Jennifer Deke und Urszula Zarzenska danken wir für ihre wissenschaftliche Unterstützung. Diese Arbeit wurde von einem Career Integration Grant (CIG, PCIG14-GA-2013-63 0734) von der Europäischen Kommission im Rahmen des 7. Rahmenprogramms, Grant LFF-GK06 'DELIGRAH' (Landesforschungsförderung Hamburg) und das DFG-Stipendium (DFG-KE 856_6-1) finanziell unterstützt. verliehen an JK.

1. Probenahme und Vorbereitung der Phloem-Saft von B. Napus Pflanzen 4,8,20
<ol><li>Phloem SAP Probenahme, verwenden gut bewässerten 8 Wochen alten B. Napus Pflanzen dieser Show nur erste Blüte um Pollen Kontaminationen zu verhindern.</li>
	<li>Verwenden eine Injektionsnadel (Ø 0,8 mm) und punctata der Blütenstand ergeben sich mehrere Male. Wiederholen Sie bei mehreren anderen Blütenstand Stengel und an anderen Pflanzen genug Phloem Sap (Abbildung 2a) zu erhalten. Hinweis: Für die komplexe Analyse empfiehlt es mit mindestens 600 µL Phloem Sap zu starten. 4 bis 5 Pflanzen werden zwischen 200 und 700 µL Phloem Sap ergeben.</li>
	<li>Wischen Sie den ersten Tropfen von den verletzten Seiten mit Filterpapier. Diese Tropfen vor allem stark belasteten Material aus den umliegenden verletzte Gewebe enthalten und müssen verworfen werden.</li>
	<li>Sammeln Sie die folgenden Tropfen durch pipettieren und speichern Sie die gesammelten Exsudat in einem vorgekühlt konische 1,5 mL Reaktionsgefäß bei-20 ° C mit einem eisfreien Kühlsystem.</li>
	<li>Weiter sammeln, bis keine weitere Tropfenbildung zu beobachten, aber nicht länger als 1 h ist. Dieses Verfahren kann nach zwei Tagen ohne erheblichen Verlust der gesammelten Phloem Sap wiederholt werden. Hinweis: Der gesammelten Phloem-Saft sofort genutzt oder gespeichert werden kann bei-80 ° C zur späteren Analyse. Für die-80 ° C Lagerung Schock-Freeze das Reaktionsgefäß in flüssigem Stickstoff.</li>
	<li>Die Phloem Probe zu ca. 1/6th das Ausgangsvolumen mit zentrifugalen Konzentratoren mit einem Molekulargewicht abgeschnitten (MWCO) von 10.000 Dalton (Da) zu konzentrieren. Zentrifugieren Sie die konzentrierte Probe bei 4 ° C und 20.000 x g für mindestens 15 min. um Staubpartikel zu entfernen. Hinweis: Phloem SAP-Konzentration führt nicht zu einem erheblichen Verlust von Proteinen.</li>
	<li>Fahren Sie für nachfolgende Funktionentheorie mit Schritt 3.1.</li>
</ol>(2) Phloem SAP-Reinheitskontrolle mit Reverse Transkriptase PCR (RT-PCR) 4,8,20
<ol><li>Gesamt-RNS aus Phloem-Saft mit einer standard RNA Extraktionsmethode für flüssiges Material zu isolieren (z.B. TRIzol oder Phenol-Chloroform-Extraktion gefolgt von Isopropanol Niederschlag aus der wässrigen Phase und Ethanol Waschschritten gemäß der des Herstellers Protokoll). Achtung: Phenol-Chloroform ist giftig. Arbeiten Sie unter einer Haube mit geeigneter persönlicher Schutzausrüstung. Bis zu sechs Monaten kann die extrahierte RNA in Ethanol bei-80 ° C aufbewahrt werden.</li>
	<li>Entfernen Sie Verunreinigungen der DNA durch Verdauung mit DNase I (1 u/µg) für 45 min bei 37 ° C und inaktivieren das Enzym durch Zugabe von EDTA, eine Endkonzentration von 5 mM und die Probe bei 75 ° C für 10 min inkubieren.</li>
	<li>Um reine RNA, zu reinigen und die Probe zu konzentrieren, indem eine weitere Reinigungsstufe (z. B. mit RNA-Cleanup-Kits, gemäß den Anweisungen des Herstellers).</li>
	<li>Führen Sie eine Reverse Transkriptase PCR (RT-PCR) für die Synthese der cDNA mit einer cDNA Synthese Kit mit 150 ng reine RNA wie vom Hersteller beschrieben ist das Protokoll. Hinweis: Die cDNA kann bei-20 ° C bis zur weiteren Verwendung gespeichert werden.</li>
	<li>Verwenden Sie 5 µL cDNA als Vorlage für eine standard-PCR-Reaktion wie vom Hersteller angegeben, Fach-spezifische Protokolle zu verstärken und durch Agarose-Gelelektrophorese überprüfen. Bestätigen Sie die Reinheit der Phloem Proben z.B. mit Primer für Rubisco kleine Untereinheit, Thioredoxin-h und die Pollen-Hüllprotein (Abbildung 1 b, Tabelle 1).</li>
</ol>3. blaue native Seite 4,25,26,31
<ol><li>Verwenden Sie entweder selbst gegossenen native gradient Gele wie beschrieben an anderer Stelle27 oder kommerziellen Bis-Tris gradient Gele.</li>
	<li>Laden Sie mindestens 20 bis 30 µg der konzentrierten Proteins Probe pro Bohrloch auf das Gel in triplicates.</li>
	<li>Führen Sie das Gel bei 4 ° C und 150 V mit dunkel blauen Kathode Puffer B und Anode Puffer (Tabelle 2), bis die Probe 1/3rd des Gels (ca. 20 bis 30 min, Bild 3a) übergeben. Hinweis: Für Nordbeflecken, reicht eine einzige Gel-Gasse, während für die Analyse der Proteinzusammensetzung von 3D PAGE und Massenspektrometrie ist es empfehlenswert, die gleiche Band aus bis zu zehn Gel Bahnen sich weniger reichlich Proteine kombinieren.</li>
	<li>Unterbrechen den Lauf und Austausch dunkel blaue Kathode Puffer B mit leichten blauen Kathode Puffer B/10 (Tabelle 2) und der Flucht. Beenden Sie das Gel ausgeführt werden, wenn die blaue Front beginnt zu eluieren aus Gel (ca. 120 bis 180 min, Bild 3a). Hinweis: Das fertige blau native Gel kann bei 4 ° C für mindestens eine Woche gespeichert werden. Längerer Lagerung kann um zu diffundieren Bänder führen und sollte vermieden werden. Dunkel blau Puffer B kann wiederverwendet werden.</li>
</ol>4. OPTIONAL: Nachweis von RNA mit blauen native northern Blot 4
<ol><li>Unterschiedliche Banden geschnitten Sie aus oder verwenden Sie die ganze Gel-Spur aus dem blauen native Gel und übertragen Sie sie auf eine Nylon-Membran von semi Dry blotting bei 3,5 mA/cm2 für 60 min und markieren Sie die obere und untere Gel-Grenze mit einem Bleistift auf der Membran (Abbildung 4a).</li>
	<li>Beflecken, waschen Sie die Membran mit DEPC-behandeltem Wasser und trocknen Sie zwischen zwei Filterpapiere.</li>
	<li>Führen Sie UV-Vernetzung der gepunkteten Membran mit 120.000 µJ/cm2 (85 s wenn der Vernetzer in Tabelle Materialienverwenden).</li>
	<li>Pre-hybridisieren Sie die Membran mit 6 mL Hybridisierung Puffer (kommerzielle oder selbst gemacht) für 60 min bei 68 ° C im Backofen Hybridisierung (Abb. 4a).</li>
	<li>Fügen Sie eine zusätzliche 1 mL der Hybridisierung Puffer mit 4 µL 3' biotinylierte Sonden (100 nM).</li>
	<li>Inkubieren Sie Membran mit der Sonde über Nacht, beim Abkühlen des Backofen von 68 ° C auf 37 ° c</li>
	<li>Waschen Sie die Membran mit Puffer mit 2 X SSC und 0,1 % SDS für 5 min bei Raumtemperatur, Sonden gebunden unspezifisch zu entfernen. Achtung: SDS kann Reizungen verursachen. Tragen Sie Handschuhe und Kittel bei der Arbeit mit SDS und SDS mit Lösungen.</li>
	<li>Führen Sie die Erkennung der 3'-biotinylierte Sonden auf der Membran z.B. mit Streptavidin-HRP-Konjugat und Luminol als Meerrettich Peroxidase (HRP) Substrat, wodurch eine sensible Chemilumineszenz-Reaktion (Abb. 4a).</li>
</ol>5. zweite dimension: Tris-Tricine-Harnstoff Seite 4,28
<ol><li>Verbrauchssteuern Sie einzelne Bands aus dem blauen native Gel. Kombinieren Sie Bands aus Proben laufen in parallelen Bahnen, eine weitere Konzentration von komplexen Proteinen (Abbildung 5) zu erreichen. Hinweis: Ausgeschnittenen Bänder können in einzelnen Reaktionsgefäßen bis zur weiteren Verwendung bei 4 ° c gespeichert werden</li>
	<li>Gießen Sie eine 12 %-Tris-Tricine-Harnstoff-Gel (Dicke von 1 mm, 6,8 x 8,6 cm (Breite x Länge)). Das trennende Gel (Tabelle 2), 10 mL Gel Lösung A vorbereiten Gießen zwischen zwei Glasplatten und Overlay mit Isopropanol. Entfernen Sie das Isopropanol, nachdem die Polymerisation beendet ist und übertragen Sie 4 mL Gel Lösung B (Tabelle 2) für das Stapeln Gel auf das Gel und legen Sie eine 10 gut kämmen zu. Achtung: Unpolymerisierten Acrylamid kann neurotoxische und TEMED ist gesundheitsschädlich beim Einatmen. Immer persönliche Schutzausrüstung tragen und arbeiten unter einer Haube.</li>
	<li>Übertragen Sie die ausgeschnittenen Gel-Bands in einem 1,5 mL Reaktionsgefäß und 1 mL 2 x SDS-Probenpuffer für Gleichgewichtherstellung der Gel-Stücke (Abbildung 5, Tabelle 2).<ol>
<li>Brüten Sie die Proben 10 min bei Raumtemperatur, vor dem Kochen in einem Heizblock (95 ° C) oder in der Mikrowelle und inkubieren Sie die Proben wieder auf weitere 15 min bei Raumtemperatur.</li>
		<li>Stapeln Sie mehrere äquilibriert Gel Stücke vertreten die gleichen Komplex in einem einzigen Gel Tasche.</li>
		<li>Führen Sie die Elektrophorese mit Anode und Kathode mit 150 V für 45 bis 60 min Puffer und Verbrauchsteuern Sie die ganze Gel-Spur.</li>
	</ol>
</li>
	<li>Brüten die geschnittenen Fahrspur für 20 min in sauren Puffer (100 mM Tris, 100 mM Essigsäure) und equilibrate in 125 mM Tris-HCl, pH 6,8 für weitere 20 min (Abbildung 5).</li>
</ol>(6) dritte Dimension: SDS-PAGE 4,32
<ol><li>Gießen Sie einen 15 % SDS Trennung Gel nach Laemmli32 (Dicke: 1,5 mm, 6,8 x 8,6 cm (Breite x Länge)) (Tabelle 2) und fügen Sie eine dünne Schicht von 4 % Gel oben stapeln. Achtung: SDS, Acrylamid und TEMED sind giftig und schädlich. Arbeiten unter einer Haube und persönliche Schutzausrüstung tragen.</li>
	<li>Übertragen der äquilibriert Gel-Spur auf das SDS-Gel und decken das Gel mit 0,5 % (w/w) Agarose in 1 X SDS laufen Puffer ergänzt mit einer Spur von Bromophenol blue (Abbildung 5).</li>
	<li>Kochen Sie die SDS mit Puffer Agarose in der Mikrowelle vor Verladung auf das Gel.</li>
	<li>Legen Sie für den Betrieb eines Protein-Markers zur Abschätzung der Molekulargewichte der Einzelkomponenten ein Stück Filterpapier an einem Ende des Gels, bis die Agarose erstarrt oder verwenden Sie einen speziellen Kamm in der Regel für IPG Gele verwendet.</li>
	<li>Führen Sie das Gel 150 V für 60 min und Fleck Färbung das Gel mit kolloidalem Coomassie, silbernen Fleck oder eine andere Methode geeignet für anschließende massenspektrometrische Analyse.</li>
	<li>Analysieren Sie die sichtbaren Proteinspots mit massenspektrometrischer Methoden wie Matrix-unterstützte Laser Desorption/Ionisation Time-of-Flight (MALDI-TOF) oder LC-MS/MS Massenspektrometrie. Hinweis: Wir empfehlen, um die kolloidalen Coomassie-Färbung wie bereits beschrieben33zu verwenden. In unseren Händen sogar weniger reichlich Proteine kann ausreichend gebeizt und ermöglicht eine massenspektrometrische Analyse mit angemessenen Datenqualität.</li>
</ol>

<ol>
	<li>Kempers, R., van Bel, A. J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Symplasmic+connections+between+sieve+element+and+companion+cell+in+the+stem+phloem+ofVicia+faba+L.+have+a+molecular+exclusion+limit+of+at+least+10+kDa.">Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa.</a> Planta. 201 (2), 195-201 (1997).</li><li>Stadler, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+GFP-fusions+in+Arabidopsis+companion+cells+reveals+non-specific+protein+trafficking+into+sieve+elements+and+identifies+a+novel+post-phloem+domain+in+roots.">Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots.</a> Plant J. 41 (2), 319-331 (2005).</li><li>Imlau, A., Truernit, E., Sauer, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-to-cell+and+long-distance+trafficking+of+the+green+fluorescent+protein+in+the+phloem+and+symplastic+unloading+of+the+protein+into+sink+tissues.">Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues.</a> Plant Cell. 11 (3), 309-322 (1999).</li><li>Ostendorp, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+Brassica+napus+phloem+protein+and+ribonucleoprotein+complexes.">Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes.</a> New Phytol. 214 (3), 1188-1197 (2017).</li><li>Paultre, D. S. G., Gustin, M. -. P., Molnar, A., Oparka, K. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lost+in+Transit:+Long-Distance+Trafficking+and+Phloem+Unloading+of+Protein+Signals+in+Arabidopsis+Homografts.">Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts.</a> Plant Cell. 28 (9), 2016-2025 (2016).</li><li>Sali, A., Glaeser, R., Earnest, T., Baumeister, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+words+to+literature+in+structural+proteomics.">From words to literature in structural proteomics.</a> Nature. 422 (6928), 216-225 (2003).</li><li>Lin, M. -. K., Lee, Y. -. J., Lough, T. J., Phinney, B. S., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pumpkin+Phloem+Proteome+Provides+Insights+into+Angiosperm+Sieve+Tube+Function.">Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function.</a> Mol. Cell. Proteomics. 8 (2), 343-356 (2008).</li><li>Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+the+proteome+of+Brassica+napus+phloem+sap.">Towards the proteome of Brassica napus phloem sap.</a> Proteomics. 6 (3), 896-909 (2006).</li><li>Lucas, W. J., Yoo, B. C., Kragler, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+as+a+long-distance+information+macromolecule+in+plants.">RNA as a long-distance information macromolecule in plants.</a> Nat. Rev. Mol. Cell. Bio. 2 (11), 849-857 (2001).</li><li>Dinant, S., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sampling+and+Analysis+of+Phloem+Sap.">Sampling and Analysis of Phloem Sap.</a> Plant Mineral Nutrients. 953, 185-194 (2013).</li><li>Kennedy, J. S., Mittler, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Method+of+obtaining+Phloem+Sap+via+the+Mouth-parts+of+Aphids.">A Method of obtaining Phloem Sap via the Mouth-parts of Aphids.</a> Nature. 171 (4351), 528 (1953).</li><li>King, R. W., Zeevaart, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+Phloem+exudation+from+cut+petioles+by+chelating+agents.">Enhancement of Phloem exudation from cut petioles by chelating agents.</a> Plant Physiol. 53 (1), 96-103 (1974).</li><li>Alosi, M. C., Melroy, D. L., Park, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+regulation+of+gelation+of+Phloem+exudate+from+cucurbita+fruit+by+dilution,+glutathione,+and+glutathione+reductase.">The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase.</a> Plant Physiol. 86 (4), 1089-1094 (1988).</li><li>Dinant, S., Bonnemain, J. -. L., Girousse, C., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phloem+sap+intricacy+and+interplay+with+aphid+feeding.">Phloem sap intricacy and interplay with aphid feeding.</a> Comptes rendus biologies. 333 (6-7), 504-515 (2010).</li><li>Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Collection+and+analysis+of+Arabidopsis+phloem+exudates+using+the+EDTA-facilitated+Method.">Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method.</a> J Vis Exp. (80), e51111 (2013).</li><li>Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+a+modified+EDTA-mediated+exudation+technique+and+guttation+fluid+analysis+for+Potato+spindle+tuber+viroid+RNA+detection+in+tomato+plants+(Solanum+lycopersicum).">Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum).</a> J. Virol. Methods. 198, 75-81 (2014).</li><li>Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Macromolecular+composition+of+phloem+exudate+from+white+lupin+(Lupinus+albus+L).">Macromolecular composition of phloem exudate from white lupin (Lupinus albus L).</a> BMC Plant Biol. 11 (1), 36 (2011).</li><li>Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytokinins+in+the+Phloem+Sap+of+White+Lupin+(Lupinus+albus+L.).">Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.).</a> Plant Physiol. 94 (4), 1714-1720 (1990).</li><li>Yoo, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Systemic+Small+RNA+Signaling+System+in+Plants.">A Systemic Small RNA Signaling System in Plants.</a> Plant Cell. 16 (8), 1979-2000 (2004).</li><li>Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+small+RNAs+from+the+phloem+of+Brassica+napus.">Identification and characterization of small RNAs from the phloem of Brassica napus.</a> Plant J. 53 (5), 739-749 (2008).</li><li>Chalhoub, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genetics.+Early+allopolyploid+evolution+in+the+post-Neolithic+Brassica+napus+oilseed+genome.">Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome.</a> Science. 345 (6199), 950-953 (2014).</li><li>Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+several+mRNA+species+in+rice+phloem+sap.">Detection of several mRNA species in rice phloem sap.</a> Plant Cell Phys. 39 (8), 895-897 (1998).</li><li>Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+aphid+stylectomy+and+RT-PCR+for+the+detection+of+transporter+mRNAs+in+sieve+elements.">Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements.</a> J Exp. Bot. 53 (369), 631-637 (2002).</li><li>Ruiz-Medrano, R., Xoconostle-C&#225;zares, B., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phloem+long-distance+transport+of+CmNACP+mRNA:+implications+for+supracellular+regulation+in+plants.">Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants.</a> Dev. 126 (20), 4405-4419 (1999).</li><li>Sch&#228;gger, H., Cramer, W. A., von Jagow, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+molecular+masses+and+oligomeric+states+of+protein+complexes+by+blue+native+electrophoresis+and+isolation+of+membrane+protein+complexes+by+two-dimensional+native+electrophoresis.">Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis.</a> Anal. Biochem. 217 (2), 220-230 (1994).</li><li>Sch&#228;gger, H., von Jagow, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue+native+electrophoresis+for+isolation+of+membrane+protein+complexes+in+enzymatically+active+form.">Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form.</a> Anal. Biochem. 199 (2), 223-231 (1991).</li><li>Fiala, G. J., Schamel, W. W. A., Blumenthal, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue+native+polyacrylamide+gel+electrophoresis+(BN-PAGE)+for+analysis+of+multiprotein+complexes+from+cellular+lysates.">Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates.</a> J Vis Exp. (48), e2164 (2011).</li><li>Rais, I., Karas, M., Sch&#228;gger, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two-dimensional+electrophoresis+for+the+isolation+of+integral+membrane+proteins+and+mass+spectrometric+identification.">Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification.</a> Proteomics. 4 (9), 2567-2571 (2004).</li><li>Sch&#228;gger, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tricine-SDS-PAGE.">Tricine-SDS-PAGE.</a> Nature protocols. 1 (1), 16-22 (2006).</li><li>Wittig, I., Braun, H. -. P., Sch&#228;gger, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue+native+PAGE.">Blue native PAGE.</a> Nat Protoc. 1 (1), 418-428 (2006).</li><li>Eubel, H., Braun, H. -. P., Millar, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue-native+PAGE+in+plants:+a+tool+in+analysis+of+protein-protein+interactions.">Blue-native PAGE in plants: a tool in analysis of protein-protein interactions.</a> Plant Methods. 1 (1), 11 (2005).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Dyballa, N., Metzger, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+colloidal+coomassie+G-250+staining+for+proteins+in+polyacrylamide+gels.">Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels.</a> J Vis Exp. (30), (2009).</li><li>Turnbull, C. G. N., Lopez-Cobollo, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heavy+traffic+in+the+fast+lane:+long-distance+signalling+by+macromolecules.">Heavy traffic in the fast lane: long-distance signalling by macromolecules.</a> New Phytol. 198 (1), 33-51 (2013).</li><li>Hall, S. M., Baker, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+composition+of+Ricinus+phloem+exudate.">The chemical composition of Ricinus phloem exudate.</a> Planta. 106 (2), 131-140 (1972).</li><li>Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+protein+identity+from+sieve+element+sap+in+Ricinus+communis+L.+by+quadrupole+time+of+flight+(Q-TOF)+mass+spectrometry.">Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry.</a> J. Exp. Bot. 55 (402), 1473-1481 (2004).</li><li>Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomics+of+curcurbit+phloem+exudate+reveals+a+network+of+defence+proteins.">Proteomics of curcurbit phloem exudate reveals a network of defence proteins.</a> Phytochemistry. 65 (12), 1795-1804 (2004).</li><li>Walz, C., Juenger, M., Schad, M., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+the+presence+and+activity+of+a+complete+antioxidant+defence+system+in+mature+sieve+tubes.">Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes.</a> Plant J. 31 (2), 189-197 (2002).</li><li>Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phloem+sap+proteins:+their+identities+and+potential+roles+in+the+interaction+between+plants+and+phloem-feeding+insects.">Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects.</a> J Exp. Bot. 57 (4), 767-774 (2006).</li><li>Ham, B. -. K., Brandom, J. L., Xoconostle-C&#225;zares, B., Ringgold, V., Lough, T. J., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+polypyrimidine+tract+binding+protein,+pumpkin+RBP50,+forms+the+basis+of+a+phloem-mobile+ribonucleoprotein+complex.">A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex.</a> Plant Cell. 21 (1), 197-215 (2009).</li><li>Schamel, W. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotinylation+of+protein+complexes+may+lead+to+aggregation+as+well+as+to+loss+of+subunits+as+revealed+by+Blue+Native+PAGE.">Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE.</a> J. Immunol. Methods. 252 (1-2), 171-174 (2001).</li><li>Zhang, S., Sun, L., Kragler, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phloem-delivered+RNA+pool+contains+small+noncoding+RNAs+and+interferes+with+translation.">The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation.</a> Plant Physiol. 150 (1), 378-387 (2009).</li></ol>

Die Autoren haben nichts preisgeben.

Das Phloem ist ein Fach von großem Interesse, da es den wichtigsten Transportweg für Photoassimilates bildet, und auch ist für Langstrecken Signalisierung zwischen verschiedenen pflanzlichen Teile9,20,34, 35. Neben kleinen Molekülen haben Makromoleküle wie Proteine und RNA mit Phloem Wartung und Signalisierung4,7,8verwickelt. Die Analyse der Zusammensetzung der Phloem ist durch die eingeschränkte Erreichbarkeit auf Phloem Proben in den meisten Pflanzenarten beschränkt. Die Insekten Mandrin Technik ist vielseitig einsetzbar, sondern experimentell anspruchsvoll und resultiert in sehr geringen Mengen von Phloem Proben11. Eine einfache Technik zum Phloem Probenahme ist EDTA erleichtert Exsudation12. EDTA bilden zweiwertige Ionen wie Calcium und verhindert somit Schließung der Sieb Platten von P-Proteine und Zellstress. Es ist einfach zu bedienen, aber ist anfällig für Verunreinigungen durch beschädigte Zellen und Proben verdünnt. Abbauende zweiwertige Ionen durch EDTA könnte auch zu einem Zusammenbruch der bestehenden Anlagen führen. Allerdings ermöglicht es Probenahme aus einer Vielzahl von Arten, einschließlich der Modellpflanze A. Thaliana15. Spontane Exsudation von Phloem Sap tritt nur in einer kleinen Anzahl von Pflanzenarten. Es ist eine invasive Methode, die erheblichen Verletzungen der Pflanze Gewebe10beinhaltet. Vor kurzem haben wir als eine Art Modell für das Studium Fernverkehr4,8,20 B. Napus etabliert. Hier können Sie Phloem Sap von kleinen Einschnitten, probieren die Verwundung Effekte und Kontaminationsquellen reduziert.
Verwenden verschiedene Stichprobenverfahren, das Proteom von Phloem Proben aus verschiedenen Pflanzenarten wurde untersucht in den letzten Jahren7,8,17,36,37, 38,39. Für diese Studien Proteom Proteine wurden extrahiert und unter denaturierenden Bedingungen ausgefällt und erlauben daher keinerlei Rückschlüsse auf Protein: Protein und Protein: Nukleinsäure-Interaktionen unter heimischen Bedingungen zu präsentieren. Co-Immunopräzipitation (CoIP) und Overlay-Assays zeigten, dass eine große Ribonucleoprotein komplexe könnte im Phloem-Saft von Kürbis40vorhanden, aber es nicht nachgewiesen wurde, dass makromolekulare komplexe unter heimischen Bedingungen innerhalb existieren der Phloem-System.
Blaue native Seite, eingeführt durch Schägger Et al. 26, in Kombination mit weiteren hochauflösenden Gel-Elektrophorese Schritte ermöglichen die Trennung der einzelnen Komponenten der große Proteinkomplexe. Mit 3D-Seite Analysen der native B. Napus Phloem Exsudat, konnten wir kürzlich zeigen, dass mehrere im Phloem Proben existieren hohen Molekulargewicht Protein: Protein und RNP-komplexe enzymatisch aktive4 sind. Alternative Methoden um Proteinkomplexe sowie RNPs zu isolieren, wie Größe Ausgrenzung Chromatographie existieren könnte, aber nicht in Bezug auf Auflösung im Vergleich zu BN-Seite. Darüber hinaus für eine angemessene Qualität der komplexen Trennung müssen Größe Ausgrenzung Spalte Matrizen die insgesamt komplexer Molekulargewichte untersucht angepasst werden. Analysieren komplexe unterschiedlicher Größe werden daher fordern verschiedene Typen von Spalten ist kostenintensiv und lässt sich nicht als hohe Fokussierung macht als BN-Seite.
Wichtige Schritte um komplexe aus B. Napus zu analysieren sind den Gesamtbetrag der Phloem Sap als Ausgangsmaterial verwendet. Mindestens 600 µL Phloem Probe sind notwendig und können aus fünf gut-gewässerten Pflanzen gewonnen werden. Für 3D-Seite und BN Nordbeflecken ist es notwendig, das erste BN-Gel mit einer ausreichenden Menge von Phloem Proben beginnen. Um dies zu erreichen, sind Phloem Proben konzentriert, bis gut und mindestens 20 bis 30 µg Protein in jeder geladen werden kann, dass Triplicates der gleichen Probe parallel ausgeführt werden. Zu niedrige oder zu hohe Konzentrationen reduzieren die Erkennung von komplexen (Abbildung 3). Phloem Proben müssen in Reaktionsgefäßen auf Eis gesammelt und eingefroren für die spätere Verwendung zur Vermeidung von Proteinabbau und Umsatz gespeichert werden soll. Protease-Inhibitoren sind in allen Phloem Proteome analysiert gefunden worden, aber auch ein vollaktives Proteasom in das Phloem von B. Napus4beschrieben wurde. Darüber hinaus abhängig von Volumen und Zusammensetzung Phloem Proben die Sampling-Zeit-Punkt und Umweltbedingungen10. Daher muss darauf geachtet werden, zur gleichen Zeit des Tages unter ähnlichen Bedingungen zu sammeln. Stress-Behandlungen (z.B. Trockenheit) reduzieren die Menge der Bast, die gesammelt werden können. Um einzelne Proteine durch Massenspektrometrie zu identifizieren, ist es zwingend erforderlich, um mögliche Keratin Verunreinigungen durch tragen von Handschuhen die Zeit zu begrenzen. Keratin führt zu zusätzlichen Signale während der Masse Spec Analyse und Proteinidentifikation behindert. Ausführen der BN-Seite an eine höhere Spannung oder bei Raumtemperatur führen zur Erwärmung des Gels, die Demontage der fragilen komplexe führen können.
Die hier vorgestellten Protokoll eignet sich für die Analyse von Protein: Protein-komplexe. Wir zeigen auch, dass es verwendet werden kann, um bestimmte RNAs enthalten in den komplexen parallel zu erkennen. Um dies zu erreichen, haben wir vor kurzem ein Protokoll für northern Blot-4BN eingeführt. RNAs sind anfällig für Abbau durch RNAse Verunreinigungen. Um diesen Abbau zu begrenzen sollte DEPC-behandelte Wasser verwendet werden.
Wichtigste Einschränkungen der vorgestellten Methode gehören die Schätzung des Molekulargewichtes von Proteinkomplexen getrennt von BN-Seite, da Migrationsverhalten auf Größe, Form und auch posttranslationale Modifikationen der komplexe31abhängt, 41. Abschätzung der Größe der RNP-komplexe ist noch komplizierter durch den Einfluss von Nukleinsäuren auf das Migrationsverhalten. Es kann auch nicht verhindert werden, dass komplexe gleicher Größe in einem einzigen Band Co migrieren. Dies führt zu der falschen Vorhersage von komplexen Kompositionen. Überprüfen daher die beobachteten Interaktionen mit komplementären Techniken, kann z. B. durch funktionelle Assays4, erforderlich sein. Auch verloren nur schwach oder vorübergehend zu einem makromolekulare Komplex verbundenen Proteine in der BN-Puffer verwendet. Um dies zu vermeiden, könnte Proben vernetzt, was auch zu Artefakten führen können oder nicht Proteinidentifikation, oder der Pufferbedingungen optimiert werden.
Im Gegensatz zu klassischen 2D-Seite, die Kombination von Harnstoff und SDS-PAGE ermöglicht die Trennung nach Hydrophobie und Molekulargewicht statt isoelektrischen Punkt (pI) und Molekulargewicht 28, und schränkt nicht die Trennung an Proteine von einem spezifische pI reichen. Ähnlich wie bei klassischen 2D-Seite, getrennten Proteine sind als einzelne Flecken sichtbar, aber auf einer diagonalen Linie 4,28 (Abbildung 5, Abbildung 6). Weitere hydrophobe Proteine erscheinen in Flecken über diese Diagonal, während mehr hydrophile Proteine sich unterhalb der Linie28 befinden. In diesem Protokoll verwendeten Polyacrylamid-Konzentrationen werden Proteine zwischen 25 bis 80 kDa gut zu trennen. Ermöglicht einer Trennung von kleineren oder größeren Proteinen die Polyacrylamid Konzentration variiert werden oder Farbverlauf Gele eingesetzt werden, in der dritten Dimension. Die Komponenten des komplexen IV (Abbildung 3) getrennt durch 3D-Seite (Abbildung 6) wurden ausgeschnitten, Trypsin verdaut und durch Massenspektrometrie analysiert. Dies führte bei der Identifizierung von mehreren tRNA Ligases. Die Komponenten der anderen Anlagen wurden vor kurzem veröffentlicht 4. Unsere 3D-Seite aktiviert die Trennung der verschiedenen Ligases, nämlich Aspartat-, Asparagin, Threonin, Lysin und Glycin Ligases mit ähnlichen Molekulargewichten (Tabelle 3). Mit einer Methionin-tRNA-spezifische-Sonde, wir konnten potenziell gebundene tRNA innerhalb komplexer IV erkennen, aber wenn in voller Länge tRNA oder tRNA Fragmente in der Anlage sind kann nicht mit den Sonden verwendet diskriminiert werden. Um zu überprüfen, wenn die Nukleinsäuren wirklich gefesselt innerhalb des Komplexes und Co nicht migrieren sind, Protease Phloem Sap verdaut können Proben als geeignete Migration Kontrollen dienen.
Es wurde bereits spekuliert, dass Protein Übersetzung im Phloem Sieb Röhren, auftreten kann, da fast die meisten Komponenten der gesamten Ribosom sowie Dehnung Faktoren im Phloem Proben4,7gefunden worden sind. Unsere Feststellung der tRNA und tRNA Ligases scheint diese Idee zu unterstützen. Allerdings tRNA Fragmente vorhanden im Phloem Proben aus Kürbis haben gezeigt, dass potente Inhibitoren der Übersetzung42 werden und funktionelle Ribosomen scheinen zu fehlen4, was darauf hindeutet, dass die Übersetzung nicht stattfinden kann.
Zusammengenommen kann das Protokoll hier präsentierten die Trennung von nativen Protein: Protein und sogar RNP komplexe aus Bast Proben und die Trennung und Identifizierung ihrer einzelnen Komponenten mit hoher Auflösung. Die Anwendung dieser Methode ermöglicht die Entdeckung neuartiger Protein und RNP-komplexe im Phloem Proben und kann daher neue Funktionen in diesem hoch spezialisierten Werk Fach aufzuklären.

Die Langstrecken das Phloem-Conduits sind essentiell für die Verteilung von Nährstoffen in höheren Pflanzen, sondern sind auch beteiligt bei der Regulierung der vielen verschiedener Prozessen wichtig für Wachstum und Entwicklung, Erreger Verteidigung und die Anpassung an den negativen Umweltbedingungen. Neben kleinen Effektoren wie Ionen, Phytohormonen oder Metaboliten selbst sind Makromoleküle wie Proteine und RNA als potentielle Signale vor kurzem entstanden.
Studien haben gezeigt, dass Phloem Laden von Proteinen Größe abhängig und kontrollierten durch Ausgrenzung Größenbeschränkung (SEL) der Pore-plasmodesmal Einheiten verbinden Begleiter Zellen (CC) und sieben Elemente (SE), die typischerweise im Bereich von 10 bis > 67 kDa1 , 2 , 3. jedoch trotz dieser Größe Beschränkungen größere Proteine und Protein komplexe innerhalb des Systems der Phloem herausfordernde Idee der Größe Ausgrenzung4gefunden wurden, und auch unspezifische Verlust von Proteinen aus CC SE wurde vorgeschlagen5 .
Multi sowie große Ribonucleoprotein komplexe spielen entscheidende Rolle bei der Biosynthese und Aufrechterhaltung der strukturellen Integritätdes der Zelle6. Es gibt Hinweise darauf, dass Protein-Protein und Ribonucleoprotein komplexe Phloem-Mobile gibt es4,7, aber bisher ist wenig über ihre Funktion bekannt. Im Phloem Siebelemente Protein: Protein und RNP-komplexe mit Fernverkehr und / oder Signalisierung8,9verwickelt. Um die Funktionen der translozierten komplexe, studieren ihre Zusammensetzung unter verschiedenen ökologischen zu entwirren oder stress Bedingungen ist erforderlich. Um dies zu erreichen, haben einheimische komplexe isoliert werden und ihre Komponenten mit ausreichender Auflösung getrennt werden.
Um hohen Molekulargewicht komplexe aus dem Phloem zu isolieren, ist es zunächst notwendig zu SAP-Proben in ausreichender Qualität und Menge zu erhalten. Die Technik, die für Phloem Probenahme verwendet werden kann hängt von der Pflanzenart von Interesse. Drei Hauptmethoden, Phloem Sap zu erhalten gibt es 10: Insekt Stylectomy11, EDTA erleichtert Exsudation12und spontane Exsudation13.
Phloem Proben von Arabidopsis Thaliana (A. Thaliana), der wichtigsten Modellpflanze in Laboren weltweit, erhalten Sie nur durch EDTA erleichtert Exsudation oder Blattlaus Stylectomy14,15. Beide Methoden führen zu stark verdünnte Phloem Sap oder sehr niedrigen Probe Beträge. EDTA-erleichtert Exsudation ist auch anfällig für Verschmutzung und kann nicht die reale Phloem Zusammensetzung16darstellen. Spontane Phloem Exsudation beschränkt sich auf Pflanzenarten wie Kürbisgewächse, Lupine oder Yucca, wohin führt Pflanzenteile abschneiden, eine spontane Emission von Phloem Sap, die leicht erhobenen13,17,18werden können, 19. Wir vor kurzem errichtet Raps (Brassica Napus) als Modellsystem für Phloem Analyse geeignet, denn es ist ein naher Verwandter von A. Thaliana und mehrere Mikroliter der Phloem Sap kann erfragt werden kleine Einschnitte, die gezeigt wurden sein hoher Reinheit4,8,20. Darüber hinaus wurde die Genomsequenz B. Napus 201421veröffentlicht.
Mit Ausnahme der Blattlaus Stylectomy alle Phloem Erhebungsmethoden beschrieben gehören Beschädigung des umgebenden Gewebes am Ort der Probenahme und die Zusammensetzung der Phloem Sap variieren in Reaktion auf eine Verletzung. Daher ist es unerlässlich, um die Qualität von Phloem Proben, unabhängig von der Sampling-Methode angewendet. Es gibt verschiedene Methoden zur Qualitätskontrolle von gesammelten Phloem Sap, z.B. durch Bestimmung der RNase Aktivität22,23, RT-PCR mit Primer gegen Rubisco8,24, oder die Analyse des Zuckers Zusammensetzung-8.
Verschiedene Methoden zu isolieren und zu trennen Proteinkomplexe aufgebracht werden können, einschließlich Größe Ausgrenzung Chromatographie, Saccharose Dichte Ultrazentrifugation oder Probenfiltration durch Membranen mit unterschiedlichen Molekulargewicht Cut Offs. Allerdings erlauben diese Ansätze keine hohen Auflösung. Die Technik namens blau native Seite (BN-Seite), erstmals von Schägger Et al.beschrieben. 25, ist überlegen in Bezug auf Auflösung. Es wurde erfolgreich verwendet, um festzustellen, die Molmassen von großen systemeigene Proteinkomplexen aus verschiedenen Organellen oder zellulären Lysates und ihre relativen Häufigkeiten26,27.
Um die komplexe Zusammensetzung von Proteinkomplexen weiter zu erhellen, ist es notwendig, die einzelnen Komponenten unter denaturierenden Bedingungen führt zu komplette Demontage komplexer Bauteile zu trennen. Dies kann durch eine zweite Dimension der SDS-PAGE 28,29 oder höheren Auflösung, durch eine zweite Dimension der isoelektrischen Fokussierung (IEF) gefolgt von einer Third dimension von SDS-PAGE30 und spätere Identifikation der zu erreichen die Proteine mittels Massenspektrometrie.
In diesem Protokoll beschreiben wir Probenahme von reinen Phloem-Saft von B. Napus Pflanzen und die Analyse von Proteinkomplexen aus solchen Phloem Proben mit einem 3D elektrophoretischen Ansatz BN-Seite mit Tris-Tricine-Harnstoff-PAGE und SDS-PAGE zu verbinden. Die getrennten Protein komplexen Bauteile werden anschließend durch Massenspektrometrie identifiziert. Darüber hinaus führen wir als eine Methode, die Erkennung von RNAs in großen RNP-komplexe4blau native Nordbeflecken erweitert die Anwendbarkeit des Ansatzes.

<table>
	<tbody>
		<tr>
			<td>1.5 mL reaction tubes</td>
			<td>Eppendorf</td>
			<td>30120086</td>
			<td></td>
		</tr>
		<tr>
			<td>10 well comb for SDS PAGE, thickness 1 mm</td>
			<td>BioRad</td>
			<td>1653359</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Propanol</td>
			<td>AppliChem</td>
			<td>131090</td>
			<td></td>
		</tr>
		<tr>
			<td>30 % Acrylamide-bisacrylamide solution (29:1) solution</td>
			<td>BioRad</td>
			<td>1610156</td>
			<td></td>
		</tr>
		<tr>
			<td>30 % Acrylamide-bisacrylamide solution (37.5:1) solution</td>
			<td>BioRad</td>
			<td>1610158</td>
			<td></td>
		</tr>
		<tr>
			<td>96 % Ethanol</td>
			<td>Carl Roth</td>
			<td>P075</td>
			<td></td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Carl Roth</td>
			<td>6755</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Lonza</td>
			<td>50004</td>
			<td></td>
		</tr>
		<tr>
			<td>Aluminum sulfate-(14-18)-hydrate</td>
			<td>AppliChem</td>
			<td>141101</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium peroxodisulfate (APS)</td>
			<td>Carl Roth</td>
			<td>9592.3</td>
			<td></td>
		</tr>
		<tr>
			<td>Bis-Tris</td>
			<td>AppliChem</td>
			<td>A3992</td>
			<td></td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>AppliChem</td>
			<td>A2940</td>
			<td></td>
		</tr>
		<tr>
			<td>Bromophenol blue</td>
			<td>AppliChem</td>
			<td>A2331</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifugal concentrators e.g. Vivaspin 500 (Mwco 10 kDa)</td>
			<td>Sartorius</td>
			<td>VS0102</td>
			<td></td>
		</tr>
		<tr>
			<td>Chemiluminescent Nucleic Acid Detection Module Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>89880</td>
			<td></td>
		</tr>
		<tr>
			<td>Chromatography papers e.g. 3 mm CHR</td>
			<td>Whatman</td>
			<td>3030-153</td>
			<td></td>
		</tr>
		<tr>
			<td>CoolBox M30 System</td>
			<td>Biocision</td>
			<td>BCS-133</td>
			<td></td>
		</tr>
		<tr>
			<td>Coomassie brilliant Blue G-250</td>
			<td>AppliChem</td>
			<td>A3480</td>
			<td></td>
		</tr>
		<tr>
			<td>Diethyl pyrocarbonate (DEPC)</td>
			<td>AppliChem</td>
			<td>A0881</td>
			<td></td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>AppliChem</td>
			<td>A1101</td>
			<td></td>
		</tr>
		<tr>
			<td>DNase I</td>
			<td>AppliChem</td>
			<td>A3778</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol abs.</td>
			<td>AppliChem</td>
			<td>A3693</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid (EDTA)</td>
			<td>AppliChem</td>
			<td>A1103</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel Imaging system e.g. Chemidoc Touch</td>
			<td>BioRad</td>
			<td>1708370</td>
			<td></td>
		</tr>
		<tr>
			<td>GeneRuler 1kb plus</td>
			<td>Thermo Fisher Scientific</td>
			<td>SM1331</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>AppliChem</td>
			<td>141339</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>AppliChem</td>
			<td>131340</td>
			<td></td>
		</tr>
		<tr>
			<td>Heating block TS1</td>
			<td>Biometra</td>
			<td>846-051-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Hybridization oven e.g. GFL Hybridization Incubator 7601</td>
			<td>GFL</td>
			<td>7601</td>
			<td></td>
		</tr>
		<tr>
			<td>Hypodermic needle (0.8 mm)</td>
			<td>B Braun</td>
			<td>4658309</td>
			<td></td>
		</tr>
		<tr>
			<td>IPG gel comb, thickness 1 mm</td>
			<td>BioRad</td>
			<td>1653367</td>
			<td></td>
		</tr>
		<tr>
			<td>Labeling of RNA e.g.Biotin 3&#39;end DNA Labeling Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>89818</td>
			<td></td>
		</tr>
		<tr>
			<td>Native gradient gel e.g. Novex NativePAGE 4&#8211;16% Bis-Tris protein gel</td>
			<td>Invitrogen</td>
			<td>BN1002BOX</td>
			<td></td>
		</tr>
		<tr>
			<td>Nylon membrane e.g. Hybond-N+</td>
			<td>Amersham Pharmacia</td>
			<td>RPN203B</td>
			<td></td>
		</tr>
		<tr>
			<td>Ortho-phosphoric acid</td>
			<td>Carl Roth</td>
			<td>6366.1</td>
			<td></td>
		</tr>
		<tr>
			<td>PageRuler prestained protein ladder</td>
			<td>Thermo Fisher Scientific</td>
			<td>26616</td>
			<td></td>
		</tr>
		<tr>
			<td>Power supply for Gel electrophoresis EPS</td>
			<td>Amersham Pharmacia</td>
			<td>18-1130-01</td>
			<td>available from GE Healthcare</td>
		</tr>
		<tr>
			<td>RNA Cleanup Kit</td>
			<td>Qiagen</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr>
			<td>Semi dry blot e.g. Fastblot 43B semi dry Blot</td>
			<td>Biometra</td>
			<td>846-015-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride (NaCl)</td>
			<td>AppliChem</td>
			<td>A1149</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium dodecyl sulfate (SDS)</td>
			<td>AppliChem</td>
			<td>142363</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthesis of cDNA e.g. RevertAid First Strand cDNA Synthesis Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetramethylethylenediamine (TEMED)</td>
			<td>AppliChem</td>
			<td>A1148</td>
			<td></td>
		</tr>
		<tr>
			<td>Tricine</td>
			<td>AppliChem</td>
			<td>A3954</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>AppliChem</td>
			<td>A1086</td>
			<td></td>
		</tr>
		<tr>
			<td>Tri-sodium citrate dihydrate</td>
			<td>AppliChem</td>
			<td>A3901</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>15596026</td>
			<td></td>
		</tr>
		<tr>
			<td>ULTRAhyb Ultrasensitive Hybridization Buffer</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM8670</td>
			<td></td>
		</tr>
		<tr>
			<td>Urea</td>
			<td>AppliChem</td>
			<td>A1360</td>
			<td></td>
		</tr>
		<tr>
			<td>UV Crosslinker e.g. Stratalinker 2400</td>
			<td>Agilent</td>
			<td>NC0477671</td>
			<td>from Fisher Scientific</td>
		</tr>
		<tr>
			<td>Vertical electrophoresis apparatus e.g.The XCell SureLock Mini-Cell or Mini-Protean III System</td>
			<td>Thermo Fisher Scientific or BioRad</td>
			<td>EI0001 or 1658004</td>
			<td></td>
		</tr>
		<tr>
			<td>Wipers e.g. KIMWIPES Delicate Task Wipers</td>
			<td>Kimberly-Clark</td>
			<td>34120</td>
			<td></td>
		</tr>
	</tbody>
</table>

phloem sap sampling from brassica napus for 3d-page of protein and ribonucleoprotein complexes

Probenahme das Phloem der höheren Pflanzen ist oft mühsam und wesentlich abhängig von der Pflanzenart. Proteom-Studien unter denaturierenden Bedingungen konnte jedoch in verschiedenen Pflanzenarten erreicht werden. Nativen Protein: Protein und Eiweiß: Nukleinsäure-komplexe aus Bast Proben noch kaum analysiert wurden, obwohl sie eine wichtige Rolle in der Wartung von diesem spezialisierten Fach oder im Fernverkehr Signalisierung spielen könnte. Große molekularen Baugruppen können isoliert mit einer blauen gebürtige Gelelektrophorese (BN-Seite) werden. Ihre Proteinkomponenten können durch eine anschließende Natriumsulfat der Dodecyl Seite (SDS-PAGE) getrennt werden. Allerdings migrieren Co Proteine mit ähnlichen Molekulargewichten, was kann Proteinidentifikation durch Massenspektrometrie behindern. Kombination von BN-Seite mit zwei verschiedenen Geruchsstoffen Gel-Elektrophorese Schritten, nämlich Tris-Tricine-Harnstoff und SDS-PAGE, ermöglicht die weitere Trennung der Proteine nach ihrer Hydrophilie/Hydrophobie und erhöht somit Auflösung und den Erfolg der Proteinidentifizierung. Es erlaubt sogar die Proteine, die unterscheiden sich nur in ihrer posttranslationale Modifikationen zu unterscheiden. Darüber hinaus kann blau native Nordbeflecken angewendet werden, um die RNA-Komponenten in makromolekulare komplexe zu identifizieren. Wir zeigen, dass unser Protokoll geeignet, das Protein und die RNA-Komponenten von nativen Protein: Protein und Ribonucleoprotein (RNP) komplexe im Phloem Proben zu entwirren. Kombination von einem blauen native Seite mit zwei verschiedenen Geruchsstoffen Seite Schritte kann dazu beitragen, um verschiedene Arten von großer Proteinkomplexe zu trennen und ermöglicht auch eine höhere Erkennungsrate von deren Komponenten durch Massenspektrometrie. Darüber hinaus ist das Protokoll robust genug, um gleichzeitig potenziell gebundenen Nukleinsäuren in einzelne Protein-komplexe erkennen.

Hier präsentieren wir ein Protokoll, das die Analyse von Protein: Protein erlaubt sowie Protein: RNA-komplexe im Phloem Proben aus Brassica Napus. Der Workflow ist in Abbildung 1dargestellt. Ein großer Vorteil von B. Napus über andere Modellorganismen ist die Möglichkeit, relativ einfach Phloem Musterkollektion von kleine Einstiche im Blütenstand Stiel. Dies ermöglicht, um reine Phloem Proben in vergleichsweise großen Mengen zu erhalten. Bei der Probenahme Phloem, ist es immer ratsam, für Verunreinigungen, zum Beispiel durch RT-PCR8zu überprüfen. Ein repräsentatives Ergebnis erhalten von einer reinen Phloem-Probe ist in Abbildung 2dargestellt. Non-kontaminierten Phloem Proben sollte eine sichtbare Band für Thioredoxin h zeigen, während kein Signal für Rubisco und Pollen-Hüllprotein angezeigt werden soll. Die kleine Untereinheit der Rubisco dienen als Steuerelement in Proben aus den Blättern, Blütenstand Stengel oder Pollen. Thioredoxin h sollte in allen Proben nachweisbar sein, da die mRNA gefunden wurde in das Phloem von verschiedenen Arten, während die Pollen Mantel Protein Abschrift nur in Blütenknospe Proben sichtbar sein soll. Verunreinigungen können auftreten, wenn Phloem Probenahme durchgeführt wird, voll blühender Pflanzen (Pollen Hüllprotein) oder wenn die ersten Tröpfchen aus dem Phloem Probenahme Punktionen nicht ordnungsgemäß verworfen werden (Rubisco).
Vor BN-Seite ist es zwingend erforderlich, um dem Phloem-Saft zu konzentrieren. Mit 20 bis 30 µg Protein pro Bohrloch, mindestens vier große Protein Komplex Bänder sichtbar nach BN-Seite von B. Napus Phloem Sap, zu niedrig oder zu hohe Konzentration nicht erlauben eine klare Trennung der komplexe (Abbildung 3). Es empfiehlt sich, mehrere Gel-Bands vertreten die gleichen Komplex in einer einzigen Tasche des zweiten Dimension Gels die Proteine aus jeder einzelnen Anlage für downstream-Processing und spätere massenspektrometrische Identifizierung sich laden.
Um die einzelnen Komponenten der Phloem makromolekulare komplexe zu identifizieren, wir BN-Startseite in Kombination mit einer zweiten Dimension Tris-Tricine-Harnstoff und eine dritte dimension SDS-PAGE um eine Trennung der einzelnen Proteine zu erreichen. Eine Trennung mit hoher Auflösung kann hier, aufgrund der verschiedenen Protein Migration Verhalten in Harnstoff und SDS-PAGE Gelen beobachtet werden. In der Regel sind Proteine, die Zugehörigkeit zu einem einzigen Komplex als eine diagonale Linie über das Gel sichtbar. Proteine oberhalb dieser Linie haben eine erhöhte Hydrophobie, während Proteine unter dem Strich mehr hydrophilen diejenigen28 (Abbildung 5, Abbildung 6) darstellen.
Für die Charakterisierung von RNP-komplexe haben wir einen Teil einer BN-PAGE-Gel BN Nordbeflecken durchführen. Nach beflecken eine ganze Spur auf einen Nylon-Membran und Vernetzung durch UV-Strahlung, kann die RNA mit RNA-spezifischen Sonden, wie in Abbildung 4dargestellt visualisiert werden. Hier wird gezeigt, dass eine spezifische tRNA nur in einer bestimmten Anlage vorhanden ist. Die Proteinkomponenten dieser tRNA-Binding-Komplex können mit dem oben beschriebenen 3D Gel-Ansatz weiter untersucht werden. Massenspektrometrische Analysen ergaben, dass diese Anlage vor allem tRNA-Ligases was bestätigt die tRNA verbindliche Aktivität enthält von BN Nordbeflecken gefunden.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57097/57097fig1.jpg"> Abb. 1: Ablauf der Analyse von komplexen Ribonucleoprotein in dem Phloem-Saft des Raps arbeiten. Nach der Probenahme und Vorbereitung der Proben Phloem wird BN-Seite durchgeführt, um native komplexe zu trennen. Solche Gele BN-Seite ermöglichen die parallele Analyse von Nukleinsäuren von BN Nordbeflecken und die Identifizierung von den Eiweißbausteinen der komplexe durch Massenspektrometrie. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57097/57097fig2.jpg"> Abbildung 2: Probenahme und Reinheit Kontrolle über Phloem-Saft des B. Napus. Nach der Punktion des Blütenstand Stammes von ca. 8-10 Wochen alten Rapspflanzen mit einer sterilen Injektionsnadel, Exsudat mit einer Pipette gesammelt und übertragen eine eiskalte Reaktionsgefäß (a), die Reinheit der Phloem Proben bestätigen, die RT-PCR durchgeführt wird, verstärken die Transkripte von Thioredoxin h, Rubisco kleine Untereinheit und Pollen Hüllprotein in gewebespezifischen Proben (b) RT-PCR ohne Reverse Transkriptase wurde als Kontrolle (-) durchgeführt. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57097/57097fig3.jpg"> Abbildung 3: BN-Seite. Schematische Darstellung des blauen native Seite mit konzentrierter Phloem Proben von B. Napus. (a) nach dem Laden der gradient Protein Gel mit 15-20 µL konzentrierte Phloem Sap, ist BN-Seite mit 1 X dunkle blaue Kathode Puffer B 150 V für 20-30 min in einem kalten Raum durchgeführt. Dann Puffer gegen 1 X leichte blaue Kathode Puffer B/10 ausgetauscht und die Seite ist fertig bei 150 V für 120-180 min bis dunkelblau läuft vorne läuft aus dem Gel. Die BN-Seite Gele zeigen vier verschiedene Bands aus vier verschiedenen hohen Molekulargewicht-komplexen. (b) laden (c) zu wenig oder zuviel (d) Phloem Proteine reduziert die Sichtbarkeit der einzelnen komplexe. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57097/57097fig4.jpg"> Abbildung 4: BN Nordbeflecken. Schematische Darstellung der BN northern Blot-Methode. (a) eine Spur der BN-Seite wird auf eine Nylon-Membran durch semi-dry blotting übertragen. Nach UV-Vernetzung und Pre-Hybridisierung wird die Membran mit RNA spezifische Sonden (hier eine Methionin-tRNA-spezifische Sonde), die biotinylierte am 3'-Ende in einer Hybridisierung Ofen über Nacht inkubiert. Kostenlose Sonden werden durch Waschschritte entfernt und die Erkennung der RNA erfolgt durch einen Streptavidin-HRP-Konjugat und Luminol. Mit diesem Ansatz, wir beobachteten, dass komplexe IV von der BN-Seite Methionin enthält tRNA. (b) die Coomassie gefärbt-Gel und der tRNA-Blot ähneln zwei verschiedene Gel Bahnen laufen parallel zur Migration Unterschiede zu vermeiden. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57097/57097fig5.jpg"> Abbildung 5: 3D-Seite. Schematische Darstellung des 3D-Seite-Ansatzes. Mehrere Bands aus der gleichen Komplex werden herausgeschnitten aus einer BN-PAGE-Gel, in Ladepuffer inkubiert und in einem Brunnen der zweiten Dimension Tris-Tricine-Harnstoff-Seite übertragen. Nach Elektrophorese sind ganze Gel Bahnen ausgeschnitten, in sauren Säure-Puffer gewaschen, equilibriert, und auf eine 15 % SDS-PAGE Gel gelegt. Nach der dritten Dimension Seite sind die getrennten Proteine Coomassie gefärbt und durch Massenspektrometrie analysiert. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig5large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57097/57097fig6.jpg"> Abbildung 6: Vertreter führt nach 3D-Seite. Im Rahmen der ersten Dimension BN-Seite erschienen mehrere komplexe. Ihre Proteinkomponenten konnte durch zwei denaturierenden Folgeseiten, wodurch ein Muster mit diagonalen Streifen vor Ort weiter getrennt werden. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig6large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Sonde</td>
			<td>Sequenz</td>
		</tr>
<tr>
<td>Thioredoxin h</td>
			<td>
 weiter: CTCAAGGCAGCCAAAGAATC Rückseite: ATGGCCTGAACATCGAACTC</td>
		</tr>
<tr>
<td>RuBisCo kleine Kette</td>
			<td>
 weiter: TTCACCGGCTTGAAGTCATC Rückseite: CCGGGTACTCCTTCTTGCAT</td>
		</tr>
<tr>
<td>Pollen-Hüllprotein BRU77666</td>
			<td>
 weiter: TCAGAACTGGAGCTTCAACG Rückseite: TTCCTTAATGGCCTCAGTGG</td>
		</tr>
</tbody></table>Tabelle 1: Primer verwendet für Phloem Probe Reinheitskontrolle. Bestätigen Phloem Probe Reinheit Primer spezifisch für Rubisco kleine Kette, Thioredoxin h und Pollen Hüllprotein cDNA Amplification einsetzbar.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Puffer und Lösungen</td>
			<td colspan="2">Inhalt</td>
			<td>Kommentar</td>
		</tr>
<tr>
<td>dunkel blaue Kathode Puffer B</td>
			<td colspan="2">15 mM Bis-Tris pH 7,0 50 mM Tricine 0,02 % (w/V) Coomassie blue G250</td>
			<td>Rezept ist von Fiala Et Al. 17 angepasst. 7.0 sollte der pH-Wert eingestellt werden Puffer kann als ein 10 X Lager gebildet werden</td>
		</tr>
<tr>
<td>leichte blaue Kathode Puffer B/10</td>
			<td colspan="2">15 mM Bis-Tris pH 7,0 50 mM Tricine 0,002 % (w/V) Coomassie blue G250</td>
			<td>Puffer kann durch Verdünnung Kathode Puffer B mit Kathode Puffer ohne Coomassie hergestellt werden</td>
		</tr>
<tr>
<td>Anode Puffer</td>
			<td colspan="2">
 50 mM Bis-Tris pH 7,0</td>
			<td>Puffer kann als ein 10 x Stammlösung hergestellt werden</td>
		</tr>
<tr>
<td>2 x SDS-Probenpuffer</td>
			<td colspan="2">
 125 mM Tris-HCl pH 6,8 4 % SDS 20 % Glycerin 0,2 M DVB-T 0,02 % (w/V) Bromophenol blue</td>
			<td></td>
		</tr>
<tr>
<td>Puffer 1 X TBE Puffer übertragen</td>
			<td colspan="2">
 89 mM Tris pH 7.6 89 mM Borsäure 2 mM EDTA</td>
			<td>TBE-Puffer kann gemacht und als Vorräte an 5 X oder 10 X gespeichert werden. Es ist wichtig, mit RNase-freie deionisiertes Wasser.</td>
		</tr>
<tr>
<td>2 x SSC-Puffer</td>
			<td colspan="2">
 300 mM NaCl 30 mM Na3Citrat pH 7,0</td>
			<td></td>
		</tr>
<tr>
<td>3 x Gel-Puffer</td>
			<td colspan="2">
 3 M Tris 1 M HCl 0,3 % SDS pH 8.45</td>
			<td>Rezept von Schägger 19 angepasst
</td>
		</tr>
<tr>
<td>Tris-Tricine Gel Lösung A</td>
			<td colspan="2">
 Für 10 mL: 30 % Acrylamid-Bisacrylamide (29,1) 3,34 mL 6 M Harnstoff 3 X Gel 3,34 mL Puffer 70 % Glycerin 1,4 mL 10 mL DdH2O hinzufügen 10 % APS 40 ΜL TEMED 4 ΜL</td>
			<td>Gewicht 6 M Harnstoff und 3 x Gel-Puffer, der Acrylamid-Bisacrylamide Lösung und 70 % Gycerol hinzufügen. Erhitzen Sie auf 60 ° C in einem Wasserbad auf den Harnstoff zu solubilisieren. Fügen Sie DdH2O bis 10 mL, 10 % APS und TEMED für die Polymerisation.</td>
		</tr>
<tr>
<td>Tris-Tricine Gel Lösung B</td>
			<td colspan="2">
 Für 6 mL: 30 % Acrylamid-Bisacrylamide (29,1) 0,8 mL 6 M Harnstoff 3 X Gel Puffer 1,5 mL 6 mL DdH2O hinzufügen 10 % APS 45 ΜL TEMED 4,5 ΜL</td>
			<td>Gewicht 6 M Harnstoff und 3 x Gel Puffer und Acrylamid-Bisacrylamide Lösung hinzufügen. Erhitzen Sie auf 60 ° C in einem Wasserbad auf den Harnstoff zu solubilisieren. Fügen Sie DdH2O bis 10 mL, 10 % APS und TEMED für die Polymerisation.</td>
		</tr>
<tr>
<td>1 x Tris-Tricine laufenden Puffer (Anode)</td>
			<td colspan="2">
 100 mM Tris 22,5 mM HCl pH 8,9</td>
			<td>Rezept von Schägger 19 angepasst
</td>
		</tr>
<tr>
<td>1 x Tris-Tricine laufenden Puffer (Kathode)</td>
			<td colspan="2">
 100 mM Tris 100 mM Tricine 1 % SDS pH 8,25</td>
			<td>Rezept von Schägger 19 angepasst
</td>
		</tr>
<tr>
<td>Sauren Puffer</td>
			<td colspan="2">
 100 mM Tris 100 mM Essigsäure</td>
			<td></td>
		</tr>
<tr>
<td>4 % SDS Stapeln gel</td>
			<td colspan="2">
 Für 2 mL: DdH2O 1,4 mL 30 % Acrylamid-Bisacrylamide (37.5:1) 0,33 mL 1 M Tris pH 6,8 0,25 mL 10 % SDS 20 ΜL 10 % APS 20 ΜL ΜL TEMED 2</td>
			<td></td>
		</tr>
<tr>
<td>15 % SDS Trennung gel</td>
			<td colspan="2">
 Für 10 mL: DdH2O 2,3 mL 30 % Acrylamid-Bisacrylamide (37.5:1) 5 mL 1.5 M Tris pH 8,8 2,5 mL 10 % SDS 100 ΜL 10 % APS 100 ΜL TEMED 4 ΜL</td>
			<td></td>
		</tr>
<tr>
<td>1 x SDS laufenden Puffer</td>
			<td colspan="2">
 25 mM Tris 192 mM Glycin 0,1 % SDS</td>
			<td></td>
		</tr>
<tr>
<td>Coomassie Färbelösung</td>
			<td colspan="2">
 5 % (w/V) Aluminiumsulfat-(14-18)-Hydrat 10 % (V/V) Ethanol (96 %) 2 % (V/V) Orthophosphorsäure Säure (85 %) 0,02 % (w/V) Coomassie Brilliant Blue G-250 
			 </td>
			<td></td>
		</tr>
<tr>
<td>ULTRAhyb Gromer Hybridisierung Puffer</td>
			<td colspan="2"></td>
			<td>AMBION, Life Technologies</td>
		</tr>
</tbody></table>Tabelle 2: Lösungen und Puffer Rezepte. Liste aller Puffer und Lösungen für 3D-PAGE-Analyse erforderlich.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Nein zu erkennen.</td>
			<td>MW OBS [kDa].</td>
			<td colspan="2">Identifikation</td>
			<td>Organismus</td>
			<td>Den Beitritt nein.</td>
			<td>MW [kDa]</td>
			<td>Maskottchen-Partitur</td>
		</tr>
<tr>
<td>CIV_1</td>
			<td>130</td>
			<td colspan="2">Vermeintliche Krankheit Widerstand Protein At4g19050</td>
			<td>B. napus</td>
			<td>CDX78917</td>
			<td>131.1</td>
			<td>110</td>
		</tr>
<tr>
<td>CIV_2</td>
			<td>130</td>
			<td colspan="2">Vermeintliche Krankheit Widerstand Protein At4g19050</td>
			<td>B. napus</td>
			<td>CDX78917</td>
			<td>131.1</td>
			<td>89</td>
		</tr>
<tr>
<td>CIV_3</td>
			<td>100</td>
			<td colspan="2">Heat shock 70 kDa-Protein 14-wie</td>
			<td>B. napus</td>
			<td>XP_013748865</td>
			<td>89,9</td>
			<td>113</td>
		</tr>
<tr>
<td>CIV_4</td>
			<td>90</td>
			<td colspan="2">Eukaryotische Dehnung Faktor 2 Zellteilung Steuern Protein 48 Homolog A</td>
			<td>B. napus B. napus</td>
			<td>CDX90241 CDY41316.1</td>
			<td>89,5 89,5</td>
			<td>111 197</td>
		</tr>
<tr>
<td>CIV_5</td>
			<td>85</td>
			<td colspan="2">Heat shock Protein 90-2-like</td>
			<td>B. rapa</td>
			<td>XP_009132342</td>
			<td>79,8</td>
			<td>172</td>
		</tr>
<tr>
<td>CIV_6</td>
			<td>80</td>
			<td colspan="2">Threonin--tRNA-ligase Glycin - tRNA-ligase</td>
			<td>B. oleracea B. napus</td>
			<td>XP_013599115 CDY43195</td>
			<td>81,5 80,8</td>
			<td>110 88</td>
		</tr>
<tr>
<td>CIV_7</td>
			<td>70</td>
			<td colspan="2">Heat Shock Protein 70 kDa Lysin - tRNA Ligase-wie</td>
			<td>B. oleracea B. napus</td>
			<td>XP_013685267 XP_013747530</td>
			<td>67,8 69,9</td>
			<td>230 150</td>
		</tr>
<tr>
<td>CIV_8</td>
			<td>65</td>
			<td colspan="2">Myrosinase Aspartate--tRNA-Ligase 2 Asparagin - tRNA Ligase 1</td>
			<td>B. napus B. napus B. napus</td>
			<td>ABQ42337 XP_013670803 XP_013729126</td>
			<td>60,6 61,6 63,5</td>
			<td>183 141 153</td>
		</tr>
<tr>
<td>CIV_9</td>
			<td>60</td>
			<td colspan="2">Myrosinase</td>
			<td>B. napus</td>
			<td>ABQ42337</td>
			<td>60,6</td>
			<td>164</td>
		</tr>
<tr>
<td>CIV_10</td>
			<td>55</td>
			<td colspan="2">Adenosylhomocysteinase 2-wie</td>
			<td>B. rapa</td>
			<td>XP_009135865</td>
			<td>53.1</td>
			<td>139</td>
		</tr>
<tr>
<td>CIV_11</td>
			<td>55</td>
			<td colspan="2">Dehnung Faktor 1-Alpha 1-wie</td>
			<td>B. oleracea</td>
			<td>XP_013586115</td>
			<td>51,9</td>
			<td>161</td>
		</tr>
<tr>
<td>CIV_12</td>
			<td>50</td>
			<td colspan="2">Cystin-Lyase CORI3-wie</td>
			<td>B. napus</td>
			<td>XP_013653143</td>
			<td>48,1</td>
			<td>237</td>
		</tr>
<tr>
<td>CIV_13</td>
			<td>44</td>
			<td colspan="2">Cystin-Lyase CORI3-wie</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48,3</td>
			<td>213</td>
		</tr>
<tr>
<td>CIV_14</td>
			<td>38</td>
			<td colspan="2">Fruktose-Bisphosphate aldolase</td>
			<td>B. rapa</td>
			<td>XP_009115993</td>
			<td>38,4</td>
			<td>226</td>
		</tr>
<tr>
<td>CIV_15</td>
			<td>45</td>
			<td colspan="2">Cystin-Lyase CORI3-wie</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48,3</td>
			<td>219</td>
		</tr>
<tr>
<td>CIV_16</td>
			<td>45</td>
			<td colspan="2">Cystin Lyase CORI3</td>
			<td>B. rapa</td>
			<td>CDY69765</td>
			<td>46,9</td>
			<td>209</td>
		</tr>
<tr>
<td>CIV_17</td>
			<td>38</td>
			<td colspan="2">Fruktose-Bisphosphate aldolase</td>
			<td>B. rapa</td>
			<td>XP_009115993</td>
			<td>38,4</td>
			<td>124</td>
		</tr>
<tr>
<td>CIV_18</td>
			<td>18</td>
			<td colspan="2">Peptidyl-Prolyl-Cis-Trans-Isomerase CYP18-3-like</td>
			<td>B. napus</td>
			<td>XP_009101932</td>
			<td>18.3</td>
			<td>128</td>
		</tr>
<tr>
<td>CIV_19</td>
			<td>45</td>
			<td colspan="2">Cystin-Lyase CORI3-wie</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48,3</td>
			<td>177</td>
		</tr>
</tbody></table>Tabelle 3: identifiziert Proteinkomponenten aus Komplex IV. Mehrere tRNA Ligases und weitere Proteine der tRNA verbindliche Anlage gefunden wurden mittels MALDI-TOF Masse spektrometrische Analyse nach 3D-Seite.

Watch this Scientific Journal Video about Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes at JoVE.com

Phloemsaftprobenahme aus Brassica napus für die 3D-PAGE von Protein- und Ribonukleoproteinkomplexen | Biologie | Video

Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

Phloem Sap Probenahme aus Brassica Napus für 3D-Seite von Protein und Ribonucleoprotein komplexe

Hier präsentieren wir ein Protokoll, um die Proteinzusammensetzung von großen native Protein: Protein und Protein zu analysieren: Nukleinsäure-komplexe aus Raps (B. Napus) Phloem Exsudat mit einem 3D Polyacrylamid-Gel-Elektrophorese (PAGE) Ansatz kombiniert blau Native (BN) mit zwei denaturierenden Seiten gefolgt von massenspektrometrische Identifizierung.

Sampling the phloem of higher plants is often laborious and significantly dependent on the plant species. However, proteome studies under denaturing ...

phloem-sap-sampling-from-brassica-napus-for-3d-page-protein

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

Fundamentals

Macromolecules

SCIENTISTS IN ACTION

13.7K Aufrufe.  Universität Hamburg. Hier präsentieren wir ein Protokoll, um die Proteinzusammensetzung von großen native Protein: Protein und Protein zu analysieren: Nukleinsäure-komplexe aus Raps (B. Napus) Phloem Exsudat mit einem 3D Polyacrylamid-Gel-Elektrophorese (PAGE) Ansatz kombiniert blau Native (BN) mit zwei denaturierenden Seiten gefolgt von massenspektrometrische Identifizierung.

Serie: Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

Purification and Visualization of Influenza A Viral Ribonucleoprotein Complexes

The influenza A viral genome consists of eight negative-sense, single stranded RNA molecules, individually packed with multiple copies of the influenza A nucleoprotein (NP) into viral ribonulceoprotein particles (vRNPs). The influenza vRNPs are enclosed within the viral envelope. During cell entry, however, these vRNP complexes are released into the cytoplasm, where they gain access to the host nuclear transport machinery. In order to study the nuclear import of influenza vRNPs and the replication of the influenza genome, it is useful to work with isolated vRNPs so that other components of the virus do not interfere with these processes. Here, we describe a procedure to purify these vRNPs from the influenza A virus. The procedure starts with the disruption of the influenza A virion with detergents in order to release the vRNP complexes from the enveloped virion. The vRNPs are then separated from the other components of the influenza A virion on a 33-70% discontinuous glycerol gradient by velocity sedimentation. The fractions obtained from the glycerol gradient are then analyzed on via SDS-PAGE after staining with Coomassie blue. The peak fractions containing NP are then pooled together and concentrated by centrifugation. After concentration, the integrity of the vRNPs is verified by visualization of the vRNPs by transmission electron microscopy after negative staining. The glycerol gradient purification is a modification of that from Kemler et al. (1994)1, and the negative staining has been performed by Wu et al. (2007).2

The genome of the influenza A virus consists of eight separate complexes of RNA and proteins, termed viral ribonucleoprotein complexes (vRNPs). This paper describes the glycerol gradient purification and transmission electron microscopy visualization of influenza A vRNPs.

Reinigung und Visualisierung von Influenza A Virus Ribonukleoproteinkomplexe

The influenza A viral genome consists of eight negative-sense, single stranded RNA molecules, individually packed with multiple copies of the influenza A ...

Forschung

Biologie

Identification of protein complexes with quantitative proteomics in S. cerevisiae

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as important intracellular signalling molecules. However, unlike proteins, lipids are small hydrophobic molecules that traffic primarily by poorly described nonvesicular routes, which are hypothesized to occur at membrane contact sites (MCSs). MCSs are regions where the endoplasmic reticulum (ER) makes direct physical contact with a partnering organelle, e.g., plasma membrane (PM). The ER portion of ER-PM MCSs is enriched in lipid-synthesizing enzymes, suggesting that lipid synthesis is directed to these sites and implying that MCSs are important for lipid traffic. Yeast is an ideal model to study ER-PM MCSs because of their abundance, with over 1000 contacts per cell, and their conserved nature in all eukaryotes. Uncovering the proteins that constitute MCSs is critical to understanding how lipids traffic is accomplished in cells, and how they act as signaling molecules. We have found that an ER called Scs2p localize to ER-PM MCSs and is important for their formation. We are focused on uncovering the molecular partners of Scs2p. Identification of protein complexes traditionally relies on first resolving purified protein samples by gel electrophoresis, followed by in-gel digestion of protein bands and analysis of peptides by mass spectrometry. This often limits the study to a small subset of proteins. Also, protein complexes are exposed to denaturing or non-physiological conditions during the procedure. To circumvent these problems, we have implemented a large-scale quantitative proteomics technique to extract unbiased and quantified data. We use stable isotope labeling with amino acids in cell culture (SILAC) to incorporate staple isotope nuclei in proteins in an untagged control strain. Equal volumes of tagged culture and untagged, SILAC-labeled culture are mixed together and lysed by grinding in liquid nitrogen. We then carry out an affinity purification procedure to pull down protein complexes. Finally, we precipitate the protein sample, which is ready for analysis by high-performance liquid chromatography/ tandem mass spectrometry. Most importantly, proteins in the control strain are labeled by the heavy isotope and will produce a mass/ charge shift that can be quantified against the unlabeled proteins in the bait strain. Therefore, contaminants, or unspecific binding can be easily eliminated. By using this approach, we have identified several novel proteins that localize to ER-PM MCSs. Here we present a detailed description of our approach. 

Here we describe a new quantitative proteomics technique for identifying protein complexes in Saccharomyces cerevisiae. In this study, we have used the SILAC method together with affinity purification followed by tandem mass spectrometry to identify with high specificity the binding partners of an ER protein, Scs2p.

Identifizierung von Protein-Komplexen mit der quantitativen Proteomik in S. cerevisiae

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as ...

Using the GELFREE 8100 Fractionation System for Molecular Weight-Based Fractionation with Liquid Phase Recovery

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based fractionation. The system is comprised of single-use, 8-sample capacity cartridges and a benchtop GELFREE Fractionation Instrument. During separation, a constant voltage is applied between the anode and cathode reservoirs, and each protein mixture is electrophoretically driven from a loading chamber into a specially designed gel column gel. Proteins are concentrated into a tight band in a stacking gel, and separated based on their respective electrophoretic mobilities in a resolving gel. As proteins elute from the column, they are trapped and concentrated in liquid phase in the collection chamber, free of the gel. The instrument is then paused at specific time intervals, and fractions are collected using a pipette. This process is repeated until all desired fractions have been collected. If fewer than 8 samples are run on a cartridge, any unused chambers can be used in subsequent separations.
This novel technology facilitates the quick and simple separation of up to 8 complex protein mixtures simultaneously, and offers several advantages when compared to previously available fractionation methods. This system is capable of fractionating up to 1mg of total protein per channel, for a total of 8mg per cartridge. Intact proteins over a broad mass range are separated on the basis of molecular weight, retaining important physiochemical properties of the analyte. The liquid phase entrapment provides for high recovery while eliminating the need for band or spot cutting, making the fractionation process highly reproducible1.

The accompanying video describes the use of the GELFREE 8100 Fractionation System, which partitions complex protein samples on the basis of molecular weight and recovers the fractions in liquid phase. The video describes how the technology works, how it is used, and provides resultant data, with polyacrylamide gel electrophoresis analysis of fractionated bovine liver homogenate.

Mit dem GELFREE 8100 Fraktionierung System für Molecular Weight-Based Fraktionierung mit Liquid Phase Wiederherstellung

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based ...

Analyzing Large Protein Complexes by Structural Mass Spectrometry

Living cells control and regulate their biological processes through the coordinated action of a large number of proteins that assemble themselves into an array of dynamic, multi-protein complexes1. To gain a mechanistic understanding of the various cellular processes, it is crucial to determine the structure of such protein complexes, and reveal how their structural organization dictates their function. Many aspects of multi-protein complexes are, however, difficult to characterize, due to their heterogeneous nature, asymmetric structure, and dynamics. Therefore, new approaches are required for the study of the tertiary levels of protein organization.
One of the emerging structural biology tools for analyzing macromolecular complexes is mass spectrometry (MS)2-5. This method yields information on the complex protein composition, subunit stoichiometry, and structural topology. The power of MS derives from its high sensitivity and, as a consequence, low sample requirement, which enables examination of protein complexes expressed at endogenous levels. Another advantage is the speed of analysis, which allows monitoring of reactions in real time. Moreover, the technique can simultaneously measure the characteristics of separate populations co-existing in a mixture. 
Here, we describe a detailed protocol for the application of structural MS to the analysis of large protein assemblies. The procedure begins with the preparation of gold-coated capillaries for nanoflow electrospray ionization (nESI). It then continues with sample preparation, emphasizing the buffer conditions which should be compatible with nESI on the one hand, and enable to maintain complexes intact on the other. We then explain, step-by-step, how to optimize the experimental conditions for high mass measurements and acquire MS and tandem MS spectra. Finally, we chart the data processing and analyses that follow. Rather than attempting to characterize every aspect of protein assemblies, this protocol introduces basic MS procedures, enabling the performance of MS and MS/MS experiments on non-covalent complexes. Overall, our goal is to provide researchers unacquainted with the field of structural MS, with knowledge of the principal experimental tools.

Mass spectrometry has proven to be a valuable tool for analyzing large protein complexes. This method enables insights into the composition, stoichiometry and overall architecture of multi-subunit assemblies. Here, we describe, step-by-step, how to perform a structural mass spectrometry analysis, and characterize macromolecular structures.

Analyse großer Proteinkomplexe von Structural-Massenspektrometrie

Living cells control and regulate their biological processes through the coordinated action of a large number of proteins that assemble themselves into an ...

A Noninvasive Hair Sampling Technique to Obtain High Quality DNA from Elusive Small Mammals

Noninvasive genetic sampling approaches are becoming increasingly important to study wildlife populations. A number of studies have reported using noninvasive sampling techniques to investigate population genetics and demography of wild populations1. This approach has proven to be especially useful when dealing with rare or elusive species2. While a number of these methods have been developed to sample hair, feces and other biological material from carnivores and medium-sized mammals, they have largely remained untested in elusive small mammals. In this video, we present a novel, inexpensive and noninvasive hair snare targeted at an elusive small mammal, the American pika (Ochotona princeps). We describe the general set-up of the hair snare, which consists of strips of packing tape arranged in a web-like fashion and placed along travelling routes in the pikas&#x2019; habitat. We illustrate the efficiency of the snare at collecting a large quantity of hair that can then be collected and brought back to the lab. We then demonstrate the use of the DNA IQ system (Promega) to isolate DNA and showcase the utility of this method to amplify commonly used molecular markers including nuclear microsatellites, amplified fragment length polymorphisms (AFLPs), mitochondrial sequences (800bp) as well as a molecular sexing marker. Overall, we demonstrate the utility of this novel noninvasive hair snare as a sampling technique for wildlife population biologists. We anticipate that this approach will be applicable to a variety of small mammals, opening up areas of investigation within natural populations, while minimizing impact to study organisms.

We present a noninvasive sampling approach to efficiently collect hair samples from elusive small mammals, as shown for the American pika. We demonstrate the utility of this method by extracting DNA from sampled hair and amplifying several types of molecular markers commonly used in studies of wildlife ecology and conservation.

Ein nicht-invasives Haar Sampling-Technik, um High Quality DNA aus Elusive Kleinsäuger erhalten

Noninvasive genetic sampling approaches are becoming increasingly important to study wildlife populations. A number of studies have reported using ...

Biochemical Reconstitution of Steroid Receptor&#x2022;Hsp90 Protein  Complexes and Reactivation of Ligand Binding

Hsp90 is an essential and highly abundant molecular chaperone protein that has been found to regulate more than 150 eukaryotic signaling proteins, including transcription factors (e.g. nuclear receptors, p53) and protein kinases (e.g. Src, Raf, Akt kinase) involved in cell cycling, tumorigenesis, apoptosis, and multiple eukaryotic signaling pathways 1,2. Of these many 'client' proteins for hsp90, the assembly of steroid receptor&bull;hsp90 complexes is the best defined (Figure 1). We present here an adaptable glucocorticoid receptor (GR) immunoprecipitation assay and in vitro GR&bull;hsp90 reconstitution method that may be readily used to probe eukaryotic hsp90 functional activity, hsp90-mediated steroid receptor ligand binding, and molecular chaperone cofactor requirements. For example, this assay can be used to test hsp90 cofactor requirements and the effects of adding exogenous compounds to the reconstitution process. 
The GR has been a particularly useful system for studying hsp90 because the receptor must be bound to hsp90 to have an open ligand binding cleft that is accessible to steroid 3. Endogenous, unliganded GR is present in the cytoplasm of mammalian cells noncovalently bound to hsp90. As found in the endogenous GR&bull;hsp90 heterocomplex, the GR ligand binding cleft is open and capable of binding steroid. If hsp90 dissociates from the GR or if its function is inhibited, the receptor is unable to bind steroid and requires reconstitution of the GR&bull;hsp90 heterocomplex before steroid binding activity is restored 4 . GR can be immunoprecipitated from cell cytosol using a monoclonal antibody, and proteins such as hsp90 complexed to the GR can be assayed by western blot. Steroid binding activity of the immunoprecipitated GR can be determined by incubating the immunopellet with [3H]steroid. 
Previous experiments have shown hsp90-mediated opening of the GR ligand binding cleft requires hsp70, a second molecular chaperone also essential for eukaryotic cell viability. Biochemical activity of hsp90 and hsp70 are catalyzed by co-chaperone proteins Hop, hsp40, and p23 5. A multiprotein chaperone machinery containing hsp90, hsp70, Hop, and hsp40 are endogenously present in eukaryotic cell cytoplasm, and reticulocyte lysate provides a chaperone-rich protein source 6. 
In the method presented, GR is immunoadsorbed from cell cytosol and stripped of the endogenous hsp90/hsp70 chaperone machinery using mild salt conditions. The salt-stripped GR is then incubated with reticulocyte lysate, ATP, and K+, which results in the reconstitution of the GR&bull;hsp90 heterocomplex and reactivation of steroid binding activity 7. This method can be utilized to test the effects of various chaperone cofactors, novel proteins, and experimental hsp90 or GR inhibitors in order to determine their functional significance on hsp90-mediated steroid binding 8-11.

An in vitro method for preparing functional glucocorticoid receptor (GR)&#x2022;hsp90 protein complexes from purified proteins and cellular lysates is described. The method utilizes immunoadsorption of recombinant GR followed by salt-stripping and protein complex reconstitution. The importance of cofactors and buffer conditions are discussed, as are potential method applications.

Biochemische Rekonstitution der Steroid-Rezeptor • Hsp90-Protein-Komplexen und Reaktivierung der Ligandenbindung

Hsp90 is an essential and highly abundant molecular chaperone protein that has been found to regulate more than 150 eukaryotic signaling proteins, ...

Method for the Isolation and Identification of mRNAs, microRNAs and Protein Components of Ribonucleoprotein Complexes from Cell Extracts using RIP-Chip

As a result of the development of high-throughput sequencing and efficient microarray analysis, global gene expression analysis has become an easy and readily available form of data collection. In many research and disease models however, steady state levels of target gene mRNA does not always directly correlate with steady state protein levels. Post-transcriptional gene regulation is a likely explanation of the divergence between the two. Driven by the binding of RNA Binding Proteins (RBP), post-transcriptional regulation affects mRNA localization, stability and translation by forming a Ribonucleoprotein (RNP) complex with target mRNAs. Identifying these unknown de novo mRNA targets from cellular extracts in the RNP complex is pivotal to understanding mechanisms and functions of the RBP and their resulting effect on protein output. This protocol outlines a method termed RNP immunoprecipitation-microarray (RIP-Chip), which allows for the identification of specific mRNAs associated in the ribonucleoprotein complex, under changing experimental conditions, along with options to further optimize an experiment for the individual researcher. With this important experimental tool, researchers can explore the intricate mechanisms associated with post-transcriptional gene regulation as well as other ribonucleoprotein interactions.

A step by step protocol to isolating and identifying RNA associated complexes through RIP-Chip.

Verfahren zur Isolierung und Identifizierung von mRNAs, microRNAs und Protein-Komponenten des Ribonucleoprotein Komplexe aus Zellextrakten mit RIP-Chip

As a result of the development of high-throughput sequencing and efficient microarray analysis, global gene expression analysis has become an easy and ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

Bezeichnung des Post-translationale Modifikationen von Pflanzenproteinkomplexe

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

An in vivo Crosslinking Approach to Isolate Protein Complexes From Drosophila Embryos

Many cellular processes are controlled by multisubunit protein complexes. Frequently these complexes form transiently and require native environment to assemble. Therefore, to identify these functional protein complexes, it is important to stabilize them in vivo before cell lysis and subsequent purification. Here we describe a method used to isolate large bona fide protein complexes from Drosophila embryos. This method is based on embryo permeabilization and stabilization of the complexes inside the embryos by in vivo crosslinking using a low concentration of formaldehyde, which can easily cross the cell membrane. Subsequently, the protein complex of interest is immunopurified followed by gel purification and analyzed by mass spectrometry. We illustrate this method using purification of a Tudor protein complex, which is essential for germline development. Tudor is a large protein, which contains multiple Tudor domains - small modules that interact with methylated arginines or lysines of target proteins. This method can be adapted for isolation of native protein complexes from different organisms and tissues.

An in vivo Crosslinking Approach to Isolate Protein Complexes From Drosophila Embryos

Multi-component protein complexes play crucial roles during cellular function and development. Here we describe a method used to isolate native protein complexes from Drosophila embryos after in vivo crosslinking followed by purification of the crosslinked complexes for subsequent structure-function analysis.

Ein In vivo Vernetzung Ansatz zur Proteinkomplexe Von Isolieren Drosophila Embryonen

Many cellular processes are controlled by multisubunit protein complexes. Frequently these complexes form transiently and require native environment to ...

Sampling Blood from the Lateral Tail Vein of the Rat

Blood samples are commonly obtained in many experimental contexts to measure targets of interest, including hormones, immune factors, growth factors, proteins, and glucose, yet the composition of the blood is dynamically regulated and easily perturbed. One factor that can change the blood composition is the stress response triggered by the sampling procedure, which can contribute to variability in the measures of interest. Here we describe a procedure for blood sampling from the lateral tail vein in the rat. This procedure offers significant advantages over other more commonly used techniques. It permits rapid sampling with minimal pain or invasiveness, without anesthesia or analgesia. Additionally, it can be used to obtain large volume samples (upwards of 1 ml in some rats), and it may be used repeatedly across experimental days. By minimizing the stress response and pain resulting from blood sampling, measures can more accurately reflect the true basal state of the animal, with minimal influence from the sampling procedure itself.

Blood samples are useful for assessing biomarkers of physiological states or disease in vivo. Here we describe the methodology to sample blood from the lateral tail vein in the rat. This method provides rapid samples with minimal pain and invasiveness.

Blutprobenentnahme aus der laterale Schwanzvene der Ratte

Blood samples are commonly obtained in many experimental contexts to measure targets of interest, including hormones, immune factors, growth factors, ...