Name: phloem sap sampling from brassica napus for 3d-page of protein and ribonucleoprotein complexes
Uploaded: 2018-01-09T15:00:00.000+00:00
Duration: 11 min 23 s
Description: Watch this Scientific Journal Video about Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes at JoVE.com

우리가 그들의 과학적 지원을 위해 제니퍼 딕 및 Urszula Zarzenska 감사합니다. 이 작품 경력 통합 교부 금에 의해 (CIG, PCIG14-가-2013-63 0734) 7 프레임 워크 프로그램, 그랜트 LFF-GK06 'DELIGRAH' (Landesforschungsförderung 함부르크), DFG 그랜트 (DFG 애 856_6-1) 내에서 유럽 위원회에 의해 재정적으로 지원 되었다 JK에 게 수 여.

1. 샘플링 및 B. napus 에서 체 관 부 수액의 준비 식물 4,,820
<ol><li>체 관 부 수액 샘플링, 사용 잘 물을 8 주 된 B. napus 식물 꽃가루 오염을 방지 하기 위해 그 표시만 초기 개화.</li>
	<li>피하 주사를 사용 하 여 (Ø 0.8 m m)는 화 서는 punctate 여러 번 줄기와. 다른 몇 가지 화 서 줄기에 및 충분 한 체 관 부 수액 (그림 2a)를 다른 식물에 반복 합니다. 참고: 복잡 한 분석을 위해이 좋습니다 체 관 부 수액의 적어도 600 µ L로 시작 하. 4 ~ 5 식물의 체 관 부 수액 200, 700 µ L 사이 얻을 것입니다.</li>
	<li>필터 종이 부상된 사이트에서 첫 번째 드롭 다운을 닦아내십시오. 이러한 방울 주로 손상된 조직 주위에서 높은 오염된 물질을 포함 하 고 버려질 필요가 있다.</li>
	<li>Pipetting으로 다음 방울을 수집 하 고 수집된 exudate 얼음 냉각 시스템을 사용 하는-20 ° C에서 미리 냉장된 원뿔 1.5 mL 반응 관에 저장.</li>
	<li>계속 해 서 수집 전혀 더 드롭 형성은 관찰, 하지만 1 시간 보다는 더 이상 때까지. 수집 된 체 관 부 수액의 상당한 손실 없이 2 일 후에이 절차를 반복할 수 있습니다. 주: 수집 된 체 관 부 수액 즉시 사용 하거나 미래의 분석-80 ° C에 저장 될 수 있습니다. -80 ° C 보관, 충격-동결 반응 관에 액체 질소.</li>
	<li>체 관 부 샘플 약 1/6번째 분자량 (MWCO) 10000 Daltons (Da)의 차단으로 원심 집중 장치를 사용 하 여 초기 볼륨을 집중 한다. 4 ° C와 먼지 입자를 제거 하는 적어도 15 분 동안 20000 x g에서 집중된 샘플 원심 참고: 체 관 부 수액 농도 단백질의 상당한 손실에 연결 되지 않습니다.</li>
	<li>이후 복잡 한 분석, 단계 3.1 진행.</li>
</ol>2. 체 관 부 수액 순도 제어 역전사 PCR (RT-PCR) 4,,820 를 사용 하 여
<ol><li>체 관 부 수액 액체 재료에 대 한 표준 RNA 추출 메서드를 사용 하 여에서 총 RNA 격리 (예: TRIzol 또는 페 놀-클로 프롬 적 출 소 프로 파 놀 강수량 수성 단계에 따라 단계를 세척 하는 에탄올에서 뒤는 제조 업체의 프로토콜)입니다. 주의: 페 놀-클로 프롬 독성이 있다. 적절 한 개인 보호 장비와 후드 작동 합니다. 최대 6 개월까지-80 ° C에서의 에탄올에 추출 된 RNA는 저장할 수 있습니다.</li>
	<li>DNase 소화 하 여 DNA의 오염 제거 나 (1 u / µ g) 37 ° C에서 45 분 동안 5mm의 최종 농도에 EDTA를 추가 하 여 효소를 비활성화 하 고 10 분 동안 75 ° C에 샘플을 품 어.</li>
	<li>순수한 RNA를 정화 하 고 다른 정화 단계 (예: 제조업체의 지침에 따라 RNA 정리 키트를 사용 하 여)에 의해 샘플을 집중 합니다.</li>
	<li>150를 사용 하 여 cDNA 합성 키트 역전사 PCR (RT-PCR) cDNA의 합성에 대 한 수행 ng 순수한 RNA의 제조 업체에 의해 설명 된 대로 프로토콜의. 참고:는 cDNA 저장할 수 있습니다-20 ° C에서 사용까지.</li>
	<li>구획 별 성적표를 증폭 agarose 젤 전기 이동 법에 의해 확인 하는 제조 업체에 의해 지정 된 표준 PCR 반응에 대 한 템플릿으로 cDNA의 5 µ L 사용 합니다. 예를 들어 rubisco 작은 소 단위, thioredoxin h, 그리고 꽃가루 외 투 단백질 (그림 1b, 표 1)에 대 한 프라이 머를 사용 하 여 체 관 부 샘플의 순도 확인 합니다.</li>
</ol>3. 블루 기본 페이지 4,25,,2631
<ol><li>사용 중 자기 부 기본 그라데이션 젤 설명 대로 다른27 또는 상업 두번째-트리 스 그라데이션 젤.</li>
	<li>부하에서 젤으로 잘 당 집중된 단백질 샘플의 20 ~ 30 µ g 이상 triplicates.</li>
	<li>4 ° C에서 150 V 젤 실행 샘플 젤 (ca. 20 ~ 30 분, 그림 3a)의 1/3rd 때까지 어두운 파란색 음극 버퍼 B와 양극 버퍼 (표 2)를 사용 하 여. 참고: 북부 blotting에 대 한 단일 젤 레인은 3D 페이지와 덜 풍부한 단백질을 집중 하 여 최대 10 개 젤 차선에서 같은 밴드를 결합 하는 것이 좋습니다 하는 질량 분석에 의해 단백질 구성의 분석에 대 한 동안, 충분 한.</li>
	<li>실행을 일시 중지 한 exchange 어두운 파란색 음극 버퍼 B 밝은 파란색 음극 B/10 (표 2)를 버퍼링 하 고 실행을 계속. 젤 블루 앞 elute 젤 (ca. 120 ~ 180 분, 그림 3a)를 시작할 때 실행을 마칩니다. 참고: 완료 블루 기본 젤 저장할 수 있습니다 4 ° C에 적어도 1 주일에 대 한. 장기간된 보관 밴드 확산으로 이어질 수 있습니다 하 고 피해 야 한다. 다크 블루 버퍼 B 다시 사용할 수 있습니다.</li>
</ol>4. 선택 사항: RNA 블루 네이티브 북부 더 럽 히 4 를 사용 하 여 검출
<ol><li>독특한 밴드 밖으로 또는 블루 기본 젤에서 전체 젤 레인을 사용 하 여 및 세미 드라이 60 분 3.5 mA/cm2 blotting에 의해 나일론 막에 그들을 전송 잘라내어 멤브레인 (그림 4a)에 연필로 위와 더 낮은 젤 테두리를 표시.</li>
	<li>럽, 후 DEPC 처리 물 막 세척 하 고 건조 한 두 필터 논문 사이.</li>
	<li>UV-가교 120000 µ / cm2 blotted 막의 수행 (85 s 자료의 테이블에에서는 Crosslinker를 사용 하는 경우).</li>
	<li>사전에 교 잡 오븐 (그림 4a)에서 68 ° C에서 60 분에 대 한 교 잡 버퍼 (상업적 또는 성가)의 6 mL와 함께 막 교배.</li>
	<li>3'-biotinylated 프로브 4 µ L를 포함 하는 교 잡 버퍼의 추가 1 mL을 추가 (100 nM).</li>
	<li>품 어 막의 프로브, 37 ° c 68 ° C에서 오븐을 냉각 하는 동안</li>
	<li>2 x SSC와 0.1 %SDS, 프로브 unspecifically 바인딩 제거를 위해 상 온에서 5 분을 포함 하는 버퍼 막 씻어. 주의: SDS 자극을 일으킬 수 있습니다. SDS와 솔루션을 포함 하는 SDS를 작업할 때 장갑과 실험실 코트를 착용.</li>
	<li>민감한 chemiluminescent 반응 (그림 4a) 인 양 고추냉이 과산화 효소 (HRP) 기판으로는 막 예 luminol와 Streptavidin HRP 공액에의 3'-biotinylated 프로브 탐지를 수행 합니다.</li>
</ol>5. 두 번째 치수: 트리 스-Tricine-요소 페이지 4,28
<ol><li>단일 밴드 블루 기본 젤에서 삭제하시오 더 복잡 한 단백질 (그림 5)의 농도 달성 하기 위해 병렬 차선에서 실행 하는 샘플에서 밴드를 결합 합니다. 참고: 삭제 밴드에에서 저장할 수 있습니다 단일 반응 튜브 4 ° c.에서 사용까지</li>
	<li>12% 트리 스-Tricine-요소 젤을 붓고 (두께 1 m m, 6.8 c m x 8.6 cm (폭 x 길이)). 분리 젤 (표 2), 젤 솔루션의 10 mL를 준비 두 유리 접시 소 프로 파 놀과 오버레이 간의 부. 중 합 완료 후는 소 프로 파 놀을 제거 하 고 젤 삽입 10 잘 빗에 겹쳐 쌓이는 젤에 대 한 젤 솔루션 B (표 2)의 4 mL를 전송. 주의: Unpolymerized 아크릴 신경 수 이며 TEMED 흡입 하는 경우에 유해한. 항상 개인 보호 장비를 착용 하 고는 후드 작동.</li>
	<li>1.5 mL 반응 관에 삭제 젤 밴드를 전송 하 고 젤 조각 (그림 5, 표 2)의 평형에 대 한 SDS 샘플 버퍼 x 2의 1 mL를 추가 합니다.<ol>
<li>실내 온도에, 또는 전자 레인지에가 열 블록 (95 ° C)에 끓는 전에 10 분 동안 샘플을 품 어 고 추가 15 분 동안 실내 온도에 다시 샘플을 품 어.</li>
		<li>여러 equilibrated 젤 조각 같은 복잡 한을 대표 하는 하나의 단일 젤 주머니에 스택.</li>
		<li>전기 이동 법 양극과 음극 150 V 45 ~ 60 분에 버퍼를 실행을 사용 하 여 수행 하 고 전체 젤 레인을 삭제할.</li>
	</ol>
</li>
	<li>산 성 버퍼 (100 mM Tris, 100 mM 아세트산)에서 20 분 컷된 레인을 품 어 고 125 mM Tris HCl, pH 6.8 또 다른 20 분 (그림 5)에서 equilibrate.</li>
</ol>6. 3 차원: SDS-페이지 4,32
<ol><li>분리 젤 Laemmli32 에 따라 15 %SDS 붓고 (두께: 1.5 m m, 6.8 c m x 8.6 cm (폭 x 길이)) (표 2) 스태킹 젤 위의 4%의 얇은 레이어를 추가 하 고. 주의: SDS, 아크릴 아 미드와 TEMED는 유독 하 고 유해 합니다. 후드 밑 작업과 개인 보호 장비를 착용.</li>
	<li>SDS 젤에 equilibrated 젤 레인 전송 및 버퍼 bromophenol 블루 (그림 5)의 흔적으로 보충을 실행 1 x SDS에 0.5% (w/w) agarose 젤 커버.</li>
	<li>전자 레인지에 agarose 젤에 로드 이전 버퍼 실행 SDS를 끓인 다.</li>
	<li>단일 부품의 분자 무게를 추정 하는 단백질 마커를 실행, 삽입 젤의 한쪽 끝에 필터 종이 agarose 경화 될 때까지 또는 일반적으로 IPG 젤 사용 특별 한 빗을 사용 하 여.</li>
	<li>150 V 60 분 및 얼룩에 젤을 실행 콜 로이드 Coomassie, 실버 얼룩 또는 어떤 다른 젤 얼룩 메서드 이후 대량 spectrometric 분석에 적합.</li>
	<li>매트릭스 보조 레이저 탈 착/이온화 같은 대량 spectrometric 방법을 사용 하 여 보이는 단백질 반점 분석 시간의 비행 (TOF MALDI) 또는 LC-MS/MS 질량 분석. 참고: 우리는 콜 로이드 Coomassie 설명된33이미로 얼룩을 사용 하 여 것이 좋습니다. 우리의 손에 덜 풍부한 단백질 충분히 얼룩이 질 수 있다 고 합리적인 데이터 품질에 대 한 대량 spectrometric 분석을 수 있습니다.</li>
</ol>

<ol>
	<li>Kempers, R., van Bel, A. J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Symplasmic+connections+between+sieve+element+and+companion+cell+in+the+stem+phloem+ofVicia+faba+L.+have+a+molecular+exclusion+limit+of+at+least+10+kDa.">Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa.</a> Planta. 201 (2), 195-201 (1997).</li><li>Stadler, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+GFP-fusions+in+Arabidopsis+companion+cells+reveals+non-specific+protein+trafficking+into+sieve+elements+and+identifies+a+novel+post-phloem+domain+in+roots.">Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots.</a> Plant J. 41 (2), 319-331 (2005).</li><li>Imlau, A., Truernit, E., Sauer, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-to-cell+and+long-distance+trafficking+of+the+green+fluorescent+protein+in+the+phloem+and+symplastic+unloading+of+the+protein+into+sink+tissues.">Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues.</a> Plant Cell. 11 (3), 309-322 (1999).</li><li>Ostendorp, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+Brassica+napus+phloem+protein+and+ribonucleoprotein+complexes.">Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes.</a> New Phytol. 214 (3), 1188-1197 (2017).</li><li>Paultre, D. S. G., Gustin, M. -. P., Molnar, A., Oparka, K. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lost+in+Transit:+Long-Distance+Trafficking+and+Phloem+Unloading+of+Protein+Signals+in+Arabidopsis+Homografts.">Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts.</a> Plant Cell. 28 (9), 2016-2025 (2016).</li><li>Sali, A., Glaeser, R., Earnest, T., Baumeister, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+words+to+literature+in+structural+proteomics.">From words to literature in structural proteomics.</a> Nature. 422 (6928), 216-225 (2003).</li><li>Lin, M. -. K., Lee, Y. -. J., Lough, T. J., Phinney, B. S., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pumpkin+Phloem+Proteome+Provides+Insights+into+Angiosperm+Sieve+Tube+Function.">Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function.</a> Mol. Cell. Proteomics. 8 (2), 343-356 (2008).</li><li>Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+the+proteome+of+Brassica+napus+phloem+sap.">Towards the proteome of Brassica napus phloem sap.</a> Proteomics. 6 (3), 896-909 (2006).</li><li>Lucas, W. J., Yoo, B. C., Kragler, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+as+a+long-distance+information+macromolecule+in+plants.">RNA as a long-distance information macromolecule in plants.</a> Nat. Rev. Mol. Cell. Bio. 2 (11), 849-857 (2001).</li><li>Dinant, S., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sampling+and+Analysis+of+Phloem+Sap.">Sampling and Analysis of Phloem Sap.</a> Plant Mineral Nutrients. 953, 185-194 (2013).</li><li>Kennedy, J. S., Mittler, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Method+of+obtaining+Phloem+Sap+via+the+Mouth-parts+of+Aphids.">A Method of obtaining Phloem Sap via the Mouth-parts of Aphids.</a> Nature. 171 (4351), 528 (1953).</li><li>King, R. W., Zeevaart, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+Phloem+exudation+from+cut+petioles+by+chelating+agents.">Enhancement of Phloem exudation from cut petioles by chelating agents.</a> Plant Physiol. 53 (1), 96-103 (1974).</li><li>Alosi, M. C., Melroy, D. L., Park, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+regulation+of+gelation+of+Phloem+exudate+from+cucurbita+fruit+by+dilution,+glutathione,+and+glutathione+reductase.">The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase.</a> Plant Physiol. 86 (4), 1089-1094 (1988).</li><li>Dinant, S., Bonnemain, J. -. L., Girousse, C., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phloem+sap+intricacy+and+interplay+with+aphid+feeding.">Phloem sap intricacy and interplay with aphid feeding.</a> Comptes rendus biologies. 333 (6-7), 504-515 (2010).</li><li>Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Collection+and+analysis+of+Arabidopsis+phloem+exudates+using+the+EDTA-facilitated+Method.">Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method.</a> J Vis Exp. (80), e51111 (2013).</li><li>Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+a+modified+EDTA-mediated+exudation+technique+and+guttation+fluid+analysis+for+Potato+spindle+tuber+viroid+RNA+detection+in+tomato+plants+(Solanum+lycopersicum).">Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum).</a> J. Virol. Methods. 198, 75-81 (2014).</li><li>Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Macromolecular+composition+of+phloem+exudate+from+white+lupin+(Lupinus+albus+L).">Macromolecular composition of phloem exudate from white lupin (Lupinus albus L).</a> BMC Plant Biol. 11 (1), 36 (2011).</li><li>Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytokinins+in+the+Phloem+Sap+of+White+Lupin+(Lupinus+albus+L.).">Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.).</a> Plant Physiol. 94 (4), 1714-1720 (1990).</li><li>Yoo, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Systemic+Small+RNA+Signaling+System+in+Plants.">A Systemic Small RNA Signaling System in Plants.</a> Plant Cell. 16 (8), 1979-2000 (2004).</li><li>Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+small+RNAs+from+the+phloem+of+Brassica+napus.">Identification and characterization of small RNAs from the phloem of Brassica napus.</a> Plant J. 53 (5), 739-749 (2008).</li><li>Chalhoub, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genetics.+Early+allopolyploid+evolution+in+the+post-Neolithic+Brassica+napus+oilseed+genome.">Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome.</a> Science. 345 (6199), 950-953 (2014).</li><li>Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+several+mRNA+species+in+rice+phloem+sap.">Detection of several mRNA species in rice phloem sap.</a> Plant Cell Phys. 39 (8), 895-897 (1998).</li><li>Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+aphid+stylectomy+and+RT-PCR+for+the+detection+of+transporter+mRNAs+in+sieve+elements.">Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements.</a> J Exp. Bot. 53 (369), 631-637 (2002).</li><li>Ruiz-Medrano, R., Xoconostle-C&#225;zares, B., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phloem+long-distance+transport+of+CmNACP+mRNA:+implications+for+supracellular+regulation+in+plants.">Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants.</a> Dev. 126 (20), 4405-4419 (1999).</li><li>Sch&#228;gger, H., Cramer, W. A., von Jagow, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+molecular+masses+and+oligomeric+states+of+protein+complexes+by+blue+native+electrophoresis+and+isolation+of+membrane+protein+complexes+by+two-dimensional+native+electrophoresis.">Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis.</a> Anal. Biochem. 217 (2), 220-230 (1994).</li><li>Sch&#228;gger, H., von Jagow, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue+native+electrophoresis+for+isolation+of+membrane+protein+complexes+in+enzymatically+active+form.">Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form.</a> Anal. Biochem. 199 (2), 223-231 (1991).</li><li>Fiala, G. J., Schamel, W. W. A., Blumenthal, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue+native+polyacrylamide+gel+electrophoresis+(BN-PAGE)+for+analysis+of+multiprotein+complexes+from+cellular+lysates.">Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates.</a> J Vis Exp. (48), e2164 (2011).</li><li>Rais, I., Karas, M., Sch&#228;gger, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two-dimensional+electrophoresis+for+the+isolation+of+integral+membrane+proteins+and+mass+spectrometric+identification.">Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification.</a> Proteomics. 4 (9), 2567-2571 (2004).</li><li>Sch&#228;gger, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tricine-SDS-PAGE.">Tricine-SDS-PAGE.</a> Nature protocols. 1 (1), 16-22 (2006).</li><li>Wittig, I., Braun, H. -. P., Sch&#228;gger, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue+native+PAGE.">Blue native PAGE.</a> Nat Protoc. 1 (1), 418-428 (2006).</li><li>Eubel, H., Braun, H. -. P., Millar, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue-native+PAGE+in+plants:+a+tool+in+analysis+of+protein-protein+interactions.">Blue-native PAGE in plants: a tool in analysis of protein-protein interactions.</a> Plant Methods. 1 (1), 11 (2005).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Dyballa, N., Metzger, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+colloidal+coomassie+G-250+staining+for+proteins+in+polyacrylamide+gels.">Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels.</a> J Vis Exp. (30), (2009).</li><li>Turnbull, C. G. N., Lopez-Cobollo, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heavy+traffic+in+the+fast+lane:+long-distance+signalling+by+macromolecules.">Heavy traffic in the fast lane: long-distance signalling by macromolecules.</a> New Phytol. 198 (1), 33-51 (2013).</li><li>Hall, S. M., Baker, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+composition+of+Ricinus+phloem+exudate.">The chemical composition of Ricinus phloem exudate.</a> Planta. 106 (2), 131-140 (1972).</li><li>Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+protein+identity+from+sieve+element+sap+in+Ricinus+communis+L.+by+quadrupole+time+of+flight+(Q-TOF)+mass+spectrometry.">Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry.</a> J. Exp. Bot. 55 (402), 1473-1481 (2004).</li><li>Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomics+of+curcurbit+phloem+exudate+reveals+a+network+of+defence+proteins.">Proteomics of curcurbit phloem exudate reveals a network of defence proteins.</a> Phytochemistry. 65 (12), 1795-1804 (2004).</li><li>Walz, C., Juenger, M., Schad, M., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+the+presence+and+activity+of+a+complete+antioxidant+defence+system+in+mature+sieve+tubes.">Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes.</a> Plant J. 31 (2), 189-197 (2002).</li><li>Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phloem+sap+proteins:+their+identities+and+potential+roles+in+the+interaction+between+plants+and+phloem-feeding+insects.">Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects.</a> J Exp. Bot. 57 (4), 767-774 (2006).</li><li>Ham, B. -. K., Brandom, J. L., Xoconostle-C&#225;zares, B., Ringgold, V., Lough, T. J., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+polypyrimidine+tract+binding+protein,+pumpkin+RBP50,+forms+the+basis+of+a+phloem-mobile+ribonucleoprotein+complex.">A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex.</a> Plant Cell. 21 (1), 197-215 (2009).</li><li>Schamel, W. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotinylation+of+protein+complexes+may+lead+to+aggregation+as+well+as+to+loss+of+subunits+as+revealed+by+Blue+Native+PAGE.">Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE.</a> J. Immunol. Methods. 252 (1-2), 171-174 (2001).</li><li>Zhang, S., Sun, L., Kragler, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phloem-delivered+RNA+pool+contains+small+noncoding+RNAs+and+interferes+with+translation.">The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation.</a> Plant Physiol. 150 (1), 378-387 (2009).</li></ol>

저자는 공개 없다.

체 관 부는 높은 관심의 구획 때문에 photoassimilates에 대 한 주요 수송 경로 구성 하 고 또한 다른 식물 부속9,20,34, 사이 장거리 신호를 위해 근본적 이다 35. 작은 분자 뿐만 아니라 RNAs 단백질 같은 고분자와 체 관 부 유지 보수 신호4,7,8연루 되었습니다. 체 관 부 구성의 분석 대부분의 식물 종에서 체 관 부 샘플에 제한 접근에 의해 제한 됩니다. 곤충 stylet 기술을 광범위 하 게 적용 하지만 실험적 요구 이며 체 관 부 샘플11의 매우 작은 양의 결과. 1 개의 쉬운 기술은 체 관 부 샘플링에 사용 되는 EDTA 촉진 나옴12입니다. EDTA 칼슘 같은 divalent 이온 chelates을 따라서 P 단백질 및 callose로 체 번호판의 폐쇄. 그것은 사용 하기 쉬운, 그러나 손상 된 세포에 의해 오염 하는 경향이 고 샘플 희석. EDTA에 의해 divalent 이온을 없애고 기존 단지의 분석 또한 발생할 수 있습니다. 그러나, 그것은 다양 한 모델 공장 A. thaliana15를 포함 하 여 종에서에서 샘플링이 있습니다. 체 관 부 수액의 자발적인 나옴만 종의 식물의 작은 수에서 발생합니다. 식물 조직10의 중요 한 상해를 포함 하는 침략 적 방법입니다. 우리는 최근 장거리 전송4,8,20공부 모델 종족으로 B. napus 를 설립. 여기, 체 관 부 수액 샘플링할 수 있다 수 작은 절 개에서 부상 효과 오염의 소스를 감소 시키는.
다른 샘플링 기법을 사용 하 여, 다양 한 식물 종에서 체 관 부 샘플의 프로테옴에 최근 몇 년 동안7,8,17,,3637, 조사는 38,39. 이러한 프로테옴 연구에 대 한 단백질 추출 되었고 조건을 변성 시키기에서 시 켰 던 따라서 단백질: 단백질 및 단백질에 대 한 결론을 허용 하지 않습니다: 핵 산 상호 작용 기본 조건 제시. 공동-immunoprecipitation (CoIP) 및 오버레이 분석 표시 주요 ribonucleoprotein 복잡 한 호박40, 체 관 부 수액에 있을 수 있지만 어떤 고분자 복합물 내의 기본 조건에서 존재 증명 되지 이었다는 체 관 부 시스템입니다.
Schägger 그 외 여러분 에 의해 도입 된 블루 기본 페이지 26, 후속 고해상도 젤 전기 이동 법 단계와 함께에서 큰 단백질 복합물의 개별 구성 요소 분리 가능 네이티브 B. napus 의 3D 페이지 분석을 사용 하 여 체 관 부 exudate, 우리 수 최근 보여 여러 높은 분자 무게 단백질: 단백질과 RNP 단지 체 관 부 샘플에 존재 하며 효소 활성화4. 크기 배제 크로마토그래피 같은 단백질 복합물 뿐만 아니라 RNPs를 분리 하는 다른 방법 존재, 하지만 억 페이지에 비해 해상도 관점에서 실패 수 있습니다. 또한, 복잡 한 분리의 합리적인 품질, 크기 배제 열 매트릭스 조사 되 고 전반적으로 복잡 한 분자 무게에 따라 적용할 수 있다. 다른 크기의 단지 분석 따라서 다른 유형의 비용을 집중 하 고 억 페이지로 초점 고성능으로 허용 하지 않는 열을 요구할 것 이다.
B. napus 에서 단지 분석 하 중요 한 단계는 시작 물자로 사용 하는 체 관 부 sap의 총 금액을 포함 합니다. 체 관 부 샘플의 적어도 600 µ L 필요 하 고 5 개의 잘 물결 무늬가 있는 식물에서 얻을 수 있습니다. 3D 페이지 및 BN 북부 blotting에 대 한 체 관 부 샘플의 충분 한 양의 초기 비 엔 젤을 시작할 필요가 있다. 이를 위해, 체 관 부 샘플은 집중 잘하고 적어도 20 ~ 30 µ g 단백질의 각에 로드할 수 있습니다 때까지 동일한 샘플의 triplicates을 동시에 실행 됩니다. 너무 낮거나 너무 높은 농도 단지 (그림 3)의 탐지를 줄일 수 있습니다. 체 관 부 샘플 필요 얼음에 반응 튜브에 수집 되며 단백질 저하와 회전율을 피하기 위해 나중에 사용 하기 위해 냉동 저장 한다. 프로 테아 제 저 해제 분석 하 고, 모든 체 관 부 proteomes에서 발견 되었습니다 하지만 또한 완전히 활성 프로테아좀 B. napus4의 체 관 부에 설명 했다. 또한, 볼륨 및 체 관 부 샘플의 구성 샘플링 시간-포인트와10환경 조건 따라 다릅니다. 따라서 유사한 조건 하에서 하루 중 같은 시간에 수집을 배려를가지고 한다. 스트레스 치료 (예: 가뭄) 수집 수 체 관 부의 양을 줄일 수 있습니다. 식별 하려면 단일 단백질 질량 분석에 의해, 제한 가능한 각 질 오염 입고 장갑 항상 필수입니다. 각 질과 질량 spec 분석 중 추가 신호 리드 저해 단백질 식별. 더 높은 전압 또는 온도에 10 억 페이지를 실행 깨지기 쉬운 단지의 분해 될 수 있는 젤의 열 발생할 수 있습니다.
여기에 제시 된 프로토콜은 단백질: 단백질 복합물의 분석에 적합 합니다. 우리는 또한 동시에 단지에 포함 된 특정 RNAs를 감지 하 사용할 수 있습니다 보여줍니다. 이를 위해, 우리는 최근 북부 blotting410 억에 대 한 프로토콜 도입. RNAs는 RNAse 오염에 의해 저하 하는 경향이 있다. 이러한 성능 저하를 제한 하려면 DEPC 처리, 물 사용 되어야 한다.
제시 방법의 주요 제한 포함 마이그레이션 동작 따라 크기, 모양에 그리고도 단지31의 posttranslational 수정 이후 억 페이지를 구분 하는 단백질 복합물의 분자량의 추정 41. RNP 복합물의 크기 추정은 마이그레이션 동작에 핵 산의 영향으로 훨씬 더 복잡 합니다. 그것은 또한 하지 막을 수 있습니다 단지 같은 크기의 공동 한 하나의 밴드에서 마이그레이션할. 이 복잡 한 구성의 잘못 된 예측 발생할 수 있습니다. 따라서 상호 보완적인 기술로 관찰 된 상호 작용을 확인, 예를 들어 기능 분석 실험4, 필요할 수 있습니다. 또한 단백질만 약하게 또는 뚜렷이 고분자 복합체에 관련 된 사용 BN 버퍼에서 손실 될 수 있습니다. 이 방지 하려면 샘플 가교 화, 부작용으로 이어질 수 있습니다 무엇 또는 단백질 식별을 방지할 수 있습니다 또는 버퍼 상태를 최적화할 수 있습니다.
클래식 2D-페이지, 달리의 요소 및 SDS 페이지 hydrophobicity 및 전자 점 (pI) 및 분자량 28, 대신 분자량에 따라 분리 수 있습니다 조합과 단백질의 분리를 제한 하지 않는 한 특정 pI 범위입니다. 클래식 비슷한 2D 페이지, 분리 단백질 단일 관광 명소를 볼 수 있지만 대각선에 선 4,28 (, 그림 5 그림 6). 반면에 친수성 단백질 더 선28아래 찾을 수 있습니다 더 많은 소수 성 단백질이이 대각선 위의 관광 명소에 나타납니다. 이 프로토콜에 사용 된 polyacrylamide 농도 사이 25 ~ 80 kDa 단백질 잘 별도 것입니다. 작은 또는 큰 단백질의 분리는 polyacrylamide 있도록 농도 변화 될 수 있다 또는 그라데이션 젤 3 차원에서 사용할 수 있습니다. 3D-페이지 (그림 6)으로 구분 된 복잡 한 IV (그림 3)의 구성 요소, 트립 신, 소화 및 질량 분석에 의해 분석 밖으로 절단. 이 결과 여러 tRNA ligases의 식별. 다른 단지의 구성 요소 되었습니다 4최근 출판. 우리의 3D 페이지는 다른 ligases, 즉 aspartate, 아스파라긴, 트레오닌, 라이 신, 글리신 ligases, 유사한 분자 무게 (표 3)와 분리를 사용할 수 있습니다. 우리 복잡 한 4 내에서 잠재적으로 바인딩된 tRNA를 감지할 수 메티오닌 tRNA 전용 프로브를 사용 하 여, 하지만 전체 길이 tRNA 또는 tRNA 조각 복잡 한에 있는 경우 사용 하는 프로브와 차별 수 없습니다. 핵 산 단지 내에 정말 바인딩된와 공동 마이그레이션 있다면, 프로 테아 제 소화 체 관 부 수액 확인을 샘플 수 있습니다 적합 한 마이그레이션 컨트롤 역할을 합니다.
그것은 거의 대부분의 구성 요소는 전체 리보솜으로 신장 요인의 체 관 부 샘플4,7에서 발견 되었습니다 이후 단백질 번역 체 관 부 체 튜브 내에서 발생할 수 있습니다 이전 추측 하고있다. TRNA와 tRNA ligases의 우리의 발견이이 아이디어를 지 원하는 것으로 보인다. 그러나, tRNA 조각 호박에서 체 관 부 샘플에 존재는 번역42 의 강력한 억제제로 표시 되었습니다 그리고 기능적인 리보솜4, 번역 자리를 차지할 수 없는 제안에 결 석 것 같다.
함께 찍은, 여기에 제시 된 프로토콜 기본 단백질: 단백질 및 체 관 부 샘플 및 분리에서 심지어 RNP 복합물의 분리 및 높은 해상도 가진 그들의 개별 부품의 식별 수 있습니다. 이 방법의 응용 프로그램 소설 단백질 및 체 관 부 샘플에서 RNP 단지 검색 하 고 따라서이 고도로 전문화 된 공장에 새로운 기능을 명료 하 게 수 있습니다.

체 관 부의 장거리 도관 더 높은 식물에 있는 유기 양분의 할당에 대 한 필수적입니다만 또한 성장 및 개발, 병원 체 방어 및 불리 한에 적응에 대 한 중요 한 많은 다른 프로세스를 규제에 참여 환경 조건입니다. 이온, phytohormones, 또는 스스로 대사 산물과 같은 작은 이펙터, 게다가 RNAs 단백질 같은 고분자는 잠재적인 신호도 최근 등장 했습니다.
연구는 단백질의 체 관 부 로드 크기 및 동반자 셀 (CC) 연결 기 공 plasmodesmal 단위의 크기 제외 제한 (SEL)에 의해 제어 요소 (SE)에 10의 범위에 일반적으로 있는 체 하 고 > 67 kDa1 , 2 , 그러나 3., 이러한 크기 제한이 더 큰 단백질 및 단백질에도 불구 하 고 단지 크기 제외4의 아이디어에 도전 하는 체 관 부 시스템 내에서 발견 되었습니다 그리고 se CC에서 단백질도 일반적인 손실 되었습니다 제안된5 .
큰 뿐 아니라 multiprotein ribonucleoprotein 단지6셀 구조적 무결성을 유지 하 고 생 합성에 중추적인 역할을 한다. 체 관 부-모바일 단백질-단백질 및 ribonucleoprotein 단지4,7, 존재 증거가 있다 하지만 날짜 그들의 기능에 대 한 약간은 알려진 다. 체 관 부 체 요소에서 단백질: 단백질과 RNP 단지 장거리 전송 및/또는 신호8,9연루 되었습니다. 환경 변화에서 그들의 구성 공부 translocated 단지의 기능을 해명 하거나 스트레스 조건이 필요 합니다. 이 위해 네이티브 단지 고립 되 고 그들의 구성 요소는 충분 한 해상도로 분리 될 필요가.
높은 분자 무게 단지는 체 관 부를 분리, 그것은 충분 한 품질 및 수량에 sap 샘플을 얻기 위해 첫 번째 필요. 체 관 부 샘플링에 사용할 수 있는 기술 관심의 식물 종에 따라 달라 집니다. 체 관 부 수액을 얻기 위해 세 가지 주요 방법 존재 10: 곤충 stylectomy11, EDTA 촉진 나옴12, 그리고 자발적인 있고13.
애기 thaliana (A. thaliana), 실험실, 전세계의 주요 모델 공장에서에서 체 관 부 샘플만 EDTA 용이 있고 또는 진딧물 stylectomy,1415에 의해 얻어질 수 있다. 두 방법 모두 매우 희석된 체 관 부 수액 또는 매우 낮은 샘플 금액으로 이어질. EDTA 용이 있고 또한 오염 하는 경향이 하 고 실제 체 관 부 구성16를 나타내지 않을 수 있습니다. 자연 체 관 부 나옴 어디 공장 부품을 잘라 쉽게 수집된13,,1718수 있는 체 관 부 수액의 자발적 방출에 리드, cucurbits, 르 피나 스 또는 유카, 같은 종 식물로 제한 됩니다. 19. 우리는 최근 체 관 부 분석을 위한 적합 한 모델 시스템으로 oilseed 강간 (브라 시카 napus)를 설립, 이후 A. thaliana 의 가까운 친척 및 체 관 부 수액의 여러 microliters 표시 되어 작은 절 개에서 얻을 수 있습니다. 고 순도4,,820의 수 있습니다. 또한, B. napus 게놈 시퀀스 201421에 릴리스 되었습니다.
진딧물 stylectomy 제외한 모든 체 관 부 수집 방법 설명 샘플링, 사이트에서 조직 주변의 손상 포함 하 고 체 관 부 수액의 구성은 부상에 대 한 응답에서 변경 될 수 있습니다. 따라서 샘플링 방법 적용에 체 관 부 샘플의 품질을 확인 하려면 필수적입니다. 예: RNase 활동22,23, Rubisco8,24에 대 한 뇌관으로 RT-PCR 또는 설탕의 분석의 결정에 의해 수집 된 체 관 부 수액의 품질 관리를 위한 다른 방법이 있다 컴포지션8.
크기 배제 크로마토그래피, 자당 밀도 ultracentrifugation, 또는 명백한 분자량 커트로 세포 막을 통해 여과 샘플을 포함 하 여 격리 하 고 분리 단백질 단지 다른 방법을 적용할 수 있습니다 오프. 그러나, 이러한 접근은 높은 해상도 허용 하지 않습니다. 라는 블루 기본 페이지 (비-), Schägger 외에의해 처음으로 설명 하는 기법. 25, 해상도 측면에서 우량 하다. 그것은 성공적으로 다양 한 세포 또는 세포 lysates 및 그들의 상대 나타났는데26,27큰 네이티브 단백질 복합물의 분자 무게를 결정 하기 위해 사용 되었다.
더 명료 단백질 복합물의 복잡 한 구성, 그것은 복잡 한 부품의 완전 한 해체로 이어지는 조건을 변성 시키기에서 개별 구성 요소를 분리 하는 데 필요한. 이 더 높은 해상도, 전자 초점 (IEF)의 두 번째 차원으로 SDS 페이지30 의 third dimension와의 후속 식별을 달성 하기 위해, 또는 SDS 페이지 28,29 의 두 번째 차원에 의해 달성 될 수 있다 단백질 질량 분석을 사용 하 여입니다.
이 프로토콜에서 순수 체 관 부 수액 B. napus 식물에서의 샘플링 및 트리 스-Tricine-우 레 아-페이지와 SDS 페이지 BN-페이지를 결합 하는 3D 전기 이동 방식을 사용 하 여 이러한 체 관 부 샘플에서 단백질 복합물의 분석을 설명 합니다. 분리 된 단백질 복잡 한 구성 요소는 이후 질량 분석을 사용 하 여 식별 됩니다. 또한, 소개 블루 네이티브 북부 blotting 큰 RNP 단지4, RNAs의 탐지를 허용 하는 방법으로는 접근의 적용을 확장 합니다.

<table><tbody><tr><td>1.5 mL reaction tubes</td><td>Eppendorf</td><td>30120086</td><td></td></tr><tr><td>10 well comb for SDS PAGE, thickness 1 mm</td><td>BioRad</td><td>1653359</td><td></td></tr><tr><td>2-Propanol</td><td>AppliChem</td><td>131090</td><td></td></tr><tr><td>30 % Acrylamide-bisacrylamide solution (29:1) solution</td><td>BioRad</td><td>1610156</td><td></td></tr><tr><td>30 % Acrylamide-bisacrylamide solution (37.5:1) solution</td><td>BioRad</td><td>1610158</td><td></td></tr><tr><td>96 % Ethanol</td><td>Carl Roth</td><td>P075</td><td></td></tr><tr><td>Acetic acid</td><td>Carl Roth</td><td>6755</td><td></td></tr><tr><td>Agarose</td><td>Lonza</td><td>50004</td><td></td></tr><tr><td>Aluminum sulfate-(14-18)-hydrate</td><td>AppliChem</td><td>141101</td><td></td></tr><tr><td>Ammonium peroxodisulfate (APS)</td><td>Carl Roth</td><td>9592.3</td><td></td></tr><tr><td>Bis-Tris</td><td>AppliChem</td><td>A3992</td><td></td></tr><tr><td>Boric acid</td><td>AppliChem</td><td>A2940</td><td></td></tr><tr><td>Bromophenol blue</td><td>AppliChem</td><td>A2331</td><td></td></tr><tr><td>Centrifugal concentrators &lt;em&gt;e.g.&lt;/em&gt; Vivaspin 500 (Mwco 10 kDa)</td><td>Sartorius</td><td>VS0102</td><td></td></tr><tr><td>Chemiluminescent Nucleic Acid Detection Module Kit</td><td>Thermo Fisher Scientific</td><td>89880</td><td></td></tr><tr><td>Chromatography papers &lt;em&gt;e.g.&lt;/em&gt; 3 mm CHR</td><td>Whatman</td><td>3030-153</td><td></td></tr><tr><td>CoolBox M30 System</td><td>Biocision</td><td>BCS-133</td><td></td></tr><tr><td>Coomassie brilliant Blue G-250</td><td>AppliChem</td><td>A3480</td><td></td></tr><tr><td>Diethyl pyrocarbonate (DEPC)</td><td>AppliChem</td><td>A0881</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>AppliChem</td><td>A1101</td><td></td></tr><tr><td>DNase I</td><td>AppliChem</td><td>A3778</td><td></td></tr><tr><td>Ethanol abs.</td><td>AppliChem</td><td>A3693</td><td></td></tr><tr><td>Ethylenediaminetetraacetic acid (EDTA)</td><td>AppliChem</td><td>A1103</td><td></td></tr><tr><td>Gel Imaging system &lt;em&gt;e.g.&lt;/em&gt; Chemidoc Touch</td><td>BioRad</td><td>1708370</td><td></td></tr><tr><td>GeneRuler 1kb plus</td><td>Thermo Fisher Scientific</td><td>SM1331</td><td></td></tr><tr><td>Glycerol</td><td>AppliChem</td><td>141339</td><td></td></tr><tr><td>Glycine</td><td>AppliChem</td><td>131340</td><td></td></tr><tr><td>Heating block TS1</td><td>Biometra</td><td>846-051-500</td><td></td></tr><tr><td>Hybridization oven &lt;em&gt;e.g.&lt;/em&gt; GFL Hybridization Incubator 7601</td><td>GFL</td><td>7601</td><td></td></tr><tr><td>Hypodermic needle (0.8 mm)</td><td>B Braun</td><td>4658309</td><td></td></tr><tr><td>IPG gel comb, thickness 1 mm</td><td>BioRad</td><td>1653367</td><td></td></tr><tr><td>Labeling of RNA &lt;em&gt;e.g.&lt;/em&gt;Biotin 3&#039;end DNA Labeling Kit</td><td>Thermo Fisher Scientific</td><td>89818</td><td></td></tr><tr><td>Native gradient gel &lt;em&gt;e.g.&lt;/em&gt; Novex NativePAGE 4&amp;ndash;16% Bis-Tris protein gel</td><td>Invitrogen</td><td>BN1002BOX</td><td></td></tr><tr><td>Nylon membrane &lt;em&gt;e.g.&lt;/em&gt; Hybond-N+</td><td>Amersham Pharmacia</td><td>RPN203B</td><td></td></tr><tr><td>Ortho-phosphoric acid</td><td>Carl Roth</td><td>6366.1</td><td></td></tr><tr><td>PageRuler prestained protein ladder</td><td>Thermo Fisher Scientific</td><td>26616</td><td></td></tr><tr><td>Power supply for Gel electrophoresis EPS</td><td>Amersham Pharmacia</td><td>18-1130-01</td><td>available from GE Healthcare</td></tr><tr><td>RNA Cleanup Kit</td><td>Qiagen</td><td>74204</td><td></td></tr><tr><td>Semi dry blot &lt;em&gt;e.g&lt;/em&gt;. Fastblot 43B semi dry Blot</td><td>Biometra</td><td>846-015-100</td><td></td></tr><tr><td>Sodium chloride (NaCl)</td><td>AppliChem</td><td>A1149</td><td></td></tr><tr><td>Sodium dodecyl sulfate (SDS)</td><td>AppliChem</td><td>142363</td><td></td></tr><tr><td>Synthesis of cDNA &lt;em&gt;e.g.&lt;/em&gt; RevertAid First Strand cDNA Synthesis Kit</td><td>Thermo Fisher Scientific</td><td>K1621</td><td></td></tr><tr><td>Tetramethylethylenediamine (TEMED)</td><td>AppliChem</td><td>A1148</td><td></td></tr><tr><td>Tricine</td><td>AppliChem</td><td>A3954</td><td></td></tr><tr><td>Tris</td><td>AppliChem</td><td>A1086</td><td></td></tr><tr><td>Tri-sodium citrate dihydrate</td><td>AppliChem</td><td>A3901</td><td></td></tr><tr><td>TRIzol Reagent</td><td>Thermo Fisher Scientific</td><td>15596026</td><td></td></tr><tr><td>ULTRAhyb Ultrasensitive Hybridization Buffer</td><td>Thermo Fisher Scientific</td><td>AM8670</td><td></td></tr><tr><td>Urea</td><td>AppliChem</td><td>A1360</td><td></td></tr><tr><td>UV Crosslinker &lt;em&gt;e.g.&lt;/em&gt; Stratalinker 2400</td><td>Agilent</td><td>NC0477671</td><td>from Fisher Scientific</td></tr><tr><td>Vertical electrophoresis apparatus &lt;em&gt;e.g.&lt;/em&gt;The XCell SureLock Mini-Cell or Mini-Protean III System</td><td>Thermo Fisher Scientific or BioRad</td><td>EI0001 or 1658004</td><td></td></tr><tr><td>Wipers &lt;em&gt;e.g.&lt;/em&gt; KIMWIPES Delicate Task Wipers</td><td>Kimberly-Clark</td><td>34120</td><td></td></tr></tbody></table>

phloem sap sampling from brassica napus for 3d-page of protein and ribonucleoprotein complexes

더 높은 식물의 체 관 부를 샘플링은 종종 힘들고 식물 종에 크게 의존입니다. 그러나, 변성 시키기 조건에서 프로테옴 연구 다른 식물 종에 달성 될 수 있었다. 네이티브 단백질: 단백질과 단백질: 체 관 부 샘플에서 핵 산 단지 아직 부족 하 게 분석 된, 하지만 그들은 수도 있습니다 중요 한 역할을이 전문된 구획의 유지 보수 또는 장거리 신호. 큰 분자 어셈블리 블루 기본 젤 전기 이동 법 (BN-페이지)를 사용 하 여 격리 된 수 있습니다. 후속 나트륨 라우릴 황산 염 (SDS-페이지)에 의해 그들의 단백질 구성 요소를 분리할 수 있습니다. 그러나, 유사한 분자 무게 단백질 공동 마이그레이션, 무슨 질량 분석에 의해 단백질 식별을 방해 수 있습니다. 두 개의 다른 변성 젤 전기 이동 법 단계, 즉 트리 스-Tricine-요소 및 SDS 페이지 BN-페이지 조합 그들의 화란/hydrophobicity에 따라 단백질의 추가 분리를 가능 하 게 하 고 따라서 해상도 성공 증가 단백질 식별. 그것은 심지어 posttranslational 수정만 다른 단백질을 구별 수 있습니다. 또한, 블루 네이티브 북부 blotting 고분자 복합물의 RNA 구성 요소를 식별 하기 위해 적용할 수 있습니다. 우리는 우리의 프로토콜 단백질 및 RNA 구성 요소 네이티브 단백질: 단백질 및 체 관 부 샘플에서 발생 하는 ribonucleoprotein (RNP) 단지의 해명 하기 적합 하다는 것을 보여줍니다. 파란색을 결합 하 여 두 개의 다른 변성 페이지 단계 기본 페이지 큰 단백질 복합물의 다른 종류를 구분 하는 데 도움이 수 있습니다 그리고 또한 질량 분석에 의해 그들의 구성 요소 식별 증가 속도 수 있습니다. 또한, 프로토콜은 동시에 단일 단백질 복합물 내의 잠재적으로 바인딩된 핵 산을 검출 하기 위하여 충분히 강력한입니다.

여기에 우리가 단백질: 단백질의 분석을 허용 하는 프로토콜을 현재 브라 시카 napus에서 체 관 부 샘플에서 단백질: RNA 복합물 뿐만 아니라. 흐름은 그림 1에 나와 있습니다. 다른 모델 유기 체 이상 B. napus 의 주요 장점 중 하나는 화 서 줄기에 작은 구멍에서 상대적으로 쉽게 체 관 부 샘플 컬렉션의 가능성입니다. 이 대 등 하 게 많은 양의 순수한 체 관 부 샘플을 얻을 수 있습니다. 체 관 부를 샘플링 때 그것은 항상 RT-PCR8예, 오염에 대 한 확인 하는 것이 좋습니다. 순수 체 관 부 샘플에서 얻은 대표적인 결과 그림 2에 묘사 된다. 비 오염 체 관 부 샘플 rubisco와 꽃가루 외 투 단백질에 대 한 신호가 나타납니다 반면 thioredoxin h에 대 한 보이는 밴드를 표시 합니다. Rubisco 작은 소 단위 잎, 샘플에서 컨트롤로 사용할 수 있습니다 화 서 줄기 또는 꽃가루. 꽃가루 외 투 단백질 대 본만 꽃 새싹 샘플에 표시 되어야 하는 동안 그것의 mRNA의 다른 종, 체 관 부에 발견 되었습니다 이후 Thioredoxin h 모든 샘플에서 감지 해야 합니다. 오염 체 관 부 샘플링 완전히 꽃 식물 (화분 외 투 단백질) 또는 체 관 부 샘플링 구멍에서에서 첫 번째 방울 제대로 삭제 하지 때 수행 하는 경우 발생할 수 있습니다 (rubisco).
BN 페이지 이전 체 관 부 수액 집중 필수입니다. 잘 당 단백질의 20 ~ 30 µ g를 사용 하 여, 적어도 4 개의 주요 단백질 복잡 한 악대 표시 되 고 비 엔-페이지의 B. napus 체 관 부 수액, 너무 낮은 후 또는 너무 높은 농도 단지 (그림 3)의 명확한 분리를 허용 하지 않습니다. 2 차원 젤 다운스트림 처리 및 후속 대량 spectrometric 식별에 대 한 각 단일 복잡 한에서 단백질을 더 집중에 한 단일 주머니에 같은 복잡 한을 대표 하는 여러 젤 밴드를 로드 하는 것이 좋습니다.
체 관 부 고분자 복합물의 개별 구성 요소를 식별 하려면 우리 초기 BN-페이지 2 차원 트리 스-Tricine-요소와 함께 결합 하 고 3 차원 단일 단백질의 분리를 달성 하기 위해 SDS 페이지. 여기, 때문에 다른 단백질 마이그레이션 동작 요소에 SDS 페이지 젤 높은 해상도와 분리를 관찰할 수 있습니다. 일반적으로, 단일 복잡 한에 속하는 단백질 젤에서 대각선으로 볼 수 있을 것입니다. 반면 단백질 선 아래 대표 더 많은 친수성 사람28 (그림 5, 그림 6)이이 선 위에 단백질 증가 hydrophobicity, 있다.
RNP 단지의 특성화, BN 페이지 젤 부분의 BN 북부 blotting 수행을 사용 했습니다. UV 방사선에 의해 나일론 막과 가교에 전체 레인의 blotting 후 RNA RNA 관련 프로브를 사용 하 여 그림 4에서 볼 수 있듯이 구상 수 있다. 여기 특정 tRNA는 한 특정 단지에만 표시 됩니다. 이 tRNA 바인딩 복합물의 단백질 구성 요소는 위에서 설명한 3D 젤 방식을 사용 하 여 추가 조사 수 있습니다. 대량 spectrometric 분석이 복잡이 한 무엇 BN 북부 blotting에 의해 발견 하는 tRNA 바인딩 활동 확인 주로 tRNA ligases 포함 했다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57097/57097fig1.jpg"> 그림 1: oilseed 강간의 체 관 부 수액에서 ribonucleoprotein 복합물의 분석의 흐름을 일. 샘플링 및 체 관 부 샘플의 준비, 후 BN 페이지 네이티브 단지를 별도로 수행 됩니다. 이러한 비 엔 페이지 젤 수 BN 북부 blotting에 의해 핵 산의 병렬 분석 및 질량 분석에 의해 복합물의 단백질 구성 요소 식별. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57097/57097fig2.jpg"> 그림 2: 체 관 부 수액 B. napus의 샘플링 및 순도 제어. 메 마른 피하 주사와 8 10 주 오래 된 oilseed 강간 식물의 꽃이 핌 줄기를 puncturing 후 exudate는 피 펫으로 수집 되 고는 얼음 처럼 차가운 반응 관 (a) RT-PCR 수행 체 관 부 샘플의 순도 확인로 전송 증폭 thioredoxin h, rubisco 작은 소 단위, 및 조직 관련 샘플 (b) RT-PCR 역전사 없이에서 꽃가루 외 투 단백질의 사본 제어 (-)으로 수행 되었다. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57097/57097fig3.jpg"> 그림 3: BN 페이지. 집중된 체 관 부 샘플 블루 기본 페이지의 도식 표현 B. napus. (a) 후 집중된 체 관 부 수액의 15-20 µ L로 그라데이션 단백질 젤 로드, BN 페이지 1 x 다크 블루 음극 버퍼 B 150 V 추운 방에 20-30 분 수행 됩니다. 그리고 버퍼 1 x 라이트 블루 음극 버퍼 B/10에 대 한 교환 페이지는 젤 전면 실행을 실행 하는 진한 파란색까지 150 V 120-180 분에 완료 되. BN 페이지 젤 4 가지 밴드를 대표 하는 4 개의 다른 높은 분자 무게 단지 표시. (b) 너무 작은 (c) 또는 (d) 체 관 부 단백질 너무 많이 로드 개별 단지의 가시성을 줄일 수 있습니다. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57097/57097fig4.jpg"> 그림 4: BN 북부 더럽혀. 북부 방법 blotting BN의 도식 적인 표현입니다. (BN-페이지의 a)는 레인 blotting 세미 드라이 하 여 나일론 막에 전송 됩니다. 자외선 가교 및 사전 교 잡, 후 막 RNA 특정 프로브 (여기는 메티오닌 tRNA 관련 조사), 밤 동안 3'-끝에 교 잡 오븐에서 biotinylated는 인 큐베이 팅. 무료 프로브 단계 세척 하 여 제거 되 고 RNA의 검출 streptavidin HRP 켤레와 luminol에 의해 수행 됩니다. 이 방법을 사용 하 여, 복잡 한 4 억 페이지에서 메티오닌을 포함 관찰 tRNA. (b) Coomassie 스테인드 젤과 tRNA 오 닮은 마이그레이션 차이 피하기 위해 병렬로 실행 하는 두 개의 다른 젤 레인. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57097/57097fig5.jpg"> 그림 5: 3D 페이지. 3D 페이지 접근의 도식 적인 표현입니다. 같은 단지에서 여러 밴드 BN 페이지 젤에서 excised, 버퍼 로드 incubated 되며 2 차원 트리 스-Tricine-우 레 아-페이지의 한 우물으로 전송. 전기 이동 법, 후 전체 젤 레인 잘라, 산 성 산 성 버퍼에서 세척, equilibrated, 있으며 15 %SDS 페이지 젤에 배치. 3 차원 페이지 후 분리 된 단백질 Coomassie 스테인드 및 질량 분석에 의해 분석 됩니다. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57097/57097fig6.jpg"> 그림 6: 대표 결과 3D 페이지 후. 첫 번째 차원 BN 페이지 내에서 여러 단지 나타났다. 그들의 단백질 구성 요소 결과 대각선 자리 패턴에 두 후속 변성 페이지에 추가 구분 수 있습니다. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>프로브</td>
			<td>시퀀스</td>
		</tr>
<tr>
<td>Thioredoxin h</td>
			<td>
 앞으로: CTCAAGGCAGCCAAAGAATC 역: ATGGCCTGAACATCGAACTC</td>
		</tr>
<tr>
<td>Rubisco 작은 사슬</td>
			<td>
 앞으로: TTCACCGGCTTGAAGTCATC 역: CCGGGTACTCCTTCTTGCAT</td>
		</tr>
<tr>
<td>화분 외 투 단백질 BRU77666</td>
			<td>
 앞으로: TCAGAACTGGAGCTTCAACG 역: TTCCTTAATGGCCTCAGTGG</td>
		</tr>
</tbody></table>표 1: 체 관 부 샘플 순도 제어에 사용 되는 뇌관. 체 관 부 샘플 순도 확인 rubisco 작은 사슬, thioredoxin h 및 꽃가루 외 투 단백질을 위한 특정 뇌관 cDNA 증폭에 사용할 수 있습니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>버퍼 및 솔루션</td>
			<td colspan="2">콘텐츠</td>
			<td>댓글</td>
		</tr>
<tr>
<td>다크 블루 음극 버퍼 B</td>
			<td colspan="2">15mm 두번째-트리 스 pH 7.0 50 mM Tricine 0.02% (w/v) Coomassie 파란 G250</td>
			<td>제조 법은 Fiala 외. 17 에서 적응 7.0에 pH는 조정 한다 10 배 재고 버퍼를 만들 수 있습니다.</td>
		</tr>
<tr>
<td>라이트 블루 음극 버퍼 B/10</td>
			<td colspan="2">15mm 두번째-트리 스 pH 7.0 50 mM Tricine 0.002% (w/v) Coomassie 파란 G250</td>
			<td>버퍼는 음극 버퍼 B Coomassie 없이 음극 버퍼를 diluting 하 여 준비 될 수 있다</td>
		</tr>
<tr>
<td>양극 버퍼</td>
			<td colspan="2">
 50mm 두번째-트리 스 pH 7.0</td>
			<td>버퍼 재고 솔루션 x 10으로 준비 될 수 있다</td>
		</tr>
<tr>
<td>SDS 샘플 버퍼 x 2</td>
			<td colspan="2">
 125 mM Tris HCl pH 6.8 4% SDS 20% 글리세롤 0.2 M DTT 0.02% (w/v) bromophenol 블루</td>
			<td></td>
		</tr>
<tr>
<td>전송 버퍼 1 버퍼 x TBE</td>
			<td colspan="2">
 89 mM Tris pH 7.6 89 m m 붕 2 mM EDTA</td>
			<td>TBE 버퍼 만든 고 5 배 또는 10 x 주식으로 저장 될 수 있습니다. 사용 RNase 자유 이온된 물에 중요 하다.</td>
		</tr>
<tr>
<td>SSC 버퍼 x 2</td>
			<td colspan="2">
 300 mM NaCl 30 m m 나3시트르산 pH 7.0</td>
			<td></td>
		</tr>
<tr>
<td>젤 버퍼 x 3</td>
			<td colspan="2">
 3 M 트리 1 M HCl 0.3% SDS pH 8.45</td>
			<td>Schägger 19 에서 적응 하는 레시피
</td>
		</tr>
<tr>
<td>트리 스 Tricine 젤 솔루션 A</td>
			<td colspan="2">
 10 ml: 30% 아크릴-bisacrylamide (29: 1) 3.34 mL 6 M 요소 3 배 젤 버퍼 3.34 mL 70% 글리세롤 1.4 mL ddH2O 10 mL을 추가 10% APS 40 Μ L TEMED 4 Μ L</td>
			<td>무게 6 M 요소와 3 배 젤 버퍼, 아크릴 bisacrylamide 솔루션 및 70 %gycerol 추가 합니다. 하는 요소를 solubilize 물 욕조에 60 ° C에가 열. DdH2O 10 mL, 10% 추가 APS와 TEMED 중 합에 대 한 마지막으로.</td>
		</tr>
<tr>
<td>트리 스 Tricine 젤 솔루션 B</td>
			<td colspan="2">
 6 ml: 30% 아크릴-bisacrylamide (29: 1) 0.8 mL 6 M 요소 3 배 젤 버퍼 1.5 mL ddH2O 6 mL을 추가 10% APS 45 Μ L 4.5 TEMED Μ L</td>
			<td>6 M 요소 무게 고 젤 버퍼와 아크릴 bisacrylamide 솔루션 x 3를 추가 합니다. 하는 요소를 solubilize 물 욕조에 60 ° C에가 열. DdH2O 10 mL, 10% 추가 APS와 TEMED 중 합에 대 한 마지막으로.</td>
		</tr>
<tr>
<td>트리 스 Tricine 실행 버퍼 (양극) x 1</td>
			<td colspan="2">
 100 mM Tris 22.5 m m HCl pH 8.9</td>
			<td>Schägger 19 에서 적응 하는 레시피
</td>
		</tr>
<tr>
<td>트리 스 Tricine 실행 버퍼 (음극) x 1</td>
			<td colspan="2">
 100 mM Tris 100 mM Tricine 1% SDS pH 8.25</td>
			<td>Schägger 19 에서 적응 하는 레시피
</td>
		</tr>
<tr>
<td>산 성 버퍼</td>
			<td colspan="2">
 100 mM Tris 100 mM 아세트산</td>
			<td></td>
		</tr>
<tr>
<td>4 %SDS 겹쳐 쌓이는 젤</td>
			<td colspan="2">
 2 ml. ddH2O 1.4 mL 30% 아크릴-bisacrylamide (37.5:1) 0.33 mL 1 M Tris pH 6.8 0.25 mL 10% SDS 20 Μ L 10% APS 20 Μ L TEMED 2 Μ L</td>
			<td></td>
		</tr>
<tr>
<td>15 %SDS 젤을 분리</td>
			<td colspan="2">
 10 ml: ddH2O 2.3 mL 30% 아크릴-bisacrylamide (37.5:1) 5 mL 1.5 M Tris pH 8.8 2.5 mL 10% SDS 100 Μ L 10% APS 100 Μ L TEMED 4 Μ L</td>
			<td></td>
		</tr>
<tr>
<td>SDS 실행 버퍼 x 1</td>
			<td colspan="2">
 25mm Tris 192 m m 글리신 0.1% SDS</td>
			<td></td>
		</tr>
<tr>
<td>Coomassie 솔루션 얼룩</td>
			<td colspan="2">
 5% (w/v) 황산 알루미늄-(14-18)-하이드 레이트 10% (v/v) 에탄올 (96%) 2% (v/v) 직접 산 (85%) 0.02% (w/v) Coomassie 화려한 블루 G-250 
			 </td>
			<td></td>
		</tr>
<tr>
<td>ULTRAhyb 磁 교 잡 버퍼</td>
			<td colspan="2"></td>
			<td>Ambion, 생활 기술</td>
		</tr>
</tbody></table>표 2: 솔루션 및 버퍼 조리법. 모든 버퍼 및 3D 페이지 분석에 필요한 솔루션의 목록입니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>자리 아니입니다.</td>
			<td>MW obs. [kDa]</td>
			<td colspan="2">식별</td>
			<td>유기 체</td>
			<td>아니오를 취득.</td>
			<td>MW [kDa]</td>
			<td>마스코트 점수</td>
		</tr>
<tr>
<td>CIV_1</td>
			<td>130</td>
			<td colspan="2">상 상속 질병 저항 단백질 At4g19050</td>
			<td>B. napus</td>
			<td>CDX78917</td>
			<td>131.1</td>
			<td>110</td>
		</tr>
<tr>
<td>CIV_2</td>
			<td>130</td>
			<td colspan="2">상 상속 질병 저항 단백질 At4g19050</td>
			<td>B. napus</td>
			<td>CDX78917</td>
			<td>131.1</td>
			<td>89</td>
		</tr>
<tr>
<td>CIV_3</td>
			<td>100</td>
			<td colspan="2">열 충격 70 kDa 단백질 14 처럼</td>
			<td>B. napus</td>
			<td>XP_013748865</td>
			<td>89.9</td>
			<td>113</td>
		</tr>
<tr>
<td>CIV_4</td>
			<td>90</td>
			<td colspan="2">진 핵 신장 요인 2 세포 분열 조절 단백질 48 체 A</td>
			<td>B. napus B. napus</td>
			<td>CDX90241 CDY41316.1</td>
			<td>89.5 89.5</td>
			<td>111 197</td>
		</tr>
<tr>
<td>CIV_5</td>
			<td>85</td>
			<td colspan="2">열 충격 단백질 90-2-같은</td>
			<td>B. rapa</td>
			<td>XP_009132342</td>
			<td>79.8</td>
			<td>172</td>
		</tr>
<tr>
<td>CIV_6</td>
			<td>80</td>
			<td colspan="2">트레오닌-tRNA 리가 글리신-tRNA 리가</td>
			<td>B. 올레라케아 B. napus</td>
			<td>XP_013599115 CDY43195</td>
			<td>81.5 80.8</td>
			<td>110 88</td>
		</tr>
<tr>
<td>CIV_7</td>
			<td>70</td>
			<td colspan="2">열 충격 단백질 70 kDa 리 신-tRNA 리가 같은</td>
			<td>B. 올레라케아 B. napus</td>
			<td>XP_013685267 XP_013747530</td>
			<td>67.8 69.9</td>
			<td>230 150</td>
		</tr>
<tr>
<td>CIV_8</td>
			<td>65</td>
			<td colspan="2">Myrosinase Aspartate-tRNA 리가 2 아스파라긴-tRNA 리가 1</td>
			<td>B. napus B. napus B. napus</td>
			<td>ABQ42337 XP_013670803 XP_013729126</td>
			<td>60.6 61.6 63.5</td>
			<td>183 141 153</td>
		</tr>
<tr>
<td>CIV_9</td>
			<td>60</td>
			<td colspan="2">Myrosinase</td>
			<td>B. napus</td>
			<td>ABQ42337</td>
			<td>60.6</td>
			<td>164</td>
		</tr>
<tr>
<td>CIV_10</td>
			<td>55</td>
			<td colspan="2">Adenosylhomocysteinase 2-같은</td>
			<td>B. rapa</td>
			<td>XP_009135865</td>
			<td>53.1</td>
			<td>139</td>
		</tr>
<tr>
<td>CIV_11</td>
			<td>55</td>
			<td colspan="2">신장 요인 1 알파 1-같은</td>
			<td>B. 올레라케아</td>
			<td>XP_013586115</td>
			<td>51.9</td>
			<td>161</td>
		</tr>
<tr>
<td>CIV_12</td>
			<td>50</td>
			<td colspan="2">시스 틴 lyase CORI3 처럼</td>
			<td>B. napus</td>
			<td>XP_013653143</td>
			<td>48.1</td>
			<td>237</td>
		</tr>
<tr>
<td>CIV_13</td>
			<td>44</td>
			<td colspan="2">시스 틴 lyase CORI3 처럼</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48.3</td>
			<td>213</td>
		</tr>
<tr>
<td>CIV_14</td>
			<td>38</td>
			<td colspan="2">과 당-bisphosphate aldolase</td>
			<td>B. rapa</td>
			<td>XP_009115993</td>
			<td>38.4</td>
			<td>226</td>
		</tr>
<tr>
<td>CIV_15</td>
			<td>45</td>
			<td colspan="2">시스 틴 lyase CORI3 처럼</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48.3</td>
			<td>219</td>
		</tr>
<tr>
<td>CIV_16</td>
			<td>45</td>
			<td colspan="2">시스 틴 lyase CORI3</td>
			<td>B. rapa</td>
			<td>CDY69765</td>
			<td>46.9</td>
			<td>209</td>
		</tr>
<tr>
<td>CIV_17</td>
			<td>38</td>
			<td colspan="2">과 당-bisphosphate aldolase</td>
			<td>B. rapa</td>
			<td>XP_009115993</td>
			<td>38.4</td>
			<td>124</td>
		</tr>
<tr>
<td>CIV_18</td>
			<td>18</td>
			<td colspan="2">Peptidyl-prolyl cis 트랜스 isomerase CYP18-3-처럼</td>
			<td>B. napus</td>
			<td>XP_009101932</td>
			<td>18.3</td>
			<td>128</td>
		</tr>
<tr>
<td>CIV_19</td>
			<td>45</td>
			<td colspan="2">시스 틴 lyase CORI3 처럼</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48.3</td>
			<td>177</td>
		</tr>
</tbody></table>표 3: 복잡 한 IV에서 단백질 구성 요소 식별. 여러 tRNA ligases와 추가 단백질 tRNA 바인딩 단지 내 발견 되었습니다 후 3D 페이지 spectrometric 분석을 대량 MALDI TOF를 사용 하 여.

Watch this Scientific Journal Video about Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes at JoVE.com

Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

체 관 부 수액 샘플링 브라시카 napus 단백질 및 Ribonucleoprotein 단지의 3D-페이지에서

여기에 우리가 큰 네이티브 단백질: 단백질 및 단백질의 단백질 구성을 분석 하는 프로토콜을 제시: oilseed 강간에서 핵 산 복합물 (B. napus) 체 관 부 exudate 블루 결합 3D polyacrylamide 젤 전기 이동 법 (페이지) 방식을 사용 하 여 네이티브 대량 spectrometric 식별 뒤의 변성 페이지 두 개 (10 억).

Sampling the phloem of higher plants is often laborious and significantly dependent on the plant species. However, proteome studies under denaturing ...

phloem-sap-sampling-from-brassica-napus-for-3d-page-protein

Research

Education

JoVE Journal

JoVE Core

Biology

Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

Fundamentals

Macromolecules

SCIENTISTS IN ACTION

13.7K 조회수.  Universität Hamburg. 여기에 우리가 큰 네이티브 단백질: 단백질 및 단백질의 단백질 구성을 분석 하는 프로토콜을 제시: oilseed 강간에서 핵 산 복합물 (B. napus) 체 관 부 exudate 블루 결합 3D polyacrylamide 젤 전기 이동 법 (페이지) 방식을 사용 하 여 네이티브 대량 spectrometric 식별 뒤의 변성 페이지 두 개 (10 억).

비디오: Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

mRNA Interactome Capture from Plant Protoplasts

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional gene regulation (PTGR) of messenger RNAs (mRNAs). In the past few years, a number of mRNA-bound proteomes from yeast and mammalian cell lines have been successfully isolated through the use of a novel method called &#34;mRNA interactome capture,&#34; which allows for the identification of mRNA-binding proteins (mRBPs) directly from a physiological environment. The method is composed of in vivo ultraviolet (UV) crosslinking, pull-down and purification of messenger ribonucleoprotein complexes (mRNPs) by oligo(dT) beads, and the subsequent identification of the crosslinked proteins by mass spectrometry (MS). Very recently, by applying the same method, several plant mRNA-bound proteomes have been reported simultaneously from different Arabidopsis tissue sources: etiolated seedlings, leaf tissue, leaf mesophyll protoplasts, and cultured root cells. Here, we present the optimized mRNA interactome capture method for Arabidopsis thaliana leaf mesophyll protoplasts, a cell type that serves as a versatile tool for experiments that include various cellular assays. The conditions for optimal protein yield include the amount of starting tissue and the duration of UV irradiation. In the mRNA-bound proteome obtained from a medium-scale experiment (107 cells), RBPs noted to have RNA-binding capacity were found to be overrepresented, and many novel RBPs were identified. The experiment can be scaled up (109 cells), and the optimized method can be applied to other plant cell types and species to broadly isolate, catalog, and compare mRNA-bound proteomes in plants.

Here, we present an interactome capture protocol applied to Arabidopsis thaliana leaf mesophyll protoplasts. This method critically relies on in vivo UV crosslinking and allows for the isolation and identification of plant mRNA-binding proteins from a physiological environment.

식물 원형질에서 mRNA Interactome 캡처

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

연구

생화학

2 in 1: One-step Affinity Purification for the Parallel Analysis of Protein-Protein and Protein-Metabolite Complexes

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of protein-protein interactions (PPI) is no novelty, experimental approaches aiming to characterize endogenous protein-metabolite interactions (PMI) constitute a rather recent development. Herein, we present a protocol that allows simultaneous characterization of the PPI and PMI of a protein of choice, referred to as bait. Our protocol was optimized for Arabidopsis cell cultures and combines affinity purification (AP) with mass spectrometry (MS)-based protein and metabolite detection. In short, transgenic Arabidopsis lines, expressing bait protein fused to an affinity tag, are first lysed to obtain a native cellular extract. Anti-tag antibodies are used to pull down protein and metabolite partners of the bait protein. The affinity-purified complexes are extracted using a one-step methyl tert-butyl ether (MTBE)/methanol/water method. Whilst metabolites separate into either the polar or the hydrophobic phase, proteins can be found in the pellet. Both metabolites and proteins are then analyzed by ultra-performance liquid chromatography-mass spectrometry (UPLC-MS or UPLC-MS/MS). Empty-vector (EV) control lines are used to exclude false positives. The major advantage of our protocol is that it enables identification of protein and metabolite partners of a target protein in parallel in near-physiological conditions (cellular lysate). The presented method is straightforward, fast, and can be easily adapted to biological systems other than plant cell cultures.

Protein-protein and protein-metabolite interactions are crucial for all cellular functions. Herein, we describe a protocol that allows parallel analysis of these interactions with a protein of choice. Our protocol was optimized for plant cell cultures and combines affinity purification with mass spectrometry-based protein and metabolite detection.

2 1: 원스텝 단백질 단백질과 단백질 대사 산물 단지의 병렬 분석에 대 한 친 화력 정화

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of ...

Analysis of N-glycans from Raphanus sativus Cultivars Using PNGase H+

In recent years, the carbohydrate moieties of plants have received considerable attention, as they are a potential source of cross-reactive, allergy-provoking immune responses. In addition, carbohydrate structures also play a critical role in plant metabolism. Here, we present a simple and rapid method for preparing and analyzing N-glycans from different cultivars of radish (Raphanus sativus) using an N-glycanase specific for the release of plant-derived carbohydrate structures. To achieve this, crude trichloroacetic acid precipitates of radish homogenates were treated with PNGase H+, and labeled using 2-aminobenzamide as a fluorescent tag. The labeled N-glycan samples were subsequently analyzed by ultra performance liquid chromatography (UPLC) separation and matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry for a detailed structural evaluation and to quantify relative abundancies of the radish-derived N-glycan structures. This protocol can also be used for the analysis of N-glycans from various other plant species, and may be useful for further investigation of the function and effects of N-glycans on human health.

Analysis of N-glycans from Raphanus sativus Cultivars Using PNGase H+

We describe a simple and rapid method for the preparation and analysis of N-glycans from different cultivars of radish (Raphanus sativus).

N-glycans Raphanus sativus Cultivars 사용 PNGase H+ 에서 분석

In recent years, the carbohydrate moieties of plants have received considerable attention, as they are a potential source of cross-reactive, ...

High-Resolution Complexome Profiling by Cryoslicing BN-MS Analysis

Proteins generally exert biological functions through interactions with other proteins, either in dynamic protein assemblies or as a part of stably formed complexes. The latter can be elegantly resolved according to molecular size using native polyacrylamide gel electrophoresis (BN-PAGE). Coupling of such separations to sensitive mass spectrometry (BN-MS) has been well-established and theoretically allows for exhaustive assessment of the extractable complexome in biological samples. However, this approach is rather laborious and provides limited complex size resolution and sensitivity. Also, its application has remained restricted to abundant mitochondrial and plastid proteins. Thus, for a majority of proteins, information regarding integration into stable protein complexes is still lacking. Presented here is an optimized approach for complexome profiling comprising preparative-scale BN-PAGE separation, sub-millimeter sampling of broad gel lanes by cryomicrotome slicing, and mass spectrometric analysis with label-free protein quantification. The procedures and tools for critical steps are described in detail. As an application, the report describes complexome analysis of a solubilized endosome-enriched membrane fraction from mouse kidneys, with 2,545 proteins profiled in total. The results demonstrate identification of uniform, low-abundance membrane proteins such as intracellular ion channels as well as high resolution, complex protein assembly patterns, including glycosylation isoforms. The results are in agreement with independent biochemical analyses. In summary, this methodology allows for comprehensive and unbiased identification of protein (super)complexes and their subunit composition, providing a basis for investigating stoichiometry, assembly, and interaction dynamics of protein complexes in any biological system.

A versatile cryoslicing BN-MS protocol using a microtome is presented for high-resolution complexome profiling.

BN-MS 분석에 의한 고분해능 컴플렉스 프로파일링

Proteins generally exert biological functions through interactions with other proteins, either in dynamic protein assemblies or as a part of stably formed ...

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based phosphoproteomics has transformed the way of studying plant signal transduction. However, requirement of lots of starting materials and prolonged MS measurement time to achieve the depth of coverage has been the limiting factor for the high throughput study of global phosphoproteomic changes in plants. To improve the sensitivity and throughput of plant phosphoproteomics, we have developed a stop and go extraction (stage) tip based phosphoproteomics approach coupled with Tandem Mass Tag (TMT) labeling for the rapid and comprehensive analysis of plant phosphorylation perturbation in response to osmotic stress. Leveraging the simplicity and high throughput of stage tip technique, the whole procedure takes approximately one hour using two tips to finish phosphopeptide enrichment, fractionation, and sample cleaning steps, suggesting an easy-to-use and high efficiency of the approach. This approach not only provides an in-depth plant phosphoproteomics analysis (&#62; 11,000 phosphopeptide identification) but also demonstrates the superior separation efficiency (&#60; 5% overlap) between adjacent fractions. Further, multiplexing has been achieved using TMT labeling to quantify the phosphoproteomic changes of wild-type and snrk2 decuple mutant plants. This approach has successfully been used to reveal the phosphorylation events of Raf-like kinases in response to osmotic stress, which sheds light on the understanding of early osmotic signaling in land plants.

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Presented here is a phosphoproteomic approach, namely stop and go extraction tip based phosphoproteomic, which provides high-throughput and deep coverage of Arabidopsis phosphoproteome. This approach delineates the overview of osmotic stress signaling in Arabidopsis.

애기독증에서 삼투압 신호 프로파일링을 위한 인포프로테오믹 전략

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

에서 외과를 이용한 셀 타입 특정 표현식 프로파일을 사용하여 조직 및 장기 특정 Phytochrome 응답 조사 Arabidopsis thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

생물학

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation (BiFC) System

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein (YFP) into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest. These constructs can then be co-transformed into Nicotiana benthamiana via Agrobacterium mediated transformation, allowing the transit expression of fusion proteins. The reconstitution of YFP signal only occurs when the inquest proteins interact 1-7. To test and validate the protein-protein interactions, BiFC can be used together with yeast two hybrid (Y2H) assay. This may detect indirect interactions which can be overlooked in the Y2H. Gateway technology is a universal platform that enables researchers to shuttle the gene of interest (GOI) into as many expression and functional analysis systems as possible8,9. Both the orientation and reading frame can be maintained without using restriction enzymes or ligation to make expression-ready clones. As a result, one can eliminate all the re-sequencing steps to ensure consistent results throughout the experiments. We have created a series of Gateway compatible BiFC and Y2H vectors which provide researchers with easy-to-use tools to perform both BiFC and Y2H assays10. Here, we demonstrate the ease of using our BiFC system to test protein-protein interactions in N. benthamiana plants.

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation BiFC System

We have developed a technique to test protein-protein interactions in plant. A yellow fluorescent protein (YFP) is split into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest via Gateway system, enabling expression of fusion proteins. Reconstitution of YFP signal only occurs when the inquest proteins interact.

게이트웨이 가능 Bimolecular의 형광 Complementation (BiFC) 시스템을 사용하여 공장에서 단백질 상호 작용의 검출

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein ...

Profiling Thiol Redox Proteome Using Isotope Tagging Mass Spectrometry

Pseudomonas syringae pv. tomato strain DC3000 not only causes bacterial speck disease in Solanum lycopersicum but also on Brassica species, as well as on Arabidopsis thaliana, a genetically tractable host plant1,2. The accumulation of reactive oxygen species (ROS) in cotyledons inoculated with DC3000 indicates a role of ROS in modulating necrotic cell death during bacterial speck disease of tomato3. Hydrogen peroxide, a component of ROS, is produced after inoculation of tomato plants with Pseudomonas3. Hydrogen peroxide can be detected using a histochemical stain 3'-3' diaminobenzidine (DAB)4. DAB staining reacts with hydrogen peroxide to produce a brown stain on the leaf tissue4. ROS has a regulatory role of the cellular redox environment, which can change the redox status of certain proteins5. Cysteine is an important amino acid sensitive to redox changes. Under mild oxidation, reversible oxidation of cysteine sulfhydryl groups serves as redox sensors and signal transducers that regulate a variety of physiological processes6,7. Tandem mass tag (TMT) reagents enable concurrent identification and multiplexed quantitation of proteins in different samples using tandem mass spectrometry8,9. The cysteine-reactive TMT (cysTMT) reagents enable selective labeling and relative quantitation of cysteine-containing peptides from up to six biological samples. Each isobaric cysTMT tag has the same nominal parent mass and is composed of a sulfhydryl-reactive group, a MS-neutral spacer arm and an MS/MS reporter10. After labeling, the samples were subject to protease digestion. The cysteine-labeled peptides were enriched using a resin containing anti-TMT antibody. During MS/MS analysis, a series of reporter ions (i.e., 126-131 Da) emerge in the low mass region, providing information on relative quantitation. The workflow is effective for reducing sample complexity, improving dynamic range and studying cysteine modifications. Here we present redox proteomic analysis of the Pst DC3000 treated tomato (Rio Grande) leaves using cysTMT technology. This high-throughput method has the potential to be applied to studying other redox-regulated physiological processes.

Reactive oxygen species level is elevated when cells encounter stress conditions. Here we show the example of 3'-3' diaminobenzidine staining as well as cysTMT labeling and mass spectrometry to profile the redox proteome in Pseudomonas syringae treated tomato leaves.

동위 원소 태그 질량 분광법을 사용하여 Thiol 산화 환원 프로테옴 프로 파일링

Pseudomonas syringae pv. tomato strain DC3000 not only causes bacterial speck disease in Solanum lycopersicum but also on Brassica species, as well as on ...

Collection and Analysis of Arabidopsis Phloem Exudates Using the EDTA-facilitated Method

The plant phloem is essential for the long-distance transport of (photo-) assimilates as well as of signals conveying biotic or abiotic stress. It contains sugars, amino acids, proteins, RNA, lipids and other metabolites. While there is a large interest in understanding the composition and function of the phloem, the role of many of these molecules and thus, their importance in plant development and stress response has yet to be determined. One barrier to phloem analysis lies in the fact that the phloem seals itself upon wounding. As a result, the number of plants from which phloem sap can be obtained is limited. One method that allows collection of phloem exudates from several plant species without added equipment is the EDTA-facilitated phloem exudate collection described here. While it is easy to use, it does lead to the wounding of cells and care has to be taken to remove contents of damaged cells. In addition, several controls to prove purity of the exudate are necessary. Because it is an exudation rather than a direct collection of the phloem sap (not possible in many species) only relative quantification of its contents can occur. The advantage of this method over others is that it can be used in many herbaceous or woody plant species (Perilla, Arabidopsis, poplar, etc.) and requires minimal equipment and training. It leads to reasonably large amounts of exudates that can be used for subsequent analysis of proteins, sugars, lipids, RNA, viruses and metabolites. It is simple enough that it can be used in both a research as well as in a teaching laboratory.

Collection and Analysis of Arabidopsis Phloem Exudates Using the EDTA-facilitated Method

Knowledge of the composition of the phloem sap as well as the mechanism of its loading and long-distance transport is essential for the understanding of long-distance signaling in plant development and stress/pathogen response and of assimilate transport. This manuscript describes the collection of phloem exudates using the EDTA-facilitated method.

의 수집과 분석<em&gt; 애기 장대</em&gt; 사부는 EDTA-촉진 방법을 사용하여 삼출물

The plant phloem is essential for the long-distance transport of (photo-) assimilates as well as of signals conveying biotic or abiotic stress. It ...

The Infiltration-centrifugation Technique for Extraction of Apoplastic Fluid from Plant Leaves Using Phaseolus vulgaris as an Example

The apoplast is a distinct extracellular compartment in plant tissues that lies outside the plasma membrane and includes the cell wall. The apoplastic compartment of plant leaves is the site of several important biological processes, including cell wall formation, cellular nutrient and water uptake and export, plant-endophyte interactions and defence responses to pathogens. The infiltration-centrifugation method is well established as a robust technique for the analysis of the soluble apoplast composition of various plant species. The fluid obtained by this method is commonly known as apoplast washing fluid (AWF). The following protocol describes an optimized vacuum infiltration and centrifugation method for AWF extraction from Phaseolus vulgaris (French bean) cv. Tendergreen leaves. The limitations of this method and the optimization of the protocol for other plant species are discussed. Recovered AWF can be used in a wide range of downstream experiments that seek to characterize the composition of the apoplast and how it varies in response to plant species and genotype, plant development and environmental conditions, or to determine how microorganisms grow in apoplast fluid and respond to changes in its composition.

The Infiltration-centrifugation Technique for Extraction of Apoplastic Fluid from Plant Leaves Using Phaseolus vulgaris as an Example

This protocol details the optimized extraction of apoplast washing fluid from plant leaves, using French bean plants (Phaseolus vulgaris) as a model example.

공장에서 유체 Apoplastic의 추출을위한 침투-원심 분리 기술을 사용하여 잎<em&gt; 위 Phaseolus 심상</em&gt; 예를 들어

The apoplast is a distinct extracellular compartment in plant tissues that lies outside the plasma membrane and includes the cell wall. The apoplastic ...

체 관 부 수액 샘플링 브라시카 napus 단백질 및 Ribonucleoprotein 단지의 3D-페이지에서

요약

더 많은 비디오 탐색

이 비디오의 챕터

식물 원형질에서 mRNA Interactome 캡처

2 1: 원스텝 단백질 단백질과 단백질 대사 산물 단지의 병렬 분석에 대 한 친 화력 정화

N-glycans Raphanus sativus Cultivars 사용 PNGase H⁺ 에서 분석

BN-MS 분석에 의한 고분해능 컴플렉스 프로파일링

애기독증에서 삼투압 신호 프로파일링을 위한 인포프로테오믹 전략

에서 외과를 이용한 셀 타입 특정 표현식 프로파일을 사용하여 조직 및 장기 특정 Phytochrome 응답 조사 Arabidopsis thaliana

게이트웨이 가능 Bimolecular의 형광 Complementation (BiFC) 시스템을 사용하여 공장에서 단백질 상호 작용의 검출

동위 원소 태그 질량 분광법을 사용하여 Thiol 산화 환원 프로테옴 프로 파일링

의 수집과 분석

공장에서 유체 Apoplastic의 추출을위한 침투-원심 분리 기술을 사용하여 잎