Diese Arbeit wurde vom Agriculture and Food Research Initiative wettbewerbsfähige Grant Nr. 2011-68003-30395 vom United States Department of Agriculture, nationalen Institut für Ernährung und Landwirtschaft im Rahmen des NoroCORE Projekts unterstützt. Open-Access-Gebühr wurde von der United States Department of Agriculture finanziert. Wir möchten danken Robert Atmar (Baylor College of Medicine, Houston, TX) freundlicherweise uns zur Verfügung gestellt die gereinigten Capsids und Valerie Lapham für ihre Unterstützung bei der TEM-Bilder. Wir möchten auch Frank N. Barry Danke für Ihre Hilfe die Experimente vorgestellt.

1. Platte-basierte verbindlich Test zur Bewertung der Verlust der höheren Norovirus Kapsid Auftragsstruktur Hinweis: ein sehr ähnliches ELASA Protokoll zu dem hier vorgestellten wurde veröffentlicht 29, und ähnliche ELASA Assays zuvor gemeldet wurden als Teil der Forschung anderswo 17 , 18 , 22 Artikel.
<ol><li>Wärmebehandlung von menschlichen Norovirus GII.4 Sydney Capsids <ol><li>erhalten gereinigte menschlichen Norovirus großen Kapsid Protein (VP1) von GII.4 Sydney (Beitritt: JX459908) montiert in Capsids. 
		Hinweis: Capsids in der Studie wurden mit freundlicher Genehmigung von R. Atmar (Baylor College of Medicine, Houston, TX).</li>
		<li>Verdünnt Capsids zu 50 µg/mL in 1 x Phosphat-gepufferte Kochsalzlösung (PBS, pH 7,2) auf eine maximale Lautstärke von 15 µL in aufgestellter PCR Einzelrohren. Sicherstellen, dass das Rohr mindestens 600 enthält ng Kapsid. Sicherzustellen, dass es 600 ng Kapsid pro Behandlung-Liganden Kombination.</li>
		<li>Vorheizen Thermocycler gewünschte Wärmebehandlung. 
		Hinweis: für die Zwecke dieses Protokolls, Behandlung bei 68 ° C für die verschiedenen Tageszeiten (0 - 25 min) gewählt wurde.</li>
		<li>Heizen eine zusätzliche Thermocycler bis 4 ° C für sofortige Kühlung. Die Thermocycler Röhren mit Kapsid-Lösung für die gewünschte Zeit hinzufügen. Sofort nach dem Erhitzen auf Cycler vorgekühlte 4 ° C für 5 min übertragen.
		<ol><li>Include 95 ° C für 5 min Behandlung als denaturiert Kapsid Kontrolle. Sind sie unbehandelt (23 ° C) Kapsid Lösung als Positivkontrolle. PBS mit keine Kapsid als eine zusätzliche negative Kontrolle enthalten.</li>
		</ol></li> <li>Kurz spin-down in einer Zentrifuge, alle Tropfen an der Unterseite des Rohres und die behandelten Kapsid Lösungen mit PBS-Puffer bis 3 µg/mL zu verdünnen. Sicherzustellen, dass es mindestens 200 µL verdünnt, behandelten Kapsid (100 µL/Well).</li>
	</ol></li> <li>Gelten 100 µL Kapsid Lösung in jede Vertiefung, gibt es mindestens zwei Brunnen pro Behandlung zu gewährleisten. Darüber hinaus gehören Sie 2 Kontroll-Vertiefungen mit 100 µL PBS für jedes Liganden; Dadurch wird die Hintergrund Extinktion des Assays. Die Platte mit einem Deckel abdecken, Versiegelung der Kanten mit Paraffin film um die Verdunstung zu reduzieren, und lassen über Nacht auf ein Schütteln Inkubator bei 4 ° C oder 2 h bei Raumtemperatur.</li>
	<li>Vorbereitung den blockierenden Puffer durch die 5 % Magermilch Feststoffe (w/V) in PBS mit 0,05 % Tween 20 (PBST).</li>
	<li>Entfernen die behandelten Kapsid-Lösungen von der Platte. Fügen Sie 200 µL/Well des blockierenden Puffer. 2 h bei Raumtemperatur inkubieren oder verschlossen über Nacht bei 4 ° c</li>
	Vorbereiten der Ligand verbindliche Lösungen für die biotinylierte Aptamer M6-2 18 , 29 und biotinylierte synthetischen HBGA Blutgruppe A oder biotinylierte Typ H. <li>
	<ol><li>Verdünnt biotinylierte Aptamer bis 1 µM in Nuklease-freies Wasser. Sicherzustellen Sie, dass es genug Lösung für 200 µL total für jede Behandlung. Verdünnen Sie der gewählten biotinylierte HBGA zu 30 µg/mL in der blocking-Puffer. Sicherzustellen, dass es genug Lösung für 200 µL Gesamtvolumen für jede Behandlung. 
		Hinweis: Um weniger HBGA zu verwenden, können 10 µg/mL HBGA in 0,25 % Magermilch-PBST ersetzt werden. Konzentrationen für biotinylierte M6-2 und HBGA wurden bisher optimiert und berichtet.</li>
	</ol></li> <li>Blockierende Puffer zu entfernen und waschen Sie die Platten 3 Mal mit 200 µL/Well PBST. Klopfen Sie die Platte auf dem Kopf stehend auf sterilen Papiertüchern trocknen die Restfeuchte.</li>
	<li>Hinzufügen 100 µL/Well des Liganden verbindliche Lösungen, um sicherzustellen, dass es 2 Brunnen pro Wärmebehandlung-Liganden-Kombination gibt. Die Platte bedeckt mit einem Deckel auf einem Orbitalschüttler bei ca. 60 u/min für 1 h bei Raumtemperatur inkubieren. 
	Hinweis: Achten Sie darauf, 2 Brunnen der unbehandelten Capsids und völlig denaturierten Capsids für jede Liganden bzw. als positive und negative Kontrollen umfassen. Darüber hinaus gehören 2 &#34; keine Kapsid &#34; Brunnen für jeden Liganden wie die Platte Hintergrund Kontrolle.</li>
	<li>Entfernen die Liganden-Lösungen und die Brunnen 3 Mal mit 200 µL/Well PBST waschen. Pat die Platte auf dem Kopf stehend auf sterilen Papiertüchern Restfeuchte trocknen.</li>
	<li>Hinzufügen 100 µL/Well-Lösung von 0,2 µg/mL Streptavidin-Meerrettich-Peroxidase mit PBS-Puffer. 15 min bei Raumtemperatur mit sanft schütteln auf einem Orbitalschüttler inkubieren. 
	Hinweis: Verschiedene Streptavidin-Meerrettich-Peroxidase-Konjugate haben unterschiedliche Konzentrationen. Wenden Sie sich an den Benutzer &#39; s-Handbuch für den idealen Bereich der Konzentrationen für ELISA Anwendungen des Enzyms und achten Sie darauf, dass es optimal ist.</li>
	<li>Die konjugierte Lösung entfernen. Waschen Sie 3 Mal mit 200 µL/Well PBST. Pat die Platte auf dem Kopf stehend auf sterilen Papiertüchern Restfeuchte trocknen.</li>
	<li>Hinzufügen 100 µL/Well 3,3 &#39;, 5,5 &#39;-Tetramethylbenzidine (TMB) Substrat, und lassen Sie die Farbe für 5-15 min. beobachten Negativkontrolle Brunnen für jede Farbe und achten Sie darauf, konsequent für den gleichen Zeitraum zwischen replizieren Platten entwickeln entwickeln. Beachten Sie die Extinktion-Palette von der Platte-Leser verwendet, sowie. 
	Hinweis: Die Entwicklungszeiten können unterscheiden sich je nach der Qualität der verwendeten Liganden/Reagenzien.</li>
	<li>Halten die Entwicklung der Reaktion mit 100 µL/Well 1M Phosphorsäure. Lesen Sie sofort Platte bei 450 nm. Sichern Sie Ihre Daten. 
	Hinweis: Einführung der Säure in der Regel die Reaktion drastisch verlangsamt aber nicht völlig stoppen. Lassen Sie die gestoppte Platte nicht für einen längeren Zeitraum hinweg vor dem Lesen der Extinktion.</li>
</ol> 2. Analyse der Untersuchungsergebnisse Platte-basierten <ol><li>sichern Sie die rohen Extinktion-Daten in einem Tabellenkalkulationsprogramm. Die durchschnittliche Absorptionswerte für jedes gut mit der spezifischen Behandlung und Liganden zu produzieren. Verwenden Sie diese Durchschnittswerte für alle nachfolgenden Analysen. 
	Hinweis: Vergleichen Sie beide gut Absorptionswerte um sicherzustellen, dass keine Paare von Brunnen deutlich unterschiedliche Werte haben.</li>
	<li>Analysieren die absolute Kapsid Integrität (alle Bindung), subtrahieren die rohe Extinktion von der &#34; keine Kapsid &#34; Steuerung von jedem anderen Extinktion Beispielwert. 
	Hinweis: Alternativ kann Verlust der Bindung durch den Verlust der höheren Ordnung (sekundären, tertiären, Quartär) Struktur direkt analysiert werden. Statt die Extinktion des Kontrollstreifens negativ (keine Kapsid) subtrahieren, subtrahieren Sie den Wert des Steuerelements vollständig denaturierten Kapsid. Dieser entfernt alle verbindenden signal aufgrund der unspezifischen Bindung an den Apparat als auch aufgrund der Kapsid Reihenfolge verbindlich. HBGA und Aptamer M6-2 Anzeigen wenig Bindung völlig denaturierten Kapsid, so dass beide Methoden ähnliche Ergebnisse produziert. Falsches positives Signal unspezifische Aptamer Bindung zugeschrieben betrachtet werden, bei der Wahl der Analyse verwenden.</li>
	<li>Mit der negativen oder denaturierte Steuerung angepasst Absorptionswerte, die Behandlung Absorptionswerte durch ihre jeweiligen positiven (keine Behandlung) Steuern Absorptionswerte und multiplizieren dividieren durch 100. Dadurch wird den Anteil des Signals von der behandelten Kapsid gegenüber der unbehandelten Kontrolle.</li>
	Subtrahieren Sie <li>zur Schätzung des verbindlichen Signal für jede Liganden auf die Kapsid-Sequenz, die &#34; keine Kapsid &#34; negative Kontrolle von der anfänglichen Absorptionswerte, und nehmen Sie die angepasste Extinktion von denaturierten Kapsid. Teilen Sie dies durch die angepassten Extinktion des positiven Steuersignals und mit 100 multiplizieren. Dies gibt die scheinbaren Prozentsatz des Signals durch Liganden Bindung an denaturierten Kapsid/Kapsid Sequenz.</li>
</ol> 3. DLS zum Nachweis von Virus-Aggregation nach der Wärmebehandlung Hinweis: Die folgenden Schritte möglicherweise spezifisch für die Software und Instrument verwendet, können aber angepasst und zu ähnlichen Geräten angewendet werden kann.
<ol><li>Erstellen eine neue Größe SOP in der DLS Instrument Software verwenden: Material = Protein, Dispergiermittel = PBS, Temperatur = 25 ° C, Gleichgewichtherstellung Zeit = 0 sec, Zelltyp = Einweg-Küvette (kleines Volumen, ZEN0040), Messwinkel = 173° Backscatter, Messdauer = Automatik, Anzahl der Messungen = 3, Verzögerung zwischen Messungen = 0 sec, Datenverarbeitung: Analysemodell = General Purpose (normale Auflösung). Verwenden Sie die Standardeinstellungen für alle anderen Parameter.</li>
	<li>Wählen Sie den grünen laufen Pfeil innerhalb der Software, und das Beispiel zu nennen.</li>
	<li>Schritte 1.1.1 bis 1.1.4 für die Wärmebehandlung von untersuchten.</li>
	<li>Verdünnt die Hitze untersuchten 01:10 in 1 X PBS für eine Endkonzentration von 5 µg/mL behandelt. (Optional) Filtern Sie die Probe mit einer 1 µm Porengröße, Staubpartikel zu entfernen; DLS ist sehr empfindlich gegenüber Staub, wie große Partikel wesentlich mehr Licht als Teilchen streuen.</li>
	<li>Transfer 50 µL verdünnter untersuchten in einem kleinen Volumen Einweg-Küvette. Legen Sie die Küvette in die Probenkammer des Instruments.</li>
	<li>Den Durchlauf starten und verwenden die &#39; Correlogram &#39;, &#39; Cumulants Fit &#39;, und &#39; Experte Beratung &#39; Registerkarten, um die Datenqualität zu bewerten.
	<ol><li>Während des Laufs zu prüfen, ob die Polydispersität-Index-Wert kleiner als 0,3 ist, stellvertretend für eine Qualität Messung. In der &#8216; MV &#8217; tab, stellen Sie sicher der Korrelationskoeffizient ist konstant und in der Nähe, aber nicht mehr als 1, in kurzer Zeit und scharf auf 0 zu einem späteren Zeitpunkt, charakteristisch für Partikelgröße abfällt. Verwendung der &#8216; Rat Experten &#8217; Registerkarte für Rückmeldung über die Qualität der Daten während der Messungen.</li>
		<li>Nachdem die Messung abgeschlossen ist, überprüfen Sie nochmals, dass die Polydispersität-Index-Wert ist kleiner als 0,3. Stellen Sie sicher, dass die Cumulants Linie folgt passen die Datenpunkte genau in die &#8216; passen Cumulants &#8217; tab.</li>
	</ol></li> <li>Nehmen im Durchschnitt von der Z-Durchschnitt Partikeldurchmesser für jede Messung als die Partikelgröße von jeder Probe berichtet. Plot den Durchmesser in nm vs. Temperatur in ° c</li>
</ol> 4. DLS zur Erkennung von Viren Aggregation in Echtzeit Hinweis: die folgenden Schritte möglicherweise spezifisch für die Software und Instrument verwendet, können aber angepasst und zu ähnlichen Geräten angewendet werden kann.
<ol><li>Erstellen eine neue Größe SOP in der DLS Instrument Software verwenden: Material = Protein, Dispergiermittel = PBS, Temperatur = als gewünschte, Gleichgewichtherstellung Zeit = 0 sec, Zelltyp = Quarz Küvette, Messwinkel = 173° Backscatter, Messdauer = Automatik, Anzahl der Messungen = 50 (möglicherweise erhöhten oder verringerten Abhängigkeit von Aggregation Rate), Verzögerung zwischen Messungen = 0 sec, Datenverarbeitung: Analysemodell = mehrere schmale Modi (hohe Auflösung). Verwenden Sie die Standardeinstellungen für alle anderen Parameter.</li>
	<li>Wählen Sie die Ausführungspfeil innerhalb der Software zu öffnen und ein neues Beispiel zu nennen, und ermöglichen das Instrument, das Temperatur-Gleichgewicht zu erreichen.</li>
	<li>Aussetzen der untersuchten mit 1 X PBS-Puffer in einem Microcentrifuge Schlauch in einer Konzentration von 5 µg/mL und ein Volumen zwischen 200-500 µL. Wirbel der Aufhängung.</li>
	<li>Spin-down der VLP-Aufhängung für 5-10 s in einer Tischplatte Zentrifuge zu de-Gas. Dies verhindert, dass Blasenbildung bei der Wärmebehandlung die Größenmessungen stört.</li>
	<li>Übertragung der VLP Aussetzung zu ein kleines Volumen Quarz Küvette vermeiden Sie Luftblasen und pipette langsam gegen die Wand von der Küvette. Nachdem das Instrument Temperatur Gleichgewicht erreicht hat, setzen Sie die Küvette in die Probenkammer.</li>
	<li>Warten 10 s für die Temperatur der Probe zu equilibrate, dann den Durchlauf starten. Starten Sie einen Timer zu Beginn des Laufs. Stoppen Sie die Zeitmessung am Ende der ersten Messung. Nutzt diese Zeit als die ersten Zeitpunkt. Späteren Zeitpunkt Punkte erzielen, von der Messzeiten von der Software erfasst.</li>
	<li>Den Durchlauf starten und überwachen die Correlogram, Verteilung passen und kompetente Beratung, die Datenqualität zu bewerten. 
	Hinweis: Die PDI wird nicht unbedingt, dass weniger als 0,3 für diese Messungen wie die Probe, während der Anhäufung Polydisperse sein soll.
	<ol><li>Stellen Sie sicher der Korrelationskoeffizient ist konstant und in der Nähe, aber nicht mehr als 1 in kurzer Zeit und zu einem oder mehreren späteren Zeiten, charakteristisch für Partikelgröße stark abfällt.</li>
		<li>Sicherstellen, dass die Verteilung passen Linie folgt die Datenpunkte eng.</li>
	</ol></li> <li>Größe Datenanalyse.
	<ol><li>Bestimmen jeweils Punkt aus der Zeitdifferenz zwischen jeder Messung und die erste Zeit-Punkt. Dauer der Messung sind nicht alle genau das gleiche.</li>
		<li>Mit eine Intensitätsverteilung, die Größe der Gipfel mit den größten Flächen für jede Messung/Zeitpunkt erfassen.</li>
		<li>Zeichnen Sie die Peak-Durchmesser in nm vs. Zeit in min.</li>
	</ol></li></ol> 5. TEM Probenvorbereitung <ol><li>erhalten Kohlenstoff Unterstützung Film (Nickel) Raster entworfen für TEM. 
	Hinweis: Wenden Sie sich an die zentrale Einrichtung auf empfohlene Reagenzien und deren Handhabung für den Einsatz mit dem Anlage-Mikroskop. Achten Sie darauf, Gitter in eine Kiste mit Trockenmittel oder eine Vakuumkammer zur Minimierung der Exposition gegenüber Feuchtigkeit zu speichern.</li>
	<li>Reißen ca. 5 x 5 cm Stück Filterpapier. Erhalten Glas Petrischalen und ordnungsgemäße selbstschließende Pinzette für den Einsatz in der Mikroskopie umkehren.</li>
	<li>Schneiden Sie ca. 2,5 x 5 cm Stück Paraffin Film. Auf die Benchtop.</li>
	<li>Wärmebehandlung von Norovirus GII.4 Sydney Capsids <ol><li>die Wärmebehandlung Schritte genau wie oben beschrieben in Schritte 1.1.1 - 1.1.5 außer: 10 mM HEPES (pH 7,4) für Behandlung anstelle von PBS und Capsids nicht weiter verdünnen nach der Behandlung (halten Sie Lösung bei 50 µg/mL). Pipette die gesamte ~ 15 µL Tropfen auf Paraffin Film behandelten Kapsid.</li>
	</ol></li> <li>Greifen die Raster-Kante mit einer Pinzette, so dass sie am Rand um das Raster zu halten in der Nähe und legen Sie die Gitter Kohlenstoff-Side-Down auf den Tropfen der behandelten Lösung. Lassen Sie für 10 min erlauben das Kapsid Anfügen an das Raster inkubieren.
	<ol><li>Abhängig von der Reinheit der Kapsid Zubereitung wäscht von 10 mM HEPES Lösung bei Bedarf hinzugefügt werden in Form von 10-15 µL Tröpfchen in Zeile nach der behandelten Kapsid Tropfen gestellt.</li>
		<li>Nach 10 min, nehmen Sie das Raster mit den Tropfen. Platzieren Sie das Raster fast senkrecht auf ein Stück Filterpapier, entfernt das Droplet Docht. Das Tröpfchen von 10-15 µL HEPES-Puffer mit dem Raster abholen, halten Sie für 30 s, dann Docht entfernt mit einem anderen Stück Filterpapier, Wash</li>
	</ol></li> <li>Einen 15 µL Tropfen 2 % Uranyl-Acetat-Lösung auf dem Paraffin-Film in einem leeren Bereich zu platzieren.
	<ol><li>Nehmen Sie das Droplet Uranyl-Acetat mit dem Gitter und halten für 45 S. Wick entfernt Uranyl-Acetat, wobei Sie auf die meisten der Lösung zu entfernen. Stellen die Gitter Kohlenstoff-Seite nach oben auf ein Stück Filterpapier, wobei Sie darauf achten, dass das Raster nicht &#34; Stick &#34; an der Feuchtigkeit auf die Pinzette. Das Filterpapier mit dem Gitter aufsetzen, in einem offenen Glas Petrischale. 
		Hinweis: Verwenden Sie Kunststoff Petrischalen, nicht, wie die Netze sie elektrostatisch angezogen werden und stecken zu Gericht.</li>
	</ol></li> <li>Wiederholen Sie für alle Behandlungen. Legen Sie die Petrischale-Hälften mit den Netzen in einem Exsikkator über Nacht zum Trocknen vor der Beobachtung mit TEM.</li>
	<li>Wenden Sie sich an die Mikroskopie-Anlage an der jeweiligen Institution in Bezug auf die vorbereiteten Gitter zu beobachten. Einige Einrichtungen ermöglichen dem Nutzer auf den Betrieb ihrer Anlage ausgebildet werden &#39; s Instrument. Bestimmte Details über die Einrichtung und die Beobachtung eines speziellen Mikroskops ist bEyond den Rahmen dieses Artikels sprengen.</li>
</ol>

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

Die Autoren haben nichts preisgeben.

Das Protokoll und die hier beschriebenen Techniken bieten ein Mittel zur Bewertung der menschlichen Norovirus Kapsid Integrität/Funktionalität. Diese Methoden können verwendet werden, für den Erhalt der mechanistische Einblicke in die Auswirkungen der Inaktivierung Behandlungen gegen das Virus und können potenziell traditionellere Inaktivierung Bewertungsmethoden wie RT-qPCR oder Plaque-Assay ergänzen. Beispielsweise sieht die Bewertung der chemischen oder physikalischen Inaktivierung durch Plaque-Assay allein ein ...

Menschlichen Norovirus ist verantwortlich für eine beträchtliche öffentliche Gesundheit Belastung weltweit verursacht ca. 685 Millionen Erkrankungen und 212.000 Todesfälle jährlich1, zu einem Preis in den Milliarden von Dollar2,3. Heute, beinhaltet Norovirus-Erkennung und Quantifizierung Genom Verstärkung bzw. Liganden-basierten Plattformen. Ersteres wird in der Regel bevorzugt, da es empfindlicher ist, quantitative Informationen liefert und in der Regel geringere Gefahr von falsch-positive Ergebnisse4 hat. Die am häufigsten verwendete Norovirus Erkennung und Quantifizierung Genom Verstärkung Technik ist Reverse Transkriptase quantitative Polymerase-Kettenreaktion (RT-qPCR). Denn es richtet sich an und ein kleines Segment des menschlichen Norovirus-Genoms verstärkt, RT-qPCR allein ist nicht in der Lage, die Unterscheidung zwischen dem infektiösen und nicht-infektiöse Partikel als kostenlose genomischen RNA, beschädigt tödlich Capsids mit Genomen und Capsids mit mutiert/abgeschnitten Genome können durch RT-qPCR noch verstärkt werden. Während vor kurzem zwei neue in-vitro- Kultivierung Techniken für menschliche Norovirus5,6 gemeldet wurden, beide noch verlassen sich auf RT-qPCR Virus Quantifizierung und noch nicht machbar Methoden für die routinemäßige klinische/Umwelt Tests für menschliche Noroviren. RT-qPCR bleibt daher den Goldstandard für klinische/Umwelttests.
Andere in-vitro- Methoden entstanden in dem Bemühen, die Infektiosität Status des Norovirus Partikel besser abschätzen zu können. Diese Methoden können in der Regel als diejenigen, die die Integrität der Norovirus Kapsid ansprechen und die Bewertung von Genom Integrität kategorisiert werden. Das erste Verfahren wird immer beliebter. Eine häufig verwendete Methode ist RNase Vorbehandlung vor der Extraktion der viralen genomischen RNA, aber dies nicht berücksichtigt werden, Viruspartikel, die intakt bleiben, aber nicht über die Fähigkeit, Host-Rezeptoren/co-Faktoren zu binden sowie Viruspartikel, die tödlich mutiert haben oder abgeschnitten oder Genome7geringfügig beschädigt haben. Kapsid Integrität kann auch ausgewertet werden, basierend auf die Fähigkeit des Virus binden an menschlichen Norovirus co-receptor/co-Faktoren, die Kohlenhydrate sind bekannt als Histo-Blut Gruppe Antigene (HBGAs). HBGAs sind in intestinalen Epithelzellen Host als Bestandteil von Glykoproteinen oder Glycolipide (unter mehreren anderen Geweben) und in Körperflüssigkeiten wie Speichel abgesondert werden kann. Magensaftresistente Bakterien mit HBGA-ähnlichen Substanzen auf ihrer Oberfläche haben auch gezeigt, dass menschliche Norovirus8,9,10binden und solche Interaktionen können Norovirus Infektion5fördern. Das grundlegende Konzept der Verwendung HBGA Bindung ist, dass nur virale Partikel binden die vermeintliche Rezeptor/co-factor in der Lage wäre, Zellen zu infizieren. Mehrere Studien deuten darauf hin, dass Wulst-basierte HBGA Bindung vor Nucleinsäureamplifikation eine viel versprechende Methode für Infektiosität Diskriminierung11,12,13,14ist, 15,16. Eine große Herausforderung für HBGAs ist, dass kein einziges HBGA Typ alle menschlichen Norovirus Genotypen binden kann. Um dieses Problem anzugehen, hat Schwein Magen Mucin, die HBGAs enthält, anstelle von gereinigten HBGA Kohlenhydrate im Interesse der einfachen Synthese, Konsistenz und reduzierten Kosten eingesetzt.
Einer kürzlich erschienenen Publikation von Moore Et al. 17 führte eine Reihe von neuen Techniken für die Schätzung der menschlichen Norovirus Kapsid Integrität. Anstelle von HBGAs, Moore Et al. 17 Bindung eines weitgehend reaktiven Nukleinsäure-Aptamer (M6-2)18 und im großen und ganzen reaktive monoklonaler Antikörper (NS14)19 , wärmebehandelte GII.4 Sydney Norovirus Capsids (virusähnliche Partikel oder untersuchten) untersucht und verglichen um die Bindung an synthetischen HBGAs. Nukleinsäure-Aptamere sind kurz (~ 20-80 nt) einzelne gestrandeten Nukleinsäuren (SsDNA oder RNA), die Falten zu einzigartigen dreidimensionalen Strukturen als Folge ihrer Sequenz und ein Ziel zu binden. Weil sie Nukleinsäuren sind, sind sie weniger kostspielig; leicht chemisch synthetisiert, gereinigte und modifiziert; und stabil gegen Hitze. Mehrere Berichte von Aptameren generiert gegen Noroviren gibt, mit einigen von ihnen zeigen breite Reaktivität verschiedener Stämme18,20,21,22. Zum Beispiel, Moore Et al. 17 unter Beweis gestellt, dass Aptamer M6-2 verpflichtet, gereinigt, zusammengebauten menschlichen Norovirus Capsids (untersuchten) und verhielt sich ähnlich, HBGA in die Abhängigkeit von der viralen Kapsid zu höherer Ordnung (z. B. sekundäre und tertiäre) Protein-Struktur für verbindliches auftreten. Auf der anderen Seite blieb ein erheblicher Anteil der Norovirus VLP Bindung an Antikörper NS14 nach Capsids völlig denaturiert wurden. Bewertung der Norovirus-Bindung in der Studie von Moore Et al. 17 erfolgte über eine einfache Platte-basierte Methode ähnlich wie ELISA, mit der Ausnahme, dass Aptamere anstelle von Antikörpern verwendet werden (daher ist die Methode ELASA hieß). Diese experimentellen Hochdurchsatz-Methode wurde zur Bewertung der Auswirkungen verschiedener Therapien auf das Norovirus Kapsid, Arbeit, die für das Verständnis des Mechanismus der viralen Inaktivierung bei Belastung durch physikalische oder chemische Stressoren wertvoll ist. Ein Nachteil dieser Methode ist jedoch die geringere Empfindlichkeit und Mangel an Toleranz für Matrix-assoziierte Kontaminanten auf höheren Ebenen, die unspezifische Bindung von Aptameren verursachen.
Moore Et al. 17 verwendet eine andere Methode, dynamische Lichtstreuung (DLS), Aggregation der Viruspartikel als Reaktion auf Wärmebehandlung zu überwachen. DLS ist häufig verwendet, um die Größe der Nanopartikel-Suspensionen zu bewerten und auf Proteine23,24 und Viren25,26,27erweitert. Die Intensität des Lichts verstreut durch Partikel in Lösung schwankt in Abhängigkeit von der Partikelgröße, so dass für die Berechnung des Diffusionskoeffizienten und dann Partikeldurchmesser mit bewährten Formeln. Die DLS-Technik kann den hydrodynamischen Durchmesser der dispergierten Partikel bis in den Nanobereich unterscheiden, die ermöglicht die Erkennung von verteilten Viren, individuelle Kapsid-Proteine oder Dimere und Virus-Aggregate, die anhand der Größe27. Virus-Aggregation, vertreten durch eine Erhöhung der Partikelgröße, zeugt vom Verlust der Integrität Kapsid. Das Kapsid ist denaturiert und seine Struktur gestört, hydrophoben Überreste ausgesetzt werden und dazu führen, dass die Teilchen zusammenhalten und Aggregate zu bilden. DLS kann verwendet werden, zur Messung der Partikelgröße nach einer bestimmten Behandlung oder die Kinetik der Aggregation in Echtzeit17,28. Diese Methode erfordert hohe Konzentrationen von gereinigten Kapsid, die möglicherweise nicht ganz repräsentativ für das Virus in seinem natürlichen Zustand aber hat den Vorteil, dass Beobachtung des Verhaltens Kapsid in Lösung.
Die letzte Methode von Moore Et Al. genutzt 17 Jahre alt war Transmissions-Elektronenmikroskopie (TEM). Obwohl diese Methode Empfindlichkeit fehlt und keine quantitative Daten erzeugt, ermöglicht es für die Visualisierung der Auswirkungen der verschiedenen Behandlungen auf die virale Kapsid-Struktur. Obwohl nicht noch ideal für klinische/Umgebungseinstellungen, ist der Einsatz dieser Methoden in Kombination wertvolle menschliche Norovirus Inaktivierung zu verstehen. Der Zweck dieses Artikels ist es, detaillierte Protokolle für die Platte basierende Bindung-Assay (ELASA), DLS, bieten und TEM Vorbereitung Methoden untersuchen die Auswirkungen der Wärmebehandlungen auf das Norovirus Kapsid im Zusammenhang mit den Behandlungen Auswirkungen auf Kapsid Integrität im Moore Et Al. vorgestellt 17.

<table><tbody><tr><td>&lt;strong&gt;Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>96-well, medium-binding polystyrene EIA plate</td><td>Fisher (Costar)</td><td>07-200-36</td><td></td></tr><tr><td>Lid for 96-well plate</td><td>Thermo Fisher</td><td>3098</td><td></td></tr><tr><td>Paraffin film (Parafilm)</td><td>Thermo Fisher</td><td>PM999</td><td></td></tr><tr><td>1x PBS (pH 7.2)</td><td>Life Technologies</td><td>20012-050</td><td></td></tr><tr><td>Polysorbate 20</td><td>Sigma-Aldrich</td><td>P9416</td><td></td></tr><tr><td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Purified, assembled human norovirus GII.4 capsids</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Individual 0.2 ml PCR tubes</td><td>Genesee Scientific</td><td>22-154G</td><td></td></tr><tr><td>2 thermocyclers</td><td>Bio-Rad</td><td>1861096</td><td></td></tr><tr><td>Tabletop mini centrifuge</td><td>Fisher Scientific</td><td>12-006-901</td><td></td></tr><tr><td>Skim milk solids</td><td>Thermo Fisher</td><td>LP0031B</td><td></td></tr><tr><td>Synthetic histo-blood group type A disaccharide, biotinylated</td><td>Glycotech</td><td>01-017</td><td></td></tr><tr><td>Biotinylated aptamer M6-2 (stock concentration 100 &amp;micro;M in nuclease-free water): 5&#039;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&amp;rsquo;</td><td>Integrated DNA Technologies</td><td>N/A</td><td></td></tr><tr><td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td><td>Life Technologies</td><td>SNN2004</td><td></td></tr><tr><td>3,3&amp;rsquo;,5,5&amp;rsquo;-tetramethylbenzidine (TMB) substrate, room temperature</td><td>Thermo Fisher</td><td>50-76-00</td><td></td></tr><tr><td>1 M phosphoric acid</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>Microplate reader capable of reading 450 nm</td><td>Tecan</td><td>Infinite m200 Pro</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Analysis of Plate-Based Assay Results&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Microsoft Excel or similar program</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Dynamic Light Scattering Experiments&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Zetasizer ZSP, or similar particle size analysis instrument</td><td>Malvern Instruments</td><td>N/A</td><td></td></tr><tr><td>Vortex</td><td>Fisher Scientifc</td><td>02-215-365</td><td></td></tr><tr><td>Quartz cuvette</td><td>Hellma</td><td>104-002-10-40</td><td></td></tr><tr><td>Small volume disposable cuvette (to reduce VLP use)</td><td>Malvern Instruments</td><td>ZEN0040</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Transmission Electron Microscopy Sample Preparation&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Nickel electron microscopy grids with carbon support film</td><td>Ladd Research</td><td>10880-100</td><td></td></tr><tr><td>Self-closing reverse electron microscopy tweezers</td><td>Ted Pella</td><td>5372-NM</td><td></td></tr><tr><td>Qualitative filter paper</td><td>Sigma-Aldrich (Whatman)</td><td>WHA1002055</td><td></td></tr><tr><td>Glass petri dishes</td><td>Sigma-Aldrich</td><td>BR455743</td><td></td></tr><tr><td>100 mM stock HEPES solution (pH 7.2)</td><td>N/A</td><td>N/A</td><td></td></tr><tr><td>2% uranyl acetate</td><td>N/A</td><td>N/A</td><td></td></tr></tbody></table>

alternative in vitro methods for the determination of viral capsid structural integrity

Menschlichen Norovirus fordert erhebliche öffentliche Gesundheit und wirtschaftliche Verluste weltweit. Schwellenländer in Vitro sind Anbau Fortschritte noch nicht anwendbar für routinemäßige Nachweis des Virus. Die aktuelle Erkennung und Quantifizierung Techniken, die in erster Linie auf Nucleinsäureamplifikation angewiesen sind, diskriminieren nicht infektiöse von nicht-infektiöse Viruspartikel. Der Zweck dieses Artikels ist es, spezifische Details über die jüngsten Fortschritte in Techniken zusammen, um weitere Informationen über den Status der Infektiosität der Viruspartikel erwerben zu präsentieren. Eine Technik beinhaltet die Beurteilung der Bindung von einer Norovirus SsDNA Aptamer, Capsids. Aptamere haben den Vorteil des Seins leicht synthetisiert und geändert und sind preiswert und stabil. Eine andere Technik, dynamisches Licht Streuung (DLS), hat den Vorteil der Beobachtung Kapsid Verhalten in Lösung. Elektronen-Mikroskopie ermöglicht eine Visualisierung der strukturellen Integrität der viralen Capsids. Obwohl mit dem Versprechen, gibt es einige Nachteile, jede Technik, wie z. B. Aptamer unspezifische Bindung an positiv geladene Moleküle aus Probe Matrizen, Erfordernis der gereinigten Kapsid für DLS und schlechte Empfindlichkeit für Elektronenmikroskopie. Dennoch, wenn diese Techniken in Kombination verwendet werden, versorgt den Körper der produzierten Daten umfassenderen Informationen auf Norovirus Kapsid Integrität, die verwendet werden, um die Infektiosität, Informationen ableiten, die wesentlich für die genaue Bewertung der Inaktivierungsverfahren oder Auslegung der Virenerkennung. Dieser Artikel enthält Protokolle für den Einsatz dieser Methoden, um menschlichen ansteckenden Norovirus Teilchen zu unterscheiden.

Die strukturelle Integrität des menschlichen Norovirus GII.4 Sydney Capsids (untersuchten) wurde anhand mehrere neuartige Methoden wie von Moore Et Al. vorgestellt 17. zunächst ein Experiment wurde durchgeführt, die die Integrität des Capsids in Abhängigkeit von ihrer Fähigkeit, eine vermeintliche Rezeptor/co-factor (HBGA) oder SsDNA Aptamer (M6-2) binden waren im Vergleich (Abbildung 1). Die angezeigten Ergebnisse wurde...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Routinemäßige Nachweismethoden nutzen virale Genom Verstärkung sind durch ihre Unfähigkeit, infektiöse von nicht-infektiöse Partikel unterscheiden begrenzt. Der Zweck dieses Artikels ist es, detaillierte Protokolle nach alternativen Methoden zur Diskriminierung von ansteckenden Norovirus Teilchen mit Aptamer Bindung, dynamische Lichtstreuung und Transmissions-Elektronenmikroskopie Unterstützung bieten.

Alternative In-vitro- Methoden zur Bestimmung der viralen Kapsid strukturelle Integrität

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

alternative-vitro-methods-for-determination-viral-capsid-structural

Research

JoVE Journal

Immunology and Infection

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

8.0K Aufrufe.  North Carolina State University. Routinemäßige Nachweismethoden nutzen virale Genom Verstärkung sind durch ihre Unfähigkeit, infektiöse von nicht-infektiöse Partikel unterscheiden begrenzt. Der Zweck dieses Artikels ist es, detaillierte Protokolle nach alternativen Methoden zur Diskriminierung von ansteckenden Norovirus Teilchen mit Aptamer Bindung, dynamische Lichtstreuung und Transmissions-Elektronenmikroskopie Unterstützung bieten.

Serie: Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Herstellung viraler DNA aus Nukleokapside

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Forschung

Immunologie und Infektion

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

In vitro Uncoating von HIV-1-Kerne

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

Einfach und robust In-vivo- Und In-vitro- Ansatz für das Studium Virusassemblierung

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

Isolation und Genomanalyse Einzel Virionen mit &#39;Single Virus Genomics&#39;

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Method for Measurement of Viral Fusion Kinetics at the Single Particle Level

Membrane fusion is an essential step during entry of enveloped viruses into cells. Conventional fusion assays typically report on a large number of fusion events, making it difficult to quantitatively analyze the sequence of the molecular steps involved. We have developed an in vitro, two-color fluorescence assay to monitor kinetics of single virus particles fusing with a target bilayer on an essentially fluid support.
Influenza viral particles are incubated with a green lipophilic fluorophore to stain the membrane and a red hydrophilic fluorophore to stain the viral interior. We deposit a ganglioside-containing lipid bilayer on the dextran-functionilized glass surface of a flow cell, incubate the viral particles on the planar bilayer and image the fluorescence of a 100 x 100 &mu;m2 area, containing several hundreds of particles, on a CCD camera. By imaging both the red and green fluorescence, we can simultaneously monitor the behavior of the membrane dye (green) and the aqueous content (red) of the particles.
Upon lowering the pH to a value below the fusion pH, the particles will fuse with the membrane. Hemifusion, the merging of the outer leaflet of the viral membrane with the outer leaflet of the target membrane, will be visible as a sudden change in the green fluorescence of a particle. Upon the subsequent fusion of the two remaining distal leaflets a pore will be formed and the red-emitting fluorophore in the viral particle will be released under the target membrane. This event will give rise to a decrease of the red fluorescence of individual particles. Finally, the integrated fluorescence from a pH-sensitive fluorophore that is embedded in the target membrane reports on the exact time of the pH drop.
From the three fluorescence-time traces, all the important events (pH drop, lipid mixing upon hemifusion, content mixing upon pore formation) can now be extracted in a straightforward manner and for every particle individually. By collecting the elapsed times for the various transitions for many individual particles in histograms, we can determine the lifetimes of the corresponding intermediates. Even hidden intermediates that do not have a direct fluorescent observable can be visualized directly from these histograms.

We present an in vitro, two-color fluorescence assay to visualize the fusion of single virus particles with a fluid target bilayer. By labeling viral particles with fluorophores that differentially stain the viral membrane and its interior, we are able to monitor the kinetics of hemifusion and pore formation.

Methode zur Messung des Viral Fusion Kinetics auf der Single Particle Stufe

Membrane fusion is an essential step during entry of enveloped viruses into cells. Conventional fusion assays typically report on a large number of fusion ...

Biologie

Highly Sensitive Assay for Measurement of Arenavirus-cell Attachment

Arenaviruses are a family of enveloped RNA viruses that cause severe human disease. The first step in the arenavirus life cycle is attachment of viral particles to host cells. While virus-cell attachment can be measured through the use of virions labeled with biotin, radioactive isotopes, or fluorescent dyes, these approaches typically require high multiplicities of infection (MOI) to enable detection of bound virus. We describe a quantitative (q)RT-PCR-based assay that measures Junin virus strain Candid 1 attachment via quantitation of virion-packaged viral genomic RNA. This assay has several advantages including its extreme sensitivity and ability to measure attachment over a large dynamic range of MOIs without the need to purify or label input virus. Importantly, this approach can be easily tailored for use with other viruses through the use of virus-specific qRT-PCR reagents. Further, this assay can be modified to permit measurement of particle endocytosis and genome uncoating. In conclusion, we describe a simple, yet robust assay for highly sensitive measurement of arenavirus-cell attachment.

The first step in the arenavirus life cycle is attachment of viral particles to host cells. We report a quantitative (q)RT-PCR-based assay for ultrasensitive detection and quantitation of arenavirus attachment events.

Hochempfindliches Verfahren zur Messung von Arenavirus-Zell-Anlage

Arenaviruses are a family of enveloped RNA viruses that cause severe human disease. The first step in the arenavirus life cycle is attachment of viral ...

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus (IAV), virus fusion with the endosomal membrane as well as the subsequent disassembly of the viral capsid, called uncoating, is governed by the ionic conditions inside endocytic vesicles. The early steps in the virus life cycle are hard to study because endosomes cannot be directly accessed experimentally, creating the need for an in vitro approach. Here, we describe a method based on velocity gradient centrifugation of purified virions through a two-layer glycerol gradient, which enables analysis of the IAV core and its stability. The gradient contains a non-ionic detergent (NP-40) in its lower layer to remove the viral membrane by solubilization as the virus sediments toward the bottom. At neutral pH, viral cores are pelleted as stable structures. The major core components, matrix protein (M1) and the viral ribonucleoproteins (vRNPs), can be clearly identified in the pellet fraction by SDS-PAGE. Decreasing the pH to 6.0 or lower in the bottom layer selectively removes M1 from the pellet followed by release of vRNPs at more acidic conditions. Viral protein bands on Coomassie-stained gels can be subjected to densitometric quantification to monitor intermediate states of IAV disassembly. Besides pH, other factors that influence viral core stability can be assessed, such as salt concentration and putative viral uncoating factors, simply by modifying the detergent-containing glycerol layer accordingly. Taken together, the presented technique allows highly reproducible and quantitative analysis of viral uncoating in vitro. It can be applied to other enveloped viruses that undergo complex uncoating processes.

In Vitro Disassembly of Influenza A Virus Capsids by Gradient Centrifugation

Disassembly of influenza A virus cores during virus entry into host cells is a multistep process. We describe an in vitro method to analyze the early stages of viral uncoating. In this approach, velocity gradient centrifugation is used to biochemically dissect the steps that initiate uncoating under defined conditions.

In - vitro - Zerlegung von Influenza - A - Virus Kapside durch Gradientenzentrifugation

Acid-triggered molecular processes closely control cell entry of many viruses that enter through the endocytic system. In the case of influenza A virus ...

Correlative Light Electron Microscopy (CLEM) for Tracking and Imaging Viral Protein Associated Structures in Cryo-immobilized Cells

Due to its high resolution, electron microscopy (EM) is an indispensable tool for virologists. However, one of the main difficulties when analyzing virus-infected or transfected cells via EM are the low efficiencies of infection or transfection, hindering the examination of these cells. In order to overcome this difficulty, light microscopy (LM) can be performed first to allocate the subpopulation of infected or transfected cells. Thus, taking advantage of the use of fluorescent proteins (FPs) fused to viral proteins, LM is used here to record the positions of the "positive-transfected" cells, expressing a FP and growing on a support with an alphanumeric pattern. Subsequently, cells are further processed for EM via high pressure freezing (HPF), freeze substitution (FS) and resin embedding. The ultra-rapid freezing step ensures excellent membrane preservation of the selected cells that can then be analyzed at the ultrastructural level by transmission electron microscopy (TEM). Here, a step-by-step correlative light electron microscopy (CLEM) workflow is provided, describing sample preparation, imaging and correlation in detail. The experimental design can be also applied to address many cell biology questions.

Correlative Light Electron Microscopy CLEM for Tracking and Imaging Viral Protein Associated Structures in Cryo-immobilized Cells

A correlative light electron microscopy (CLEM) method is applied to image virus-induced intracellular structures via electron microscopy (EM) in cells that are previously selected by light microscopy (LM). LM and EM are combined as a hybrid imaging approach to achieve an integrated view of virus-host interactions.

Korrelative Licht Elektronenmikroskopie (CLEM) für die Verfolgung und Imaging virales Protein verbundenen Strukturen in den Cryo-immobilisierten Zellen

Due to its high resolution, electron microscopy (EM) is an indispensable tool for virologists. However, one of the main difficulties when analyzing ...

Biotechnik

Assembly and Purification of Prototype Foamy Virus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an integrase (IN) enzyme that catalyzes the covalent joining of viral to host DNA, which is known as strand transfer. Integration may be modeled in vitro with recombinant retroviral IN and DNA oligomers mimicking the ends of the viral genome. In order to more closely recapitulate the integration reaction that occurs in vivo, integration complexes are assembled from recombinant IN and synthetic oligomers by dialysis in a reduced salt concentration buffer. The integration complex, called an intasome, may be purified by size exclusion chromatography. In the case of prototype foamy virus (PFV), the intasome is a tetramer of IN and two DNA oligomers and is readily separated from monomeric IN and free oligomer DNA. The integration efficiency of PFV intasomes may be assayed under a variety of experimental conditions to better understand the dynamics and mechanics of retroviral integration.

Recombinant retroviral integrase and DNA oligomers mimicking viral DNA ends can form an enzymatically active complex known as an intasome. Intasomes may be used for biochemical, structural, and kinetic studies. This protocol details how to assemble and purify prototype foamy virus intasomes.

Montage und Reinigung der Prototyp schaumig Virus Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

Production of Adeno-Associated Virus Vectors in Cell Stacks for Preclinical Studies in Large Animal Models

Adeno-associated virus (AAV) vectors are among the most clinically advanced gene therapy vectors, with three AAV gene therapies approved for humans. Clinical advancement of novel applications for AAV involves transitioning from small animal models, such as mice, to larger animal models, including dogs, sheep, and nonhuman primates. One of the limitations of administering AAV to larger animals is the requirement for large quantities of high-titer virus. While suspension cell culture is a scalable method for AAV vector production, few research labs have the equipment (e.g., bioreactors) or know how to produce AAV in this manner. Moreover, AAV titers are often significantly lower when produced in suspension HEK 293 cells as compared to adherent HEK293 cells. Described here is a method for producing large quantities of high-titer AAV using cell stacks. A detailed protocol for titering AAV as well as methods for validating vector purity are also described. Finally, representative results of AAV-mediated transgene expression in a sheep model are presented. This optimized protocol for large-scale production of AAV vectors in adherent cells will enable molecular biology laboratories to advance the testing of their novel AAV therapies in larger animal models.

Here we provide a detailed procedure for large-scale production of research-grade AAV vectors using adherent HEK 293 cells grown in cell stacks and affinity chromatography purification. This protocol consistently yields &#62;1 x 1013 vector genomes/mL, providing vector quantities appropriate for large animal studies.

Herstellung von Adeno-assoziierten Virusvektoren in Zellstapeln für präklinische Studien in Großtiermodellen

Adeno-associated virus (AAV) vectors are among the most clinically advanced gene therapy vectors, with three AAV gene therapies approved for humans. ...