel. Fragmente (in bp) sind: 4192, 2001, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318 und 174. </li><li> Verwenden DNA Montagevektoren zu konstruieren, mit mehreren gRNAs. <ol><li> Um einen Vektor mit zwei Kassetten gRNA konstruieren, verstärken die erste PCR-Position gRNA mit den Primern Swa I_MtU6F / UNS1_ScaffoldR und die zweite Position gRNA mit den Primern UNS1_MtU6F / Spe I_ScaffoldR von 1 ng von jedem der jeweiligen1.8 - Plasmide in den Schritten 1.1 aufgebaut. Verwenden Sie die PCR-Bedingungen in Schritt 1.3.3. Visualisieren ~ 3 &amp; mgr; l-Aliquote der PCR-Produkte auf einem 1% Agarosegel der Amplifikation zu bestätigen. Amplicons sind ~ 500 bp. </li><li> Kombinieren und un-gereinigte PCR-Produkte in einem 200 ul Röhrchen mischen etwa gleiche Mengen an (in der Regel 3 bis 4 &amp; mgr; l von jedem). Zur Montage fügen 1 ul PCR - Produkte kombiniert, 50 ng Swa I und Spe I linearisiert p201N: Cas9, Laborqualität Wasser zu 2,5 ul und 2,5 ul 2x High-Fidelity - Master - Mix DNA - Montage. Inkubieren in einem 50 ° C-Thermocycler für 15 min. Hinweis: Die DNA-Montageanleitungen eine 2 15 min Inkubation empfiehlt - 3 Fragmente. </li><li> Verwandeln Sie 1 bis 2 &amp; mgr; l in kompetente E. coli - Zellen und Platte auf LB Kan 50. Wachsen ausplattierten Zellen bei 37 ° C über Nacht. Speichern Sie die restlichen Reaktion bei -20 ° C. </li><li> Colony Bildschirm durch PCR mit Primern StUbi3P218R und ISceIR mit den gleichen Bedingungen wie in Schritt 1.6. Richtig cLones wird ein 1200 bp Amplikon haben. Wachsen positive Kolonien in LB Kan 50 Flüssigkulturen über Nacht und reinigen Plasmide. </li><li> Sanger-Sequenz Plasmide mit den Primern StUbi3P218R (deckt erster Position gRNA) und p201R (deckt zweiter Position gRNA). Richten Sie Chromatogramme zu den MtU6 Promotor, Ziel und Gerüstsequenzen. Diagnose verdauen mit Eco RV und Sty I in den folgenden Fragmente (in bp) führen wird: 4192, 2476, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, 174. Bolded Fragment der zweite gRNA enthält. </li></ol></li><li> Nach Erfüllung aller Qualitätskontrolle Erwartungen, verwandeln Plasmide in Agrobacterium 15 Stamm ARqua1 rhizogenes. 1 ul der Plasmid-prep bis 50 &amp; mgr; l elektrokompetente Zellen und elektroporieren in einem 1 mm Küvette mit den Einstellungen: 2,4 kV, 25 &amp; mgr; F und 200 Ω. Recover Zellen in ~ 500 ul SOC und schütteln bei 28 ° C für 2 Stunden. Platte auf LB Kan 50 und gZeile bei 28 ° C für 2 Tage. Führen Kolonie Bildschirm der gleichen Primer und PCR-Bedingungen als 1.3.3 verwenden. Machen Glycerin Aktien aus positiven Klonen. </li></ol> 2. Haarwurzel Transformation <ol><li> Sterilisieren Tomatensamen in 20% Haushaltsbleiche für 15 min unter konstantem Mischen. In einer Laminar-Flow-Haube, entfernen Sie das Bleichmittel und waschen in sterilen Labor-grade Wasser 3 mal. </li><li> Die Platte 30 Samen in einem GA-7 - Box mit ½ MS - Medium (2,22 g L -1 MS - Salze + Gamborg Vitamine, 10 g L -1 Saccharose, 3 g L -1 Gellangummi, pH - Wert 5,8). Keimen für ~ 2 Tage im Dunkeln, dann bewegen GA-7-Boxen zum Vorschein. Wachsen Sämlinge für ca. 4 Tage im Licht. </li><li> Der Tag vor der Transformation, Streifen aus A. rhizogenes Kulturen auf festem LB Kan 50 und wachsen über Nacht bei 28 ° C. </li><li> Tag der Transformation, in der Laminar-Flow-Haube montieren sterilen Materialien: 12 ml Kulturröhrchen, 50 ml konischen Röhrchen, ½ MS Flüssigkeit (kein Gellan gmgr; m), 200 uM Acetosyringons, Filterpapier, Petrischalen, Pinzetten und Skalpell, Pipetten und Pipettenspitzen. Zugeben von 25 &amp; mgr; l Acetosyringon zu 50 ml ½ MS und gieße ~ 6 ml in jedes Kulturröhrchen. </li><li> Verwenden Sie einen gebogenen 200 ul Spitze A. zu kratzen rhizogenes Zellen von der Platte und resuspendieren in den 6 ml ½ MS Flüssigkeit. Vortex das Rohr um die Zellen zu resuspendieren vollständig. Nach Resuspendieren Zellen aus jedem Vektor, messen die optische Dichte (OD) von 1 ml Zellen bei einer festen Wellenlänge von 600 nM. Sicherzustellen OD zwischen 0,2 und 0,4; verdünnen oder mehr Zellen als nötig hinzuzufügen. Wiederholen Sie dies für jedes Konstrukt. </li><li> In ~ 2 ml ½ MS Flüssigkeit in eine Petrischale mit einem sterilen Filterpapier. Excise Cotyledonen aus den Keimlingen und auf den angefeuchteten Filterpapier. Sobald alle Kotyledonen gesammelt worden ist, schneiden die distalen ~ 1 cm aus der Keimblätter, die sich in cotyledon Stücke mit zwei Schnittenden. In Explantate auf A. rhizogenes Lösungen, Mischung und Inkubation für 20 minmit gelegentlichen Invertierung. Anmerkung: Etwa 12 Explantaten pro Konstrukt werden routinemäßig verwendet, obwohl so viel wie 80 Explantate in 6 ml A. inokuliert wurden rhizogenes Lösung. </li><li> Während der A. rhizogenes Inkubation Filterpapier auf Petrischalen hinzufügen, eine pro Konstrukt transformiert. Auch setzen ½ MS feste Medien, keine Antibiotika, in der Laminar-Flow-Haube, um zu trocknen. </li><li> Scoop Cotyledonen aus A. rhizogenes Lösung mit einer sterilen Pinzette und auf trockenes Filterpapier. Deckel mit Petri Deckel Gewebe, um sicherzustellen, nicht austrocknen, während auf die nächste Transformation fortfahren. Blot Kotyledonen auf dem Filterpapier und Transfer, abaxial Seite nach oben, MS Medien auf ½. Wrap-Platten mit chirurgischen Band und Co-kultivieren im Dunkeln bei Raumtemperatur für 2 Tage. </li><li> Nach der Co-Kultivierung, Transfer Kotyledonen bis abaxial Seite mit MS - Medien mit 300 mg L -1 Ticarcillin / Clavulansäure (Tim 300, ergänzt ½ das Wachstum von resid zu verhindernual A. rhizogenes) und Kan 50 (für die Pflanzenauswahl) und wickeln mit chirurgischen Band. Pflegen Kulturen unter Leuchtstofflampen bei Raumtemperatur mit einer 16-Stunden-Photoperiode. </li><li> Nach ~ 1,5-2 Wochen Wurzeln mindestens 2 cm Länge werden aus den Cotyledonen Verwendung einer sterilen Pinzette herausgeschnitten und mit einem Skalpell und an MS Kan 50 Tim 300 media ½. Übertragen Sie 10 bis 15 Wurzeln auf einer einzigen Platte. Markieren Sie die Position der Wurzelspitzen mit einem Marker, wickeln mit chirurgischen Band, und halten in Kulturraum. </li><li> Nach einer Woche werden transformierte Wurzeln wachsen auf selektiven Medien gesehen. Ernten Sie eine Teilstichprobe von transformierten Wurzeln zur DNA-Extraktion die bevorzugte DNA-Extraktionsverfahren. Hinweis: Die Platten mit Kotyledonen kann für 2 gehalten werden - 3 wöchentliche Ernten, wonach die Wurzeln in einem wirren Durcheinander wachsen zeigen und sind schwer zu isolieren. Nicht geernteten Wurzelgewebe kann auf unbestimmte Zeit aufrechterhalten werden. Eine Vielzahl von Tests kann auf dem isolierten DNA-Probe durchgeführt werden,s auf DNA-Mutation Häufigkeit und Art bestimmen. Ergebnisse von einigen solchen Assays werden unten beschrieben. </li></ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+plant+genomes+with+CRISPR/Cas9.">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+of+sweet+orange+using+Cas9/sgRNA.">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li><li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat.">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li><li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model.">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li><li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modifications+in+soybean+with+CRISPR/Cas9.">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li><li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate:CoA+ligase+specificity+and+redundancy.">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li><li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CCTop:+An+Intuitive,+Flexible+and+Reliable+CRISPR/Cas9+Target+Prediction+Tool.">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li><li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-P:+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants.">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li><li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES.">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li><li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR/Cas9+system.">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genome+editing+made+easy:+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR/Cas+system.">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9.">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li><li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications.">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li><li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multiplicity+of+hairy+root+cultures:+Prolific+possibilities.">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li><li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.:+sexual+transmission+of+the+transformed+genotype+and+phenotype.">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li><li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misexpression+of+miR482,+miR1512,+and+miR1515+Increases+Soybean+Nodulation.">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li><li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations.">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li><li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vitro.+composite+plants:+an+inexpensive,+rapid+method+for+root+biology.">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li></ol>

Die Autoren haben nichts zu offenbaren.

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,...

Die Möglichkeit, gezielte DNA-Modifikationen mit CRISPR zu erzeugen / Cas9 hat ein großes Potenzial für funktionelle Genomik Studien. Es gibt zwei Komponenten des CRISPR / Cas9 Systems; die Cas9 Nuklease, abgeleitet von Staphylococcus pyogenes und einer etwa 100-nt Führungs RNA (gRNA) Molekül , das Cas9 die gezielte DNA - Stelle (n) 1 leitet. Zielerkennung wird durch den ersten übertragenen ~ 20-nt der gRNA, die für Hochdurchsatzproduktion von Targeting - Vektoren 2,3 ermöglicht. Die meisten Organismen , die so konstruiert werden können, bereits mit CRISPR / Cas9 Technologie 4,5 haben. In Pflanzen, konstitutive Promotoren, wie den CaMV 35S - Promotor, werden üblicherweise zum Antrieb der Expression der Nuklease Cas9 6 verwendet. Die gRNAs exprimiert werden, die RNA-Polymerase III U6 oder U3 Promotoren, die die erste Basis des gRNA schränkt entweder ein G, für U6 oder A für U3, für eine effiziente Transkription. Allerdings prom RNA-Polymerase IIOters, die frei von diesen Beschränkungen sind, wurden ebenfalls 7,8 verwendet. Verschiedene gRNAs DNA-Mutationen mit unterschiedlichen Effizienzen, induzieren und so kann es wichtig sein, um erste CRISPR Vektoren validieren, bevor in Ganzpflanzentransformationen zu investieren oder umfangreiche phänotypische Bildschirme einrichten. Transiente Expression von CRISPR - Konstrukte in Pflanzen durch Agroinfiltration beispielsweise unter Verwendung, führt im allgemeinen zu einer niedrigeren Frequenz Modifikations DNA im Vergleich zu stabilen Pflanzen 6, was den Nachweis von Mutationen schwieriger und phänotypischen Assays unpraktisch mit solchen Ansätzen. Sogenannte Haarwurzeln sind eine bequeme, alternative System, da eine große Anzahl von unabhängigen, stabil transformierte Materialien können innerhalb von Wochen erzeugt werden, wie für eine stabile Pflanzen Monate gegenüber. CRISPR Vektoren sind sehr effektiv DNA - Mutationen in Haarwurzeln 9,10 bei der Induktion. DNA-Montageverfahren abzubinden effizient DNA-Fragmente enthalten, überlastapping Enden 11. Ein wesentlicher Vorteil einiger DNA Montageverfahren ist die Fähigkeit , ssDNA (dh Oligos) in die zusammengesetzten Produkte einzuarbeiten. Da gRNAs nur ~ 20-nt lang und neue Ziele sind mit synthetisierten Oligos hergestellt werden, sind diese DNA-Montageverfahren gut zu CRISPR Klonen geeignet. Die Protokolle werden hier beschrieben auf der P201 - Reihe von CRISPR Vektoren basieren , die 10 Sojabohnen-, Pappel 12 erfolgreich eingesetzt wurde und nun Tomate. Das Klonierungsverfahren präsentiert bietet mehrere Vorteile gegenüber dem aktuellen Klonmethode 10. Nämlich voll funktionsfähige Vektoren können in einem einzigen Reaktions Klonierung in einem einzigen Tag erzeugt werden. Vektorkonstruktion kann auch mehrere CRISPR Vektoren parallel weiter zu reduzieren Handhabungszeit und Materialkosten zu erzeugen gepoolt werden. Wir stellen auch ein Protokoll für die Erzeugung von Tomatenhaarwurzeln als eine effiziente Methode transgenen Materialien mit Zielgen Deletionen zu erzeugen. Hairy Wurzeln sind gültig verwendetaßen die CRISPR Vektoren und liefern Material für nachfolgende Experimente.

<table border="0" cellpadding="0" cellspacing="0" width="761">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:219px;">NEBuilder&#174; (HiFi DNA assembly mix)</td>
			<td style="width:139px;">New England Biolabs</td>
			<td style="width:247px;">E5520</td>
			<td style="width:157px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p201N:Cas9</td>
			<td>Addgene</td>
			<td>59175</td>
			<td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pUC gRNA Shuttle</td>
			<td>Addgene</td>
			<td>47024</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SwaI</td>
			<td>New England Biolabs</td>
			<td>R0604S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SpeI</td>
			<td>New England Biolabs</td>
			<td>R0133S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Zymo clean and concentrator-5 column purification</td>
			<td>Zymo Research</td>
			<td>D4003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 2.1</td>
			<td>New England Biolabs</td>
			<td>B7202S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB CutSmart (Buffer 4)</td>
			<td>New England Biolabs</td>
			<td>B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 3.1</td>
			<td>New England Biolabs</td>
			<td>B7203S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EconoSpin Mini Spin Column (plasmid prep)</td>
			<td>Epoch Life Sciences</td>
			<td>1910-050/250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EcoRV-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3195S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">StyI-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3500S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MS Salts + Gamborg Vitamins</td>
			<td>Phytotechnology Laboratories</td>
			<td>M404</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phytagel&#8482; (gellan gum)</td>
			<td>Sigma Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">GA-7 Boxes</td>
			<td>Sigma Aldrich</td>
			<td>V8505</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Micropore&#8482; surgical tape</td>
			<td>3M</td>
			<td>1535-0</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Timentin&#174; (Ticarcillin/Clavulanic acid)</td>
			<td>Various</td>
			<td>0029-6571-26</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers 5&#39; -&#62; 3&#39;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SwaI_MtU6F&#160;</td>
			<td colspan="3">GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MtU6R&#160;&#160;</td>
			<td colspan="2">AAGCCTACTGGTTCGCTTGAAG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ScaffoldF&#160;</td>
			<td colspan="2">GTTTTAGAGCTAGAAATAGCAAGTT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SpeI_Scaffold R</td>
			<td colspan="3">GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">StUbi3P218R&#160;</td>
			<td colspan="2">ACATGCACCTAATTTCACTAGATGT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ISceIR</td>
			<td colspan="2">GTGATCGATTACCCTGTTATCCCTAG</td>
			<td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_Scaffold R&#160;</td>
			<td colspan="2">GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_MtU6 F&#160;&#160;</td>
			<td colspan="3">CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p201R&#160;</td>
			<td colspan="2">CGCGCCGAATTCTAGTGATCG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="3" height="21" style="height:21px;">Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

CRISPR Vektorkonstruktion mit DNA-Baugruppe erzeugt typischerweise Dutzende bis Hunderte von unabhängigen Klonen. Colony Screening durch PCR identifiziert leicht korrekte Klone und kann zwischen Plasmide mit und ohne Einlagen (2A) unterscheiden , die für die Fehlersuche nützlich ist. Typischerweise enthalten alle Klone ein Insert und ein Benutzer entscheiden kann, die Kolonie-Screening Schritte ganz zu überspringen. Diagnostische Digests (2B) und San...

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

High-throughput CRISPR Vector Konstruktion und Charakterisierung von DNA-Modifikationen durch Erzeugung von Tomaten Hairy Roots

Verwendung von DNA-Baugruppe können mehrere CRISPR Vektoren parallel in einem einzigen Reaktions Klonierung konstruiert werden, wodurch die Konstruktion einer großen Anzahl von CRISPR Vektoren eine einfache Aufgabe. Tomato Haarwurzeln sind ein ausgezeichnetes Modellsystem CRISPR Vektoren zu validieren und mutierten Materialien erzeugen.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

high-throughput-crispr-vector-construction-characterization-dna

Research

JoVE Journal

Biology

17.8K Aufrufe.  Boyce Thompson Institute for Plant Research.  Verwendung von DNA-Baugruppe können mehrere CRISPR Vektoren parallel in einem einzigen Reaktions Klonierung konstruiert werden, wodurch die Konstruktion einer großen Anzahl von CRISPR Vektoren eine einfache Aufgabe. Tomato Haarwurzeln sind ein ausgezeichnetes Modellsystem CRISPR Vektoren zu validieren und mutierten Materialien erzeugen. 

Serie: High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be produced to contain any desired DNA or RNA sequence and can be prepared to include a wide variety of base and sugar modifications. Moreover, oligos can be designed to mimic specific nucleic acid alterations and thus, can serve as important tools to investigate effects of DNA damage and mechanisms of repair. We found that Thermo Scientific Dharmacon RNA-containing oligos with a length between 50 and 80 nucleotides can be particularly suitable to study, in vivo, functions and consequences of chromosomal RNA/DNA hybrids and of ribonucleotides embedded into DNA. RNA/DNA hybrids can readily form during DNA replication, repair and transcription, however, very little is known about the stability of RNA/DNA hybrids in cells and to which extent these hybrids can affect the genetic integrity of cells. RNA-containing oligos, therefore, represent a perfect vector to introduce ribonucleotides into chromosomal DNA and generate RNA/DNA hybrids of chosen length and base composition. Here we present the protocol for the incorporation of ribonucleotides into the genome of the eukaryotic model system yeast /Saccharomyces cerevisiae/. Yet, our lab has utilized Thermo Scientific Dharmacon RNA-containing oligos to generate RNA/DNA hybrids at the chromosomal level in different cell systems, from bacteria to human cells.

This work shows how to form an RNA/DNA hybrid at the chromosomal level and reveal transfer of genetic information from RNA to genomic DNA in yeast cells.

Generierung von RNA / DNA-Hybride in genomischer DNA durch Transformation mit RNA-haltigen Oligonukleotiden

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

Forschung

Biologie

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping project is to collect a tissue sample from each individual plant. The traditional approach to this task is to sample plants one-at-a-time. If one wishes to genotype hundreds or thousands of individuals, however, using this strategy results in a significant bottleneck in the genotyping pipeline. The Ice-Cap method that we describe here provides a high-throughput solution to this challenge by allowing one scientist to collect tissue from several thousand seedlings in a single day 1,2. This level of throughput is made possible by the fact that tissue is harvested from plants 96-at-a-time, rather than one-at-a-time.
The Ice-Cap method provides an integrated platform for performing seedling growth, tissue harvest, and DNA extraction. The basis for Ice-Cap is the growth of seedlings in a stacked pair of 96-well plates. The wells of the upper plate contain plugs of agar growth media on which individual seedlings germinate. The roots grow down through the agar media, exit the upper plate through a hole, and pass into a lower plate containing water. To harvest tissue for DNA extraction, the water in the lower plate containing root tissue is rapidly frozen while the seedlings in the upper plate remain at room temperature. The upper plate is then peeled away from the lower plate, yielding one plate with 96 root tissue samples frozen in ice and one plate with 96 viable seedlings. The technique is named "Ice-Cap" because it uses ice to capture the root tissue. The 96-well plate containing the seedlings can then wrapped in foil and transferred to low temperature. This process suspends further growth of the seedlings, but does not affect their viability. Once genotype analysis has been completed, seedlings with the desired genotype can be transferred from the 96-well plate to soil for further propagation. We have demonstrated the utility of the Ice-Cap method using Arabidopsis thaliana, tomato, and rice seedlings. We expect that the method should also be applicable to other species of plants with seeds small enough to fit into the wells of 96-well plates.

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

The Ice-Cap method allows one to grow plants in 96-well plates and non-destructively harvest root tissue from each seedling. DNA extracted from this root tissue can be used for genotyping reactions. We have found that Ice-Cap works well for Arabidopsis thaliana, tomato, and rice seedlings.

Ice-Cap: Ein Verfahren zur Züchtung von Arabidopsis Und Tomatenpflanzen in 96-well-Platten für High-Throughput-Genotypisierung

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

Substrat Generation für Endonukleasen der CRISPR / Cas-Systeme

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

Generierung von High Quality Chromatin Immunpräzipitation DNA Vorlage für Hochdurchsatz-Sequenzierung (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

Gezielte DNA Methylierungsanalyse von Next-Generation-Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Hochdurchsatz-Screening für Chemische Modulatoren der Post-transkriptionell regulierten Genen

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DAMiD-seq: Genomweite Mapping von Protein-DNA-Wechselwirkungen von Hochdurchsatz-Sequenzierung von Adenin-methylierten DNA-Fragmenten

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Amplification, Next-Generation-Sequenzierung und genomischer DNA Mapping von Retrovirale Integration Seiten

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Isolation, Characterization, And High Throughput Extracellular Flux Analysis of Mouse Primary Renal Tubular Epithelial Cells

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). Therefore, assessing mitochondrial function in primary TECs may provide valuable insight into the bioenergetic status of the cells, providing insight into the pathophysiology of CKD. While there are a number of complex protocols available for the isolation and purification of proximal tubules in different species, the field lacks a cost-effective method optimized for&#160;tubular cell isolation without the need for purification. Here, we provide an isolation protocol that allows for studies focusing on both primary mouse proximal and distal renal TECs. In addition to cost-effective reagents and minimal animal procedures required in this protocol, the isolated cells maintain high energy levels after isolation and can be sub-cultured up to four&#160;passages, allowing for continuous studies. Furthermore, using a high throughput extracellular flux analyzer, we assess the mitochondrial respiration directly in the isolated TECs in a 96-well plate for which we provide recommendations for the optimization of cell density and compound concentration. These observations suggest that this protocol can be used for renal tubular ex vivo studies with a consistent, well-standardized production of renal TECs. This protocol may have broader future applications to study mitochondrial dysfunction associated with renal disorders for drug discovery or drug characterization purposes.

This protocol provides a cost-effective approach to isolate and characterize mouse primary renal tubular cells that can subsequently be sub-cultured to assess renal biological functions ex vivo, including mitochondrial bioenergetics.

Isolierung, Charakterisierung und hohem Durchsatz extrazelluläre Flux-Analyse der Maus primäre renale tubuläre Epithelzellen

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective and widely available vaccines are lacking for a majority of these diseases, necessitating the development of novel disease mitigation strategies. To this end, a promising avenue of disease control involves targeting the vector microbiome, the community of microbes inhabiting the vector. The vector microbiome plays a pivotal role in pathogen dynamics, and manipulations of the microbiome have led to reduced vector abundance or pathogen transmission for a handful of vector-borne diseases. However, translating these findings into disease control applications requires a thorough understanding of vector microbial ecology, historically limited by insufficient technology in this field. The advent of next-generation sequencing approaches has enabled rapid, highly parallel sequencing of diverse microbial communities. Targeting the highly-conserved 16S rRNA gene has facilitated characterizations of microbes present within vectors under varying ecological and experimental conditions. This technique involves amplification of the 16S rRNA gene, sample barcoding via PCR, loading samples onto a flow cell for sequencing, and bioinformatics approaches to match sequence data with phylogenetic information. Species or genus-level identification for a high number of replicates can typically be achieved through this approach, thus circumventing challenges of low detection, resolution, and output from traditional culturing, microscopy, or histological staining techniques. Therefore, this method is well-suited for characterizing vector microbes under diverse conditions but cannot currently provide information on microbial function, location within the vector, or response to antibiotic treatment. Overall, 16S next-generation sequencing is a powerful technique for better understanding the identity and role of vector microbes in disease dynamics.

Here we present a next-generation sequencing protocol for 16S rRNA sequencing which enables identification and characterization of microbial communities within vectors. This method involves DNA extraction, amplification and barcoding of samples through PCR, sequencing on a flow-cell, and bioinformatics to match sequence data to phylogenetic information.

Tick Microbiome Charakterisierung von Next-Generation-16 s rRNA Amplikons Sequenzierung

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...