우리가 그들의 과학적 지원을 위해 제니퍼 딕 및 Urszula Zarzenska 감사합니다. 이 작품 경력 통합 교부 금에 의해 (CIG, PCIG14-가-2013-63 0734) 7 프레임 워크 프로그램, 그랜트 LFF-GK06 'DELIGRAH' (Landesforschungsförderung 함부르크), DFG 그랜트 (DFG 애 856_6-1) 내에서 유럽 위원회에 의해 재정적으로 지원 되었다 JK에 게 수 여.

1. 샘플링 및 B. napus 에서 체 관 부 수액의 준비 식물 4,,820
<ol><li>체 관 부 수액 샘플링, 사용 잘 물을 8 주 된 B. napus 식물 꽃가루 오염을 방지 하기 위해 그 표시만 초기 개화.</li>
	<li>피하 주사를 사용 하 여 (Ø 0.8 m m)는 화 서는 punctate 여러 번 줄기와. 다른 몇 가지 화 서 줄기에 및 충분 한 체 관 부 수액 (그림 2a)를 다른 식물에 반복 합니다. 참고: 복잡 한 분석을 위해이 좋습니다 체 관 부 수액의 적어도 600 µ L로 시작 하. 4 ~ 5 식물의 체 관 부 수액 200, 700 µ L 사이 얻을 것입니다.</li>
	<li>필터 종이 부상된 사이트에서 첫 번째 드롭 다운을 닦아내십시오. 이러한 방울 주로 손상된 조직 주위에서 높은 오염된 물질을 포함 하 고 버려질 필요가 있다.</li>
	<li>Pipetting으로 다음 방울을 수집 하 고 수집된 exudate 얼음 냉각 시스템을 사용 하는-20 ° C에서 미리 냉장된 원뿔 1.5 mL 반응 관에 저장.</li>
	<li>계속 해 서 수집 전혀 더 드롭 형성은 관찰, 하지만 1 시간 보다는 더 이상 때까지. 수집 된 체 관 부 수액의 상당한 손실 없이 2 일 후에이 절차를 반복할 수 있습니다. 주: 수집 된 체 관 부 수액 즉시 사용 하거나 미래의 분석-80 ° C에 저장 될 수 있습니다. -80 ° C 보관, 충격-동결 반응 관에 액체 질소.</li>
	<li>체 관 부 샘플 약 1/6번째 분자량 (MWCO) 10000 Daltons (Da)의 차단으로 원심 집중 장치를 사용 하 여 초기 볼륨을 집중 한다. 4 ° C와 먼지 입자를 제거 하는 적어도 15 분 동안 20000 x g에서 집중된 샘플 원심 참고: 체 관 부 수액 농도 단백질의 상당한 손실에 연결 되지 않습니다.</li>
	<li>이후 복잡 한 분석, 단계 3.1 진행.</li>
</ol>2. 체 관 부 수액 순도 제어 역전사 PCR (RT-PCR) 4,,820 를 사용 하 여
<ol><li>체 관 부 수액 액체 재료에 대 한 표준 RNA 추출 메서드를 사용 하 여에서 총 RNA 격리 (예: TRIzol 또는 페 놀-클로 프롬 적 출 소 프로 파 놀 강수량 수성 단계에 따라 단계를 세척 하는 에탄올에서 뒤는 제조 업체의 프로토콜)입니다. 주의: 페 놀-클로 프롬 독성이 있다. 적절 한 개인 보호 장비와 후드 작동 합니다. 최대 6 개월까지-80 ° C에서의 에탄올에 추출 된 RNA는 저장할 수 있습니다.</li>
	<li>DNase 소화 하 여 DNA의 오염 제거 나 (1 u / µ g) 37 ° C에서 45 분 동안 5mm의 최종 농도에 EDTA를 추가 하 여 효소를 비활성화 하 고 10 분 동안 75 ° C에 샘플을 품 어.</li>
	<li>순수한 RNA를 정화 하 고 다른 정화 단계 (예: 제조업체의 지침에 따라 RNA 정리 키트를 사용 하 여)에 의해 샘플을 집중 합니다.</li>
	<li>150를 사용 하 여 cDNA 합성 키트 역전사 PCR (RT-PCR) cDNA의 합성에 대 한 수행 ng 순수한 RNA의 제조 업체에 의해 설명 된 대로 프로토콜의. 참고:는 cDNA 저장할 수 있습니다-20 ° C에서 사용까지.</li>
	<li>구획 별 성적표를 증폭 agarose 젤 전기 이동 법에 의해 확인 하는 제조 업체에 의해 지정 된 표준 PCR 반응에 대 한 템플릿으로 cDNA의 5 µ L 사용 합니다. 예를 들어 rubisco 작은 소 단위, thioredoxin h, 그리고 꽃가루 외 투 단백질 (그림 1b, 표 1)에 대 한 프라이 머를 사용 하 여 체 관 부 샘플의 순도 확인 합니다.</li>
</ol>3. 블루 기본 페이지 4,25,,2631
<ol><li>사용 중 자기 부 기본 그라데이션 젤 설명 대로 다른27 또는 상업 두번째-트리 스 그라데이션 젤.</li>
	<li>부하에서 젤으로 잘 당 집중된 단백질 샘플의 20 ~ 30 µ g 이상 triplicates.</li>
	<li>4 ° C에서 150 V 젤 실행 샘플 젤 (ca. 20 ~ 30 분, 그림 3a)의 1/3rd 때까지 어두운 파란색 음극 버퍼 B와 양극 버퍼 (표 2)를 사용 하 여. 참고: 북부 blotting에 대 한 단일 젤 레인은 3D 페이지와 덜 풍부한 단백질을 집중 하 여 최대 10 개 젤 차선에서 같은 밴드를 결합 하는 것이 좋습니다 하는 질량 분석에 의해 단백질 구성의 분석에 대 한 동안, 충분 한.</li>
	<li>실행을 일시 중지 한 exchange 어두운 파란색 음극 버퍼 B 밝은 파란색 음극 B/10 (표 2)를 버퍼링 하 고 실행을 계속. 젤 블루 앞 elute 젤 (ca. 120 ~ 180 분, 그림 3a)를 시작할 때 실행을 마칩니다. 참고: 완료 블루 기본 젤 저장할 수 있습니다 4 ° C에 적어도 1 주일에 대 한. 장기간된 보관 밴드 확산으로 이어질 수 있습니다 하 고 피해 야 한다. 다크 블루 버퍼 B 다시 사용할 수 있습니다.</li>
</ol>4. 선택 사항: RNA 블루 네이티브 북부 더 럽 히 4 를 사용 하 여 검출
<ol><li>독특한 밴드 밖으로 또는 블루 기본 젤에서 전체 젤 레인을 사용 하 여 및 세미 드라이 60 분 3.5 mA/cm2 blotting에 의해 나일론 막에 그들을 전송 잘라내어 멤브레인 (그림 4a)에 연필로 위와 더 낮은 젤 테두리를 표시.</li>
	<li>럽, 후 DEPC 처리 물 막 세척 하 고 건조 한 두 필터 논문 사이.</li>
	<li>UV-가교 120000 µ / cm2 blotted 막의 수행 (85 s 자료의 테이블에에서는 Crosslinker를 사용 하는 경우).</li>
	<li>사전에 교 잡 오븐 (그림 4a)에서 68 ° C에서 60 분에 대 한 교 잡 버퍼 (상업적 또는 성가)의 6 mL와 함께 막 교배.</li>
	<li>3'-biotinylated 프로브 4 µ L를 포함 하는 교 잡 버퍼의 추가 1 mL을 추가 (100 nM).</li>
	<li>품 어 막의 프로브, 37 ° c 68 ° C에서 오븐을 냉각 하는 동안</li>
	<li>2 x SSC와 0.1 %SDS, 프로브 unspecifically 바인딩 제거를 위해 상 온에서 5 분을 포함 하는 버퍼 막 씻어. 주의: SDS 자극을 일으킬 수 있습니다. SDS와 솔루션을 포함 하는 SDS를 작업할 때 장갑과 실험실 코트를 착용.</li>
	<li>민감한 chemiluminescent 반응 (그림 4a) 인 양 고추냉이 과산화 효소 (HRP) 기판으로는 막 예 luminol와 Streptavidin HRP 공액에의 3'-biotinylated 프로브 탐지를 수행 합니다.</li>
</ol>5. 두 번째 치수: 트리 스-Tricine-요소 페이지 4,28
<ol><li>단일 밴드 블루 기본 젤에서 삭제하시오 더 복잡 한 단백질 (그림 5)의 농도 달성 하기 위해 병렬 차선에서 실행 하는 샘플에서 밴드를 결합 합니다. 참고: 삭제 밴드에에서 저장할 수 있습니다 단일 반응 튜브 4 ° c.에서 사용까지</li>
	<li>12% 트리 스-Tricine-요소 젤을 붓고 (두께 1 m m, 6.8 c m x 8.6 cm (폭 x 길이)). 분리 젤 (표 2), 젤 솔루션의 10 mL를 준비 두 유리 접시 소 프로 파 놀과 오버레이 간의 부. 중 합 완료 후는 소 프로 파 놀을 제거 하 고 젤 삽입 10 잘 빗에 겹쳐 쌓이는 젤에 대 한 젤 솔루션 B (표 2)의 4 mL를 전송. 주의: Unpolymerized 아크릴 신경 수 이며 TEMED 흡입 하는 경우에 유해한. 항상 개인 보호 장비를 착용 하 고는 후드 작동.</li>
	<li>1.5 mL 반응 관에 삭제 젤 밴드를 전송 하 고 젤 조각 (그림 5, 표 2)의 평형에 대 한 SDS 샘플 버퍼 x 2의 1 mL를 추가 합니다.<ol>
<li>실내 온도에, 또는 전자 레인지에가 열 블록 (95 ° C)에 끓는 전에 10 분 동안 샘플을 품 어 고 추가 15 분 동안 실내 온도에 다시 샘플을 품 어.</li>
		<li>여러 equilibrated 젤 조각 같은 복잡 한을 대표 하는 하나의 단일 젤 주머니에 스택.</li>
		<li>전기 이동 법 양극과 음극 150 V 45 ~ 60 분에 버퍼를 실행을 사용 하 여 수행 하 고 전체 젤 레인을 삭제할.</li>
	</ol>
</li>
	<li>산 성 버퍼 (100 mM Tris, 100 mM 아세트산)에서 20 분 컷된 레인을 품 어 고 125 mM Tris HCl, pH 6.8 또 다른 20 분 (그림 5)에서 equilibrate.</li>
</ol>6. 3 차원: SDS-페이지 4,32
<ol><li>분리 젤 Laemmli32 에 따라 15 %SDS 붓고 (두께: 1.5 m m, 6.8 c m x 8.6 cm (폭 x 길이)) (표 2) 스태킹 젤 위의 4%의 얇은 레이어를 추가 하 고. 주의: SDS, 아크릴 아 미드와 TEMED는 유독 하 고 유해 합니다. 후드 밑 작업과 개인 보호 장비를 착용.</li>
	<li>SDS 젤에 equilibrated 젤 레인 전송 및 버퍼 bromophenol 블루 (그림 5)의 흔적으로 보충을 실행 1 x SDS에 0.5% (w/w) agarose 젤 커버.</li>
	<li>전자 레인지에 agarose 젤에 로드 이전 버퍼 실행 SDS를 끓인 다.</li>
	<li>단일 부품의 분자 무게를 추정 하는 단백질 마커를 실행, 삽입 젤의 한쪽 끝에 필터 종이 agarose 경화 될 때까지 또는 일반적으로 IPG 젤 사용 특별 한 빗을 사용 하 여.</li>
	<li>150 V 60 분 및 얼룩에 젤을 실행 콜 로이드 Coomassie, 실버 얼룩 또는 어떤 다른 젤 얼룩 메서드 이후 대량 spectrometric 분석에 적합.</li>
	<li>매트릭스 보조 레이저 탈 착/이온화 같은 대량 spectrometric 방법을 사용 하 여 보이는 단백질 반점 분석 시간의 비행 (TOF MALDI) 또는 LC-MS/MS 질량 분석. 참고: 우리는 콜 로이드 Coomassie 설명된33이미로 얼룩을 사용 하 여 것이 좋습니다. 우리의 손에 덜 풍부한 단백질 충분히 얼룩이 질 수 있다 고 합리적인 데이터 품질에 대 한 대량 spectrometric 분석을 수 있습니다.</li>
</ol>

<ol>
	<li>Kempers, R., van Bel, A. J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Symplasmic+connections+between+sieve+element+and+companion+cell+in+the+stem+phloem+ofVicia+faba+L.+have+a+molecular+exclusion+limit+of+at+least+10+kDa.">Symplasmic connections between sieve element and companion cell in the stem phloem ofVicia faba L. have a molecular exclusion limit of at least 10 kDa.</a> Planta. 201 (2), 195-201 (1997).</li><li>Stadler, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+GFP-fusions+in+Arabidopsis+companion+cells+reveals+non-specific+protein+trafficking+into+sieve+elements+and+identifies+a+novel+post-phloem+domain+in+roots.">Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots.</a> Plant J. 41 (2), 319-331 (2005).</li><li>Imlau, A., Truernit, E., Sauer, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-to-cell+and+long-distance+trafficking+of+the+green+fluorescent+protein+in+the+phloem+and+symplastic+unloading+of+the+protein+into+sink+tissues.">Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues.</a> Plant Cell. 11 (3), 309-322 (1999).</li><li>Ostendorp, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+Brassica+napus+phloem+protein+and+ribonucleoprotein+complexes.">Functional analysis of Brassica napus phloem protein and ribonucleoprotein complexes.</a> New Phytol. 214 (3), 1188-1197 (2017).</li><li>Paultre, D. S. G., Gustin, M. -. P., Molnar, A., Oparka, K. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lost+in+Transit:+Long-Distance+Trafficking+and+Phloem+Unloading+of+Protein+Signals+in+Arabidopsis+Homografts.">Lost in Transit: Long-Distance Trafficking and Phloem Unloading of Protein Signals in Arabidopsis Homografts.</a> Plant Cell. 28 (9), 2016-2025 (2016).</li><li>Sali, A., Glaeser, R., Earnest, T., Baumeister, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+words+to+literature+in+structural+proteomics.">From words to literature in structural proteomics.</a> Nature. 422 (6928), 216-225 (2003).</li><li>Lin, M. -. K., Lee, Y. -. J., Lough, T. J., Phinney, B. S., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pumpkin+Phloem+Proteome+Provides+Insights+into+Angiosperm+Sieve+Tube+Function.">Analysis of the Pumpkin Phloem Proteome Provides Insights into Angiosperm Sieve Tube Function.</a> Mol. Cell. Proteomics. 8 (2), 343-356 (2008).</li><li>Giavalisco, P., Kapitza, K., Kolasa, A., Buhtz, A., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+the+proteome+of+Brassica+napus+phloem+sap.">Towards the proteome of Brassica napus phloem sap.</a> Proteomics. 6 (3), 896-909 (2006).</li><li>Lucas, W. J., Yoo, B. C., Kragler, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+as+a+long-distance+information+macromolecule+in+plants.">RNA as a long-distance information macromolecule in plants.</a> Nat. Rev. Mol. Cell. Bio. 2 (11), 849-857 (2001).</li><li>Dinant, S., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sampling+and+Analysis+of+Phloem+Sap.">Sampling and Analysis of Phloem Sap.</a> Plant Mineral Nutrients. 953, 185-194 (2013).</li><li>Kennedy, J. S., Mittler, T. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Method+of+obtaining+Phloem+Sap+via+the+Mouth-parts+of+Aphids.">A Method of obtaining Phloem Sap via the Mouth-parts of Aphids.</a> Nature. 171 (4351), 528 (1953).</li><li>King, R. W., Zeevaart, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+Phloem+exudation+from+cut+petioles+by+chelating+agents.">Enhancement of Phloem exudation from cut petioles by chelating agents.</a> Plant Physiol. 53 (1), 96-103 (1974).</li><li>Alosi, M. C., Melroy, D. L., Park, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+regulation+of+gelation+of+Phloem+exudate+from+cucurbita+fruit+by+dilution,+glutathione,+and+glutathione+reductase.">The regulation of gelation of Phloem exudate from cucurbita fruit by dilution, glutathione, and glutathione reductase.</a> Plant Physiol. 86 (4), 1089-1094 (1988).</li><li>Dinant, S., Bonnemain, J. -. L., Girousse, C., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phloem+sap+intricacy+and+interplay+with+aphid+feeding.">Phloem sap intricacy and interplay with aphid feeding.</a> Comptes rendus biologies. 333 (6-7), 504-515 (2010).</li><li>Tetyuk, O., Benning, U. F., Hoffmann-Benning, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Collection+and+analysis+of+Arabidopsis+phloem+exudates+using+the+EDTA-facilitated+Method.">Collection and analysis of Arabidopsis phloem exudates using the EDTA-facilitated Method.</a> J Vis Exp. (80), e51111 (2013).</li><li>Kovalskaya, N., Owens, R., Baker, C. J., Deahl, K., Hammond, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+a+modified+EDTA-mediated+exudation+technique+and+guttation+fluid+analysis+for+Potato+spindle+tuber+viroid+RNA+detection+in+tomato+plants+(Solanum+lycopersicum).">Application of a modified EDTA-mediated exudation technique and guttation fluid analysis for Potato spindle tuber viroid RNA detection in tomato plants (Solanum lycopersicum).</a> J. Virol. Methods. 198, 75-81 (2014).</li><li>Rodriguez-Medina, C., Atkins, C. A., Mann, A. J., Jordan, M. E., Smith, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Macromolecular+composition+of+phloem+exudate+from+white+lupin+(Lupinus+albus+L).">Macromolecular composition of phloem exudate from white lupin (Lupinus albus L).</a> BMC Plant Biol. 11 (1), 36 (2011).</li><li>Taylor, J. S., Thompson, B., Pate, J. S., Atkins, C. A., Pharis, R. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytokinins+in+the+Phloem+Sap+of+White+Lupin+(Lupinus+albus+L.).">Cytokinins in the Phloem Sap of White Lupin (Lupinus albus L.).</a> Plant Physiol. 94 (4), 1714-1720 (1990).</li><li>Yoo, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Systemic+Small+RNA+Signaling+System+in+Plants.">A Systemic Small RNA Signaling System in Plants.</a> Plant Cell. 16 (8), 1979-2000 (2004).</li><li>Buhtz, A., Springer, F., Chappell, L., Baulcombe, D. C., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+small+RNAs+from+the+phloem+of+Brassica+napus.">Identification and characterization of small RNAs from the phloem of Brassica napus.</a> Plant J. 53 (5), 739-749 (2008).</li><li>Chalhoub, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genetics.+Early+allopolyploid+evolution+in+the+post-Neolithic+Brassica+napus+oilseed+genome.">Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome.</a> Science. 345 (6199), 950-953 (2014).</li><li>Sasaki, T., Chino, M., Hayashi, H., Fujiwara, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+several+mRNA+species+in+rice+phloem+sap.">Detection of several mRNA species in rice phloem sap.</a> Plant Cell Phys. 39 (8), 895-897 (1998).</li><li>Doering-Saad, C., Newbury, H. J., Bale, J. S., Pritchard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+aphid+stylectomy+and+RT-PCR+for+the+detection+of+transporter+mRNAs+in+sieve+elements.">Use of aphid stylectomy and RT-PCR for the detection of transporter mRNAs in sieve elements.</a> J Exp. Bot. 53 (369), 631-637 (2002).</li><li>Ruiz-Medrano, R., Xoconostle-C&#225;zares, B., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phloem+long-distance+transport+of+CmNACP+mRNA:+implications+for+supracellular+regulation+in+plants.">Phloem long-distance transport of CmNACP mRNA: implications for supracellular regulation in plants.</a> Dev. 126 (20), 4405-4419 (1999).</li><li>Sch&#228;gger, H., Cramer, W. A., von Jagow, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+molecular+masses+and+oligomeric+states+of+protein+complexes+by+blue+native+electrophoresis+and+isolation+of+membrane+protein+complexes+by+two-dimensional+native+electrophoresis.">Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis.</a> Anal. Biochem. 217 (2), 220-230 (1994).</li><li>Sch&#228;gger, H., von Jagow, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue+native+electrophoresis+for+isolation+of+membrane+protein+complexes+in+enzymatically+active+form.">Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form.</a> Anal. Biochem. 199 (2), 223-231 (1991).</li><li>Fiala, G. J., Schamel, W. W. A., Blumenthal, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue+native+polyacrylamide+gel+electrophoresis+(BN-PAGE)+for+analysis+of+multiprotein+complexes+from+cellular+lysates.">Blue native polyacrylamide gel electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular lysates.</a> J Vis Exp. (48), e2164 (2011).</li><li>Rais, I., Karas, M., Sch&#228;gger, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two-dimensional+electrophoresis+for+the+isolation+of+integral+membrane+proteins+and+mass+spectrometric+identification.">Two-dimensional electrophoresis for the isolation of integral membrane proteins and mass spectrometric identification.</a> Proteomics. 4 (9), 2567-2571 (2004).</li><li>Sch&#228;gger, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tricine-SDS-PAGE.">Tricine-SDS-PAGE.</a> Nature protocols. 1 (1), 16-22 (2006).</li><li>Wittig, I., Braun, H. -. P., Sch&#228;gger, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue+native+PAGE.">Blue native PAGE.</a> Nat Protoc. 1 (1), 418-428 (2006).</li><li>Eubel, H., Braun, H. -. P., Millar, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Blue-native+PAGE+in+plants:+a+tool+in+analysis+of+protein-protein+interactions.">Blue-native PAGE in plants: a tool in analysis of protein-protein interactions.</a> Plant Methods. 1 (1), 11 (2005).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Dyballa, N., Metzger, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+colloidal+coomassie+G-250+staining+for+proteins+in+polyacrylamide+gels.">Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels.</a> J Vis Exp. (30), (2009).</li><li>Turnbull, C. G. N., Lopez-Cobollo, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heavy+traffic+in+the+fast+lane:+long-distance+signalling+by+macromolecules.">Heavy traffic in the fast lane: long-distance signalling by macromolecules.</a> New Phytol. 198 (1), 33-51 (2013).</li><li>Hall, S. M., Baker, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+chemical+composition+of+Ricinus+phloem+exudate.">The chemical composition of Ricinus phloem exudate.</a> Planta. 106 (2), 131-140 (1972).</li><li>Barnes, A., Bale, J., Constantinidou, C., Ashton, P., Jones, A., Pritchard, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+protein+identity+from+sieve+element+sap+in+Ricinus+communis+L.+by+quadrupole+time+of+flight+(Q-TOF)+mass+spectrometry.">Determining protein identity from sieve element sap in Ricinus communis L. by quadrupole time of flight (Q-TOF) mass spectrometry.</a> J. Exp. Bot. 55 (402), 1473-1481 (2004).</li><li>Walz, C., Giavalisco, P., Schad, M., Juenger, M., Klose, J., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomics+of+curcurbit+phloem+exudate+reveals+a+network+of+defence+proteins.">Proteomics of curcurbit phloem exudate reveals a network of defence proteins.</a> Phytochemistry. 65 (12), 1795-1804 (2004).</li><li>Walz, C., Juenger, M., Schad, M., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+the+presence+and+activity+of+a+complete+antioxidant+defence+system+in+mature+sieve+tubes.">Evidence for the presence and activity of a complete antioxidant defence system in mature sieve tubes.</a> Plant J. 31 (2), 189-197 (2002).</li><li>Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phloem+sap+proteins:+their+identities+and+potential+roles+in+the+interaction+between+plants+and+phloem-feeding+insects.">Phloem sap proteins: their identities and potential roles in the interaction between plants and phloem-feeding insects.</a> J Exp. Bot. 57 (4), 767-774 (2006).</li><li>Ham, B. -. K., Brandom, J. L., Xoconostle-C&#225;zares, B., Ringgold, V., Lough, T. J., Lucas, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+polypyrimidine+tract+binding+protein,+pumpkin+RBP50,+forms+the+basis+of+a+phloem-mobile+ribonucleoprotein+complex.">A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex.</a> Plant Cell. 21 (1), 197-215 (2009).</li><li>Schamel, W. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotinylation+of+protein+complexes+may+lead+to+aggregation+as+well+as+to+loss+of+subunits+as+revealed+by+Blue+Native+PAGE.">Biotinylation of protein complexes may lead to aggregation as well as to loss of subunits as revealed by Blue Native PAGE.</a> J. Immunol. Methods. 252 (1-2), 171-174 (2001).</li><li>Zhang, S., Sun, L., Kragler, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phloem-delivered+RNA+pool+contains+small+noncoding+RNAs+and+interferes+with+translation.">The phloem-delivered RNA pool contains small noncoding RNAs and interferes with translation.</a> Plant Physiol. 150 (1), 378-387 (2009).</li></ol>

저자는 공개 없다.

체 관 부는 높은 관심의 구획 때문에 photoassimilates에 대 한 주요 수송 경로 구성 하 고 또한 다른 식물 부속9,20,34, 사이 장거리 신호를 위해 근본적 이다 35. 작은 분자 뿐만 아니라 RNAs 단백질 같은 고분자와 체 관 부 유지 보수 신호4,7,8연루 되었습니다. 체 관 부 구성의 분석 대부분의 식물 종에서 체 관 부 샘플에 제한 접근에 의해 제한 됩니다. 곤충 stylet 기술을 광범위 하 게 적용 하지만 실험적 요구 이며 체 관 부 샘플11의 매우 작은 양의 결과. 1 개의 쉬운 기술은 체 관 부 샘플링에 사용 되는 EDTA 촉진 나옴12입니다. EDTA 칼슘 같은 divalent 이온 chelates을 따라서 P 단백질 및 callose로 체 번호판의 폐쇄. 그것은 사용 하기 쉬운, 그러나 손상 된 세포에 의해 오염 하는 경향이 고 샘플 희석. EDTA에 의해 divalent 이온을 없애고 기존 단지의 분석 또한 발생할 수 있습니다. 그러나, 그것은 다양 한 모델 공장 A. thaliana15를 포함 하 여 종에서에서 샘플링이 있습니다. 체 관 부 수액의 자발적인 나옴만 종의 식물의 작은 수에서 발생합니다. 식물 조직10의 중요 한 상해를 포함 하는 침략 적 방법입니다. 우리는 최근 장거리 전송4,8,20공부 모델 종족으로 B. napus 를 설립. 여기, 체 관 부 수액 샘플링할 수 있다 수 작은 절 개에서 부상 효과 오염의 소스를 감소 시키는.
다른 샘플링 기법을 사용 하 여, 다양 한 식물 종에서 체 관 부 샘플의 프로테옴에 최근 몇 년 동안7,8,17,,3637, 조사는 38,39. 이러한 프로테옴 연구에 대 한 단백질 추출 되었고 조건을 변성 시키기에서 시 켰 던 따라서 단백질: 단백질 및 단백질에 대 한 결론을 허용 하지 않습니다: 핵 산 상호 작용 기본 조건 제시. 공동-immunoprecipitation (CoIP) 및 오버레이 분석 표시 주요 ribonucleoprotein 복잡 한 호박40, 체 관 부 수액에 있을 수 있지만 어떤 고분자 복합물 내의 기본 조건에서 존재 증명 되지 이었다는 체 관 부 시스템입니다.
Schägger 그 외 여러분 에 의해 도입 된 블루 기본 페이지 26, 후속 고해상도 젤 전기 이동 법 단계와 함께에서 큰 단백질 복합물의 개별 구성 요소 분리 가능 네이티브 B. napus 의 3D 페이지 분석을 사용 하 여 체 관 부 exudate, 우리 수 최근 보여 여러 높은 분자 무게 단백질: 단백질과 RNP 단지 체 관 부 샘플에 존재 하며 효소 활성화4. 크기 배제 크로마토그래피 같은 단백질 복합물 뿐만 아니라 RNPs를 분리 하는 다른 방법 존재, 하지만 억 페이지에 비해 해상도 관점에서 실패 수 있습니다. 또한, 복잡 한 분리의 합리적인 품질, 크기 배제 열 매트릭스 조사 되 고 전반적으로 복잡 한 분자 무게에 따라 적용할 수 있다. 다른 크기의 단지 분석 따라서 다른 유형의 비용을 집중 하 고 억 페이지로 초점 고성능으로 허용 하지 않는 열을 요구할 것 이다.
B. napus 에서 단지 분석 하 중요 한 단계는 시작 물자로 사용 하는 체 관 부 sap의 총 금액을 포함 합니다. 체 관 부 샘플의 적어도 600 µ L 필요 하 고 5 개의 잘 물결 무늬가 있는 식물에서 얻을 수 있습니다. 3D 페이지 및 BN 북부 blotting에 대 한 체 관 부 샘플의 충분 한 양의 초기 비 엔 젤을 시작할 필요가 있다. 이를 위해, 체 관 부 샘플은 집중 잘하고 적어도 20 ~ 30 µ g 단백질의 각에 로드할 수 있습니다 때까지 동일한 샘플의 triplicates을 동시에 실행 됩니다. 너무 낮거나 너무 높은 농도 단지 (그림 3)의 탐지를 줄일 수 있습니다. 체 관 부 샘플 필요 얼음에 반응 튜브에 수집 되며 단백질 저하와 회전율을 피하기 위해 나중에 사용 하기 위해 냉동 저장 한다. 프로 테아 제 저 해제 분석 하 고, 모든 체 관 부 proteomes에서 발견 되었습니다 하지만 또한 완전히 활성 프로테아좀 B. napus4의 체 관 부에 설명 했다. 또한, 볼륨 및 체 관 부 샘플의 구성 샘플링 시간-포인트와10환경 조건 따라 다릅니다. 따라서 유사한 조건 하에서 하루 중 같은 시간에 수집을 배려를가지고 한다. 스트레스 치료 (예: 가뭄) 수집 수 체 관 부의 양을 줄일 수 있습니다. 식별 하려면 단일 단백질 질량 분석에 의해, 제한 가능한 각 질 오염 입고 장갑 항상 필수입니다. 각 질과 질량 spec 분석 중 추가 신호 리드 저해 단백질 식별. 더 높은 전압 또는 온도에 10 억 페이지를 실행 깨지기 쉬운 단지의 분해 될 수 있는 젤의 열 발생할 수 있습니다.
여기에 제시 된 프로토콜은 단백질: 단백질 복합물의 분석에 적합 합니다. 우리는 또한 동시에 단지에 포함 된 특정 RNAs를 감지 하 사용할 수 있습니다 보여줍니다. 이를 위해, 우리는 최근 북부 blotting410 억에 대 한 프로토콜 도입. RNAs는 RNAse 오염에 의해 저하 하는 경향이 있다. 이러한 성능 저하를 제한 하려면 DEPC 처리, 물 사용 되어야 한다.
제시 방법의 주요 제한 포함 마이그레이션 동작 따라 크기, 모양에 그리고도 단지31의 posttranslational 수정 이후 억 페이지를 구분 하는 단백질 복합물의 분자량의 추정 41. RNP 복합물의 크기 추정은 마이그레이션 동작에 핵 산의 영향으로 훨씬 더 복잡 합니다. 그것은 또한 하지 막을 수 있습니다 단지 같은 크기의 공동 한 하나의 밴드에서 마이그레이션할. 이 복잡 한 구성의 잘못 된 예측 발생할 수 있습니다. 따라서 상호 보완적인 기술로 관찰 된 상호 작용을 확인, 예를 들어 기능 분석 실험4, 필요할 수 있습니다. 또한 단백질만 약하게 또는 뚜렷이 고분자 복합체에 관련 된 사용 BN 버퍼에서 손실 될 수 있습니다. 이 방지 하려면 샘플 가교 화, 부작용으로 이어질 수 있습니다 무엇 또는 단백질 식별을 방지할 수 있습니다 또는 버퍼 상태를 최적화할 수 있습니다.
클래식 2D-페이지, 달리의 요소 및 SDS 페이지 hydrophobicity 및 전자 점 (pI) 및 분자량 28, 대신 분자량에 따라 분리 수 있습니다 조합과 단백질의 분리를 제한 하지 않는 한 특정 pI 범위입니다. 클래식 비슷한 2D 페이지, 분리 단백질 단일 관광 명소를 볼 수 있지만 대각선에 선 4,28 (, 그림 5 그림 6). 반면에 친수성 단백질 더 선28아래 찾을 수 있습니다 더 많은 소수 성 단백질이이 대각선 위의 관광 명소에 나타납니다. 이 프로토콜에 사용 된 polyacrylamide 농도 사이 25 ~ 80 kDa 단백질 잘 별도 것입니다. 작은 또는 큰 단백질의 분리는 polyacrylamide 있도록 농도 변화 될 수 있다 또는 그라데이션 젤 3 차원에서 사용할 수 있습니다. 3D-페이지 (그림 6)으로 구분 된 복잡 한 IV (그림 3)의 구성 요소, 트립 신, 소화 및 질량 분석에 의해 분석 밖으로 절단. 이 결과 여러 tRNA ligases의 식별. 다른 단지의 구성 요소 되었습니다 4최근 출판. 우리의 3D 페이지는 다른 ligases, 즉 aspartate, 아스파라긴, 트레오닌, 라이 신, 글리신 ligases, 유사한 분자 무게 (표 3)와 분리를 사용할 수 있습니다. 우리 복잡 한 4 내에서 잠재적으로 바인딩된 tRNA를 감지할 수 메티오닌 tRNA 전용 프로브를 사용 하 여, 하지만 전체 길이 tRNA 또는 tRNA 조각 복잡 한에 있는 경우 사용 하는 프로브와 차별 수 없습니다. 핵 산 단지 내에 정말 바인딩된와 공동 마이그레이션 있다면, 프로 테아 제 소화 체 관 부 수액 확인을 샘플 수 있습니다 적합 한 마이그레이션 컨트롤 역할을 합니다.
그것은 거의 대부분의 구성 요소는 전체 리보솜으로 신장 요인의 체 관 부 샘플4,7에서 발견 되었습니다 이후 단백질 번역 체 관 부 체 튜브 내에서 발생할 수 있습니다 이전 추측 하고있다. TRNA와 tRNA ligases의 우리의 발견이이 아이디어를 지 원하는 것으로 보인다. 그러나, tRNA 조각 호박에서 체 관 부 샘플에 존재는 번역42 의 강력한 억제제로 표시 되었습니다 그리고 기능적인 리보솜4, 번역 자리를 차지할 수 없는 제안에 결 석 것 같다.
함께 찍은, 여기에 제시 된 프로토콜 기본 단백질: 단백질 및 체 관 부 샘플 및 분리에서 심지어 RNP 복합물의 분리 및 높은 해상도 가진 그들의 개별 부품의 식별 수 있습니다. 이 방법의 응용 프로그램 소설 단백질 및 체 관 부 샘플에서 RNP 단지 검색 하 고 따라서이 고도로 전문화 된 공장에 새로운 기능을 명료 하 게 수 있습니다.

체 관 부의 장거리 도관 더 높은 식물에 있는 유기 양분의 할당에 대 한 필수적입니다만 또한 성장 및 개발, 병원 체 방어 및 불리 한에 적응에 대 한 중요 한 많은 다른 프로세스를 규제에 참여 환경 조건입니다. 이온, phytohormones, 또는 스스로 대사 산물과 같은 작은 이펙터, 게다가 RNAs 단백질 같은 고분자는 잠재적인 신호도 최근 등장 했습니다.
연구는 단백질의 체 관 부 로드 크기 및 동반자 셀 (CC) 연결 기 공 plasmodesmal 단위의 크기 제외 제한 (SEL)에 의해 제어 요소 (SE)에 10의 범위에 일반적으로 있는 체 하 고 > 67 kDa1 , 2 , 그러나 3., 이러한 크기 제한이 더 큰 단백질 및 단백질에도 불구 하 고 단지 크기 제외4의 아이디어에 도전 하는 체 관 부 시스템 내에서 발견 되었습니다 그리고 se CC에서 단백질도 일반적인 손실 되었습니다 제안된5 .
큰 뿐 아니라 multiprotein ribonucleoprotein 단지6셀 구조적 무결성을 유지 하 고 생 합성에 중추적인 역할을 한다. 체 관 부-모바일 단백질-단백질 및 ribonucleoprotein 단지4,7, 존재 증거가 있다 하지만 날짜 그들의 기능에 대 한 약간은 알려진 다. 체 관 부 체 요소에서 단백질: 단백질과 RNP 단지 장거리 전송 및/또는 신호8,9연루 되었습니다. 환경 변화에서 그들의 구성 공부 translocated 단지의 기능을 해명 하거나 스트레스 조건이 필요 합니다. 이 위해 네이티브 단지 고립 되 고 그들의 구성 요소는 충분 한 해상도로 분리 될 필요가.
높은 분자 무게 단지는 체 관 부를 분리, 그것은 충분 한 품질 및 수량에 sap 샘플을 얻기 위해 첫 번째 필요. 체 관 부 샘플링에 사용할 수 있는 기술 관심의 식물 종에 따라 달라 집니다. 체 관 부 수액을 얻기 위해 세 가지 주요 방법 존재 10: 곤충 stylectomy11, EDTA 촉진 나옴12, 그리고 자발적인 있고13.
애기 thaliana (A. thaliana), 실험실, 전세계의 주요 모델 공장에서에서 체 관 부 샘플만 EDTA 용이 있고 또는 진딧물 stylectomy,1415에 의해 얻어질 수 있다. 두 방법 모두 매우 희석된 체 관 부 수액 또는 매우 낮은 샘플 금액으로 이어질. EDTA 용이 있고 또한 오염 하는 경향이 하 고 실제 체 관 부 구성16를 나타내지 않을 수 있습니다. 자연 체 관 부 나옴 어디 공장 부품을 잘라 쉽게 수집된13,,1718수 있는 체 관 부 수액의 자발적 방출에 리드, cucurbits, 르 피나 스 또는 유카, 같은 종 식물로 제한 됩니다. 19. 우리는 최근 체 관 부 분석을 위한 적합 한 모델 시스템으로 oilseed 강간 (브라 시카 napus)를 설립, 이후 A. thaliana 의 가까운 친척 및 체 관 부 수액의 여러 microliters 표시 되어 작은 절 개에서 얻을 수 있습니다. 고 순도4,,820의 수 있습니다. 또한, B. napus 게놈 시퀀스 201421에 릴리스 되었습니다.
진딧물 stylectomy 제외한 모든 체 관 부 수집 방법 설명 샘플링, 사이트에서 조직 주변의 손상 포함 하 고 체 관 부 수액의 구성은 부상에 대 한 응답에서 변경 될 수 있습니다. 따라서 샘플링 방법 적용에 체 관 부 샘플의 품질을 확인 하려면 필수적입니다. 예: RNase 활동22,23, Rubisco8,24에 대 한 뇌관으로 RT-PCR 또는 설탕의 분석의 결정에 의해 수집 된 체 관 부 수액의 품질 관리를 위한 다른 방법이 있다 컴포지션8.
크기 배제 크로마토그래피, 자당 밀도 ultracentrifugation, 또는 명백한 분자량 커트로 세포 막을 통해 여과 샘플을 포함 하 여 격리 하 고 분리 단백질 단지 다른 방법을 적용할 수 있습니다 오프. 그러나, 이러한 접근은 높은 해상도 허용 하지 않습니다. 라는 블루 기본 페이지 (비-), Schägger 외에의해 처음으로 설명 하는 기법. 25, 해상도 측면에서 우량 하다. 그것은 성공적으로 다양 한 세포 또는 세포 lysates 및 그들의 상대 나타났는데26,27큰 네이티브 단백질 복합물의 분자 무게를 결정 하기 위해 사용 되었다.
더 명료 단백질 복합물의 복잡 한 구성, 그것은 복잡 한 부품의 완전 한 해체로 이어지는 조건을 변성 시키기에서 개별 구성 요소를 분리 하는 데 필요한. 이 더 높은 해상도, 전자 초점 (IEF)의 두 번째 차원으로 SDS 페이지30 의 third dimension와의 후속 식별을 달성 하기 위해, 또는 SDS 페이지 28,29 의 두 번째 차원에 의해 달성 될 수 있다 단백질 질량 분석을 사용 하 여입니다.
이 프로토콜에서 순수 체 관 부 수액 B. napus 식물에서의 샘플링 및 트리 스-Tricine-우 레 아-페이지와 SDS 페이지 BN-페이지를 결합 하는 3D 전기 이동 방식을 사용 하 여 이러한 체 관 부 샘플에서 단백질 복합물의 분석을 설명 합니다. 분리 된 단백질 복잡 한 구성 요소는 이후 질량 분석을 사용 하 여 식별 됩니다. 또한, 소개 블루 네이티브 북부 blotting 큰 RNP 단지4, RNAs의 탐지를 허용 하는 방법으로는 접근의 적용을 확장 합니다.

<table>
	<tbody>
		<tr>
			<td>1.5 mL reaction tubes</td>
			<td>Eppendorf</td>
			<td>30120086</td>
			<td></td>
		</tr>
		<tr>
			<td>10 well comb for SDS PAGE, thickness 1 mm</td>
			<td>BioRad</td>
			<td>1653359</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Propanol</td>
			<td>AppliChem</td>
			<td>131090</td>
			<td></td>
		</tr>
		<tr>
			<td>30 % Acrylamide-bisacrylamide solution (29:1) solution</td>
			<td>BioRad</td>
			<td>1610156</td>
			<td></td>
		</tr>
		<tr>
			<td>30 % Acrylamide-bisacrylamide solution (37.5:1) solution</td>
			<td>BioRad</td>
			<td>1610158</td>
			<td></td>
		</tr>
		<tr>
			<td>96 % Ethanol</td>
			<td>Carl Roth</td>
			<td>P075</td>
			<td></td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Carl Roth</td>
			<td>6755</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Lonza</td>
			<td>50004</td>
			<td></td>
		</tr>
		<tr>
			<td>Aluminum sulfate-(14-18)-hydrate</td>
			<td>AppliChem</td>
			<td>141101</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium peroxodisulfate (APS)</td>
			<td>Carl Roth</td>
			<td>9592.3</td>
			<td></td>
		</tr>
		<tr>
			<td>Bis-Tris</td>
			<td>AppliChem</td>
			<td>A3992</td>
			<td></td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>AppliChem</td>
			<td>A2940</td>
			<td></td>
		</tr>
		<tr>
			<td>Bromophenol blue</td>
			<td>AppliChem</td>
			<td>A2331</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifugal concentrators e.g. Vivaspin 500 (Mwco 10 kDa)</td>
			<td>Sartorius</td>
			<td>VS0102</td>
			<td></td>
		</tr>
		<tr>
			<td>Chemiluminescent Nucleic Acid Detection Module Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>89880</td>
			<td></td>
		</tr>
		<tr>
			<td>Chromatography papers e.g. 3 mm CHR</td>
			<td>Whatman</td>
			<td>3030-153</td>
			<td></td>
		</tr>
		<tr>
			<td>CoolBox M30 System</td>
			<td>Biocision</td>
			<td>BCS-133</td>
			<td></td>
		</tr>
		<tr>
			<td>Coomassie brilliant Blue G-250</td>
			<td>AppliChem</td>
			<td>A3480</td>
			<td></td>
		</tr>
		<tr>
			<td>Diethyl pyrocarbonate (DEPC)</td>
			<td>AppliChem</td>
			<td>A0881</td>
			<td></td>
		</tr>
		<tr>
			<td>Dithiothreitol (DTT)</td>
			<td>AppliChem</td>
			<td>A1101</td>
			<td></td>
		</tr>
		<tr>
			<td>DNase I</td>
			<td>AppliChem</td>
			<td>A3778</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol abs.</td>
			<td>AppliChem</td>
			<td>A3693</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid (EDTA)</td>
			<td>AppliChem</td>
			<td>A1103</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel Imaging system e.g. Chemidoc Touch</td>
			<td>BioRad</td>
			<td>1708370</td>
			<td></td>
		</tr>
		<tr>
			<td>GeneRuler 1kb plus</td>
			<td>Thermo Fisher Scientific</td>
			<td>SM1331</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>AppliChem</td>
			<td>141339</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>AppliChem</td>
			<td>131340</td>
			<td></td>
		</tr>
		<tr>
			<td>Heating block TS1</td>
			<td>Biometra</td>
			<td>846-051-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Hybridization oven e.g. GFL Hybridization Incubator 7601</td>
			<td>GFL</td>
			<td>7601</td>
			<td></td>
		</tr>
		<tr>
			<td>Hypodermic needle (0.8 mm)</td>
			<td>B Braun</td>
			<td>4658309</td>
			<td></td>
		</tr>
		<tr>
			<td>IPG gel comb, thickness 1 mm</td>
			<td>BioRad</td>
			<td>1653367</td>
			<td></td>
		</tr>
		<tr>
			<td>Labeling of RNA e.g.Biotin 3&#39;end DNA Labeling Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>89818</td>
			<td></td>
		</tr>
		<tr>
			<td>Native gradient gel e.g. Novex NativePAGE 4&#8211;16% Bis-Tris protein gel</td>
			<td>Invitrogen</td>
			<td>BN1002BOX</td>
			<td></td>
		</tr>
		<tr>
			<td>Nylon membrane e.g. Hybond-N+</td>
			<td>Amersham Pharmacia</td>
			<td>RPN203B</td>
			<td></td>
		</tr>
		<tr>
			<td>Ortho-phosphoric acid</td>
			<td>Carl Roth</td>
			<td>6366.1</td>
			<td></td>
		</tr>
		<tr>
			<td>PageRuler prestained protein ladder</td>
			<td>Thermo Fisher Scientific</td>
			<td>26616</td>
			<td></td>
		</tr>
		<tr>
			<td>Power supply for Gel electrophoresis EPS</td>
			<td>Amersham Pharmacia</td>
			<td>18-1130-01</td>
			<td>available from GE Healthcare</td>
		</tr>
		<tr>
			<td>RNA Cleanup Kit</td>
			<td>Qiagen</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr>
			<td>Semi dry blot e.g. Fastblot 43B semi dry Blot</td>
			<td>Biometra</td>
			<td>846-015-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride (NaCl)</td>
			<td>AppliChem</td>
			<td>A1149</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium dodecyl sulfate (SDS)</td>
			<td>AppliChem</td>
			<td>142363</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthesis of cDNA e.g. RevertAid First Strand cDNA Synthesis Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetramethylethylenediamine (TEMED)</td>
			<td>AppliChem</td>
			<td>A1148</td>
			<td></td>
		</tr>
		<tr>
			<td>Tricine</td>
			<td>AppliChem</td>
			<td>A3954</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>AppliChem</td>
			<td>A1086</td>
			<td></td>
		</tr>
		<tr>
			<td>Tri-sodium citrate dihydrate</td>
			<td>AppliChem</td>
			<td>A3901</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>15596026</td>
			<td></td>
		</tr>
		<tr>
			<td>ULTRAhyb Ultrasensitive Hybridization Buffer</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM8670</td>
			<td></td>
		</tr>
		<tr>
			<td>Urea</td>
			<td>AppliChem</td>
			<td>A1360</td>
			<td></td>
		</tr>
		<tr>
			<td>UV Crosslinker e.g. Stratalinker 2400</td>
			<td>Agilent</td>
			<td>NC0477671</td>
			<td>from Fisher Scientific</td>
		</tr>
		<tr>
			<td>Vertical electrophoresis apparatus e.g.The XCell SureLock Mini-Cell or Mini-Protean III System</td>
			<td>Thermo Fisher Scientific or BioRad</td>
			<td>EI0001 or 1658004</td>
			<td></td>
		</tr>
		<tr>
			<td>Wipers e.g. KIMWIPES Delicate Task Wipers</td>
			<td>Kimberly-Clark</td>
			<td>34120</td>
			<td></td>
		</tr>
	</tbody>
</table>

phloem sap sampling from brassica napus for 3d-page of protein and ribonucleoprotein complexes

더 높은 식물의 체 관 부를 샘플링은 종종 힘들고 식물 종에 크게 의존입니다. 그러나, 변성 시키기 조건에서 프로테옴 연구 다른 식물 종에 달성 될 수 있었다. 네이티브 단백질: 단백질과 단백질: 체 관 부 샘플에서 핵 산 단지 아직 부족 하 게 분석 된, 하지만 그들은 수도 있습니다 중요 한 역할을이 전문된 구획의 유지 보수 또는 장거리 신호. 큰 분자 어셈블리 블루 기본 젤 전기 이동 법 (BN-페이지)를 사용 하 여 격리 된 수 있습니다. 후속 나트륨 라우릴 황산 염 (SDS-페이지)에 의해 그들의 단백질 구성 요소를 분리할 수 있습니다. 그러나, 유사한 분자 무게 단백질 공동 마이그레이션, 무슨 질량 분석에 의해 단백질 식별을 방해 수 있습니다. 두 개의 다른 변성 젤 전기 이동 법 단계, 즉 트리 스-Tricine-요소 및 SDS 페이지 BN-페이지 조합 그들의 화란/hydrophobicity에 따라 단백질의 추가 분리를 가능 하 게 하 고 따라서 해상도 성공 증가 단백질 식별. 그것은 심지어 posttranslational 수정만 다른 단백질을 구별 수 있습니다. 또한, 블루 네이티브 북부 blotting 고분자 복합물의 RNA 구성 요소를 식별 하기 위해 적용할 수 있습니다. 우리는 우리의 프로토콜 단백질 및 RNA 구성 요소 네이티브 단백질: 단백질 및 체 관 부 샘플에서 발생 하는 ribonucleoprotein (RNP) 단지의 해명 하기 적합 하다는 것을 보여줍니다. 파란색을 결합 하 여 두 개의 다른 변성 페이지 단계 기본 페이지 큰 단백질 복합물의 다른 종류를 구분 하는 데 도움이 수 있습니다 그리고 또한 질량 분석에 의해 그들의 구성 요소 식별 증가 속도 수 있습니다. 또한, 프로토콜은 동시에 단일 단백질 복합물 내의 잠재적으로 바인딩된 핵 산을 검출 하기 위하여 충분히 강력한입니다.

여기에 우리가 단백질: 단백질의 분석을 허용 하는 프로토콜을 현재 브라 시카 napus에서 체 관 부 샘플에서 단백질: RNA 복합물 뿐만 아니라. 흐름은 그림 1에 나와 있습니다. 다른 모델 유기 체 이상 B. napus 의 주요 장점 중 하나는 화 서 줄기에 작은 구멍에서 상대적으로 쉽게 체 관 부 샘플 컬렉션의 가능성입니다. 이 대 등 하 게 많은 양의 순수한 체 관 부 샘플을 얻을 수 있습니다. 체 관 부를 샘플링 때 그것은 항상 RT-PCR8예, 오염에 대 한 확인 하는 것이 좋습니다. 순수 체 관 부 샘플에서 얻은 대표적인 결과 그림 2에 묘사 된다. 비 오염 체 관 부 샘플 rubisco와 꽃가루 외 투 단백질에 대 한 신호가 나타납니다 반면 thioredoxin h에 대 한 보이는 밴드를 표시 합니다. Rubisco 작은 소 단위 잎, 샘플에서 컨트롤로 사용할 수 있습니다 화 서 줄기 또는 꽃가루. 꽃가루 외 투 단백질 대 본만 꽃 새싹 샘플에 표시 되어야 하는 동안 그것의 mRNA의 다른 종, 체 관 부에 발견 되었습니다 이후 Thioredoxin h 모든 샘플에서 감지 해야 합니다. 오염 체 관 부 샘플링 완전히 꽃 식물 (화분 외 투 단백질) 또는 체 관 부 샘플링 구멍에서에서 첫 번째 방울 제대로 삭제 하지 때 수행 하는 경우 발생할 수 있습니다 (rubisco).
BN 페이지 이전 체 관 부 수액 집중 필수입니다. 잘 당 단백질의 20 ~ 30 µ g를 사용 하 여, 적어도 4 개의 주요 단백질 복잡 한 악대 표시 되 고 비 엔-페이지의 B. napus 체 관 부 수액, 너무 낮은 후 또는 너무 높은 농도 단지 (그림 3)의 명확한 분리를 허용 하지 않습니다. 2 차원 젤 다운스트림 처리 및 후속 대량 spectrometric 식별에 대 한 각 단일 복잡 한에서 단백질을 더 집중에 한 단일 주머니에 같은 복잡 한을 대표 하는 여러 젤 밴드를 로드 하는 것이 좋습니다.
체 관 부 고분자 복합물의 개별 구성 요소를 식별 하려면 우리 초기 BN-페이지 2 차원 트리 스-Tricine-요소와 함께 결합 하 고 3 차원 단일 단백질의 분리를 달성 하기 위해 SDS 페이지. 여기, 때문에 다른 단백질 마이그레이션 동작 요소에 SDS 페이지 젤 높은 해상도와 분리를 관찰할 수 있습니다. 일반적으로, 단일 복잡 한에 속하는 단백질 젤에서 대각선으로 볼 수 있을 것입니다. 반면 단백질 선 아래 대표 더 많은 친수성 사람28 (그림 5, 그림 6)이이 선 위에 단백질 증가 hydrophobicity, 있다.
RNP 단지의 특성화, BN 페이지 젤 부분의 BN 북부 blotting 수행을 사용 했습니다. UV 방사선에 의해 나일론 막과 가교에 전체 레인의 blotting 후 RNA RNA 관련 프로브를 사용 하 여 그림 4에서 볼 수 있듯이 구상 수 있다. 여기 특정 tRNA는 한 특정 단지에만 표시 됩니다. 이 tRNA 바인딩 복합물의 단백질 구성 요소는 위에서 설명한 3D 젤 방식을 사용 하 여 추가 조사 수 있습니다. 대량 spectrometric 분석이 복잡이 한 무엇 BN 북부 blotting에 의해 발견 하는 tRNA 바인딩 활동 확인 주로 tRNA ligases 포함 했다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57097/57097fig1.jpg"> 그림 1: oilseed 강간의 체 관 부 수액에서 ribonucleoprotein 복합물의 분석의 흐름을 일. 샘플링 및 체 관 부 샘플의 준비, 후 BN 페이지 네이티브 단지를 별도로 수행 됩니다. 이러한 비 엔 페이지 젤 수 BN 북부 blotting에 의해 핵 산의 병렬 분석 및 질량 분석에 의해 복합물의 단백질 구성 요소 식별. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57097/57097fig2.jpg"> 그림 2: 체 관 부 수액 B. napus의 샘플링 및 순도 제어. 메 마른 피하 주사와 8 10 주 오래 된 oilseed 강간 식물의 꽃이 핌 줄기를 puncturing 후 exudate는 피 펫으로 수집 되 고는 얼음 처럼 차가운 반응 관 (a) RT-PCR 수행 체 관 부 샘플의 순도 확인로 전송 증폭 thioredoxin h, rubisco 작은 소 단위, 및 조직 관련 샘플 (b) RT-PCR 역전사 없이에서 꽃가루 외 투 단백질의 사본 제어 (-)으로 수행 되었다. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57097/57097fig3.jpg"> 그림 3: BN 페이지. 집중된 체 관 부 샘플 블루 기본 페이지의 도식 표현 B. napus. (a) 후 집중된 체 관 부 수액의 15-20 µ L로 그라데이션 단백질 젤 로드, BN 페이지 1 x 다크 블루 음극 버퍼 B 150 V 추운 방에 20-30 분 수행 됩니다. 그리고 버퍼 1 x 라이트 블루 음극 버퍼 B/10에 대 한 교환 페이지는 젤 전면 실행을 실행 하는 진한 파란색까지 150 V 120-180 분에 완료 되. BN 페이지 젤 4 가지 밴드를 대표 하는 4 개의 다른 높은 분자 무게 단지 표시. (b) 너무 작은 (c) 또는 (d) 체 관 부 단백질 너무 많이 로드 개별 단지의 가시성을 줄일 수 있습니다. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57097/57097fig4.jpg"> 그림 4: BN 북부 더럽혀. 북부 방법 blotting BN의 도식 적인 표현입니다. (BN-페이지의 a)는 레인 blotting 세미 드라이 하 여 나일론 막에 전송 됩니다. 자외선 가교 및 사전 교 잡, 후 막 RNA 특정 프로브 (여기는 메티오닌 tRNA 관련 조사), 밤 동안 3'-끝에 교 잡 오븐에서 biotinylated는 인 큐베이 팅. 무료 프로브 단계 세척 하 여 제거 되 고 RNA의 검출 streptavidin HRP 켤레와 luminol에 의해 수행 됩니다. 이 방법을 사용 하 여, 복잡 한 4 억 페이지에서 메티오닌을 포함 관찰 tRNA. (b) Coomassie 스테인드 젤과 tRNA 오 닮은 마이그레이션 차이 피하기 위해 병렬로 실행 하는 두 개의 다른 젤 레인. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57097/57097fig5.jpg"> 그림 5: 3D 페이지. 3D 페이지 접근의 도식 적인 표현입니다. 같은 단지에서 여러 밴드 BN 페이지 젤에서 excised, 버퍼 로드 incubated 되며 2 차원 트리 스-Tricine-우 레 아-페이지의 한 우물으로 전송. 전기 이동 법, 후 전체 젤 레인 잘라, 산 성 산 성 버퍼에서 세척, equilibrated, 있으며 15 %SDS 페이지 젤에 배치. 3 차원 페이지 후 분리 된 단백질 Coomassie 스테인드 및 질량 분석에 의해 분석 됩니다. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57097/57097fig6.jpg"> 그림 6: 대표 결과 3D 페이지 후. 첫 번째 차원 BN 페이지 내에서 여러 단지 나타났다. 그들의 단백질 구성 요소 결과 대각선 자리 패턴에 두 후속 변성 페이지에 추가 구분 수 있습니다. <a href="//cloudflare.jove.com/files/ftp_upload/57097/57097fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>프로브</td>
			<td>시퀀스</td>
		</tr>
<tr>
<td>Thioredoxin h</td>
			<td>
 앞으로: CTCAAGGCAGCCAAAGAATC 역: ATGGCCTGAACATCGAACTC</td>
		</tr>
<tr>
<td>Rubisco 작은 사슬</td>
			<td>
 앞으로: TTCACCGGCTTGAAGTCATC 역: CCGGGTACTCCTTCTTGCAT</td>
		</tr>
<tr>
<td>화분 외 투 단백질 BRU77666</td>
			<td>
 앞으로: TCAGAACTGGAGCTTCAACG 역: TTCCTTAATGGCCTCAGTGG</td>
		</tr>
</tbody></table>표 1: 체 관 부 샘플 순도 제어에 사용 되는 뇌관. 체 관 부 샘플 순도 확인 rubisco 작은 사슬, thioredoxin h 및 꽃가루 외 투 단백질을 위한 특정 뇌관 cDNA 증폭에 사용할 수 있습니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>버퍼 및 솔루션</td>
			<td colspan="2">콘텐츠</td>
			<td>댓글</td>
		</tr>
<tr>
<td>다크 블루 음극 버퍼 B</td>
			<td colspan="2">15mm 두번째-트리 스 pH 7.0 50 mM Tricine 0.02% (w/v) Coomassie 파란 G250</td>
			<td>제조 법은 Fiala 외. 17 에서 적응 7.0에 pH는 조정 한다 10 배 재고 버퍼를 만들 수 있습니다.</td>
		</tr>
<tr>
<td>라이트 블루 음극 버퍼 B/10</td>
			<td colspan="2">15mm 두번째-트리 스 pH 7.0 50 mM Tricine 0.002% (w/v) Coomassie 파란 G250</td>
			<td>버퍼는 음극 버퍼 B Coomassie 없이 음극 버퍼를 diluting 하 여 준비 될 수 있다</td>
		</tr>
<tr>
<td>양극 버퍼</td>
			<td colspan="2">
 50mm 두번째-트리 스 pH 7.0</td>
			<td>버퍼 재고 솔루션 x 10으로 준비 될 수 있다</td>
		</tr>
<tr>
<td>SDS 샘플 버퍼 x 2</td>
			<td colspan="2">
 125 mM Tris HCl pH 6.8 4% SDS 20% 글리세롤 0.2 M DTT 0.02% (w/v) bromophenol 블루</td>
			<td></td>
		</tr>
<tr>
<td>전송 버퍼 1 버퍼 x TBE</td>
			<td colspan="2">
 89 mM Tris pH 7.6 89 m m 붕 2 mM EDTA</td>
			<td>TBE 버퍼 만든 고 5 배 또는 10 x 주식으로 저장 될 수 있습니다. 사용 RNase 자유 이온된 물에 중요 하다.</td>
		</tr>
<tr>
<td>SSC 버퍼 x 2</td>
			<td colspan="2">
 300 mM NaCl 30 m m 나3시트르산 pH 7.0</td>
			<td></td>
		</tr>
<tr>
<td>젤 버퍼 x 3</td>
			<td colspan="2">
 3 M 트리 1 M HCl 0.3% SDS pH 8.45</td>
			<td>Schägger 19 에서 적응 하는 레시피
</td>
		</tr>
<tr>
<td>트리 스 Tricine 젤 솔루션 A</td>
			<td colspan="2">
 10 ml: 30% 아크릴-bisacrylamide (29: 1) 3.34 mL 6 M 요소 3 배 젤 버퍼 3.34 mL 70% 글리세롤 1.4 mL ddH2O 10 mL을 추가 10% APS 40 Μ L TEMED 4 Μ L</td>
			<td>무게 6 M 요소와 3 배 젤 버퍼, 아크릴 bisacrylamide 솔루션 및 70 %gycerol 추가 합니다. 하는 요소를 solubilize 물 욕조에 60 ° C에가 열. DdH2O 10 mL, 10% 추가 APS와 TEMED 중 합에 대 한 마지막으로.</td>
		</tr>
<tr>
<td>트리 스 Tricine 젤 솔루션 B</td>
			<td colspan="2">
 6 ml: 30% 아크릴-bisacrylamide (29: 1) 0.8 mL 6 M 요소 3 배 젤 버퍼 1.5 mL ddH2O 6 mL을 추가 10% APS 45 Μ L 4.5 TEMED Μ L</td>
			<td>6 M 요소 무게 고 젤 버퍼와 아크릴 bisacrylamide 솔루션 x 3를 추가 합니다. 하는 요소를 solubilize 물 욕조에 60 ° C에가 열. DdH2O 10 mL, 10% 추가 APS와 TEMED 중 합에 대 한 마지막으로.</td>
		</tr>
<tr>
<td>트리 스 Tricine 실행 버퍼 (양극) x 1</td>
			<td colspan="2">
 100 mM Tris 22.5 m m HCl pH 8.9</td>
			<td>Schägger 19 에서 적응 하는 레시피
</td>
		</tr>
<tr>
<td>트리 스 Tricine 실행 버퍼 (음극) x 1</td>
			<td colspan="2">
 100 mM Tris 100 mM Tricine 1% SDS pH 8.25</td>
			<td>Schägger 19 에서 적응 하는 레시피
</td>
		</tr>
<tr>
<td>산 성 버퍼</td>
			<td colspan="2">
 100 mM Tris 100 mM 아세트산</td>
			<td></td>
		</tr>
<tr>
<td>4 %SDS 겹쳐 쌓이는 젤</td>
			<td colspan="2">
 2 ml. ddH2O 1.4 mL 30% 아크릴-bisacrylamide (37.5:1) 0.33 mL 1 M Tris pH 6.8 0.25 mL 10% SDS 20 Μ L 10% APS 20 Μ L TEMED 2 Μ L</td>
			<td></td>
		</tr>
<tr>
<td>15 %SDS 젤을 분리</td>
			<td colspan="2">
 10 ml: ddH2O 2.3 mL 30% 아크릴-bisacrylamide (37.5:1) 5 mL 1.5 M Tris pH 8.8 2.5 mL 10% SDS 100 Μ L 10% APS 100 Μ L TEMED 4 Μ L</td>
			<td></td>
		</tr>
<tr>
<td>SDS 실행 버퍼 x 1</td>
			<td colspan="2">
 25mm Tris 192 m m 글리신 0.1% SDS</td>
			<td></td>
		</tr>
<tr>
<td>Coomassie 솔루션 얼룩</td>
			<td colspan="2">
 5% (w/v) 황산 알루미늄-(14-18)-하이드 레이트 10% (v/v) 에탄올 (96%) 2% (v/v) 직접 산 (85%) 0.02% (w/v) Coomassie 화려한 블루 G-250 
			 </td>
			<td></td>
		</tr>
<tr>
<td>ULTRAhyb 磁 교 잡 버퍼</td>
			<td colspan="2"></td>
			<td>Ambion, 생활 기술</td>
		</tr>
</tbody></table>표 2: 솔루션 및 버퍼 조리법. 모든 버퍼 및 3D 페이지 분석에 필요한 솔루션의 목록입니다.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>자리 아니입니다.</td>
			<td>MW obs. [kDa]</td>
			<td colspan="2">식별</td>
			<td>유기 체</td>
			<td>아니오를 취득.</td>
			<td>MW [kDa]</td>
			<td>마스코트 점수</td>
		</tr>
<tr>
<td>CIV_1</td>
			<td>130</td>
			<td colspan="2">상 상속 질병 저항 단백질 At4g19050</td>
			<td>B. napus</td>
			<td>CDX78917</td>
			<td>131.1</td>
			<td>110</td>
		</tr>
<tr>
<td>CIV_2</td>
			<td>130</td>
			<td colspan="2">상 상속 질병 저항 단백질 At4g19050</td>
			<td>B. napus</td>
			<td>CDX78917</td>
			<td>131.1</td>
			<td>89</td>
		</tr>
<tr>
<td>CIV_3</td>
			<td>100</td>
			<td colspan="2">열 충격 70 kDa 단백질 14 처럼</td>
			<td>B. napus</td>
			<td>XP_013748865</td>
			<td>89.9</td>
			<td>113</td>
		</tr>
<tr>
<td>CIV_4</td>
			<td>90</td>
			<td colspan="2">진 핵 신장 요인 2 세포 분열 조절 단백질 48 체 A</td>
			<td>B. napus B. napus</td>
			<td>CDX90241 CDY41316.1</td>
			<td>89.5 89.5</td>
			<td>111 197</td>
		</tr>
<tr>
<td>CIV_5</td>
			<td>85</td>
			<td colspan="2">열 충격 단백질 90-2-같은</td>
			<td>B. rapa</td>
			<td>XP_009132342</td>
			<td>79.8</td>
			<td>172</td>
		</tr>
<tr>
<td>CIV_6</td>
			<td>80</td>
			<td colspan="2">트레오닌-tRNA 리가 글리신-tRNA 리가</td>
			<td>B. 올레라케아 B. napus</td>
			<td>XP_013599115 CDY43195</td>
			<td>81.5 80.8</td>
			<td>110 88</td>
		</tr>
<tr>
<td>CIV_7</td>
			<td>70</td>
			<td colspan="2">열 충격 단백질 70 kDa 리 신-tRNA 리가 같은</td>
			<td>B. 올레라케아 B. napus</td>
			<td>XP_013685267 XP_013747530</td>
			<td>67.8 69.9</td>
			<td>230 150</td>
		</tr>
<tr>
<td>CIV_8</td>
			<td>65</td>
			<td colspan="2">Myrosinase Aspartate-tRNA 리가 2 아스파라긴-tRNA 리가 1</td>
			<td>B. napus B. napus B. napus</td>
			<td>ABQ42337 XP_013670803 XP_013729126</td>
			<td>60.6 61.6 63.5</td>
			<td>183 141 153</td>
		</tr>
<tr>
<td>CIV_9</td>
			<td>60</td>
			<td colspan="2">Myrosinase</td>
			<td>B. napus</td>
			<td>ABQ42337</td>
			<td>60.6</td>
			<td>164</td>
		</tr>
<tr>
<td>CIV_10</td>
			<td>55</td>
			<td colspan="2">Adenosylhomocysteinase 2-같은</td>
			<td>B. rapa</td>
			<td>XP_009135865</td>
			<td>53.1</td>
			<td>139</td>
		</tr>
<tr>
<td>CIV_11</td>
			<td>55</td>
			<td colspan="2">신장 요인 1 알파 1-같은</td>
			<td>B. 올레라케아</td>
			<td>XP_013586115</td>
			<td>51.9</td>
			<td>161</td>
		</tr>
<tr>
<td>CIV_12</td>
			<td>50</td>
			<td colspan="2">시스 틴 lyase CORI3 처럼</td>
			<td>B. napus</td>
			<td>XP_013653143</td>
			<td>48.1</td>
			<td>237</td>
		</tr>
<tr>
<td>CIV_13</td>
			<td>44</td>
			<td colspan="2">시스 틴 lyase CORI3 처럼</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48.3</td>
			<td>213</td>
		</tr>
<tr>
<td>CIV_14</td>
			<td>38</td>
			<td colspan="2">과 당-bisphosphate aldolase</td>
			<td>B. rapa</td>
			<td>XP_009115993</td>
			<td>38.4</td>
			<td>226</td>
		</tr>
<tr>
<td>CIV_15</td>
			<td>45</td>
			<td colspan="2">시스 틴 lyase CORI3 처럼</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48.3</td>
			<td>219</td>
		</tr>
<tr>
<td>CIV_16</td>
			<td>45</td>
			<td colspan="2">시스 틴 lyase CORI3</td>
			<td>B. rapa</td>
			<td>CDY69765</td>
			<td>46.9</td>
			<td>209</td>
		</tr>
<tr>
<td>CIV_17</td>
			<td>38</td>
			<td colspan="2">과 당-bisphosphate aldolase</td>
			<td>B. rapa</td>
			<td>XP_009115993</td>
			<td>38.4</td>
			<td>124</td>
		</tr>
<tr>
<td>CIV_18</td>
			<td>18</td>
			<td colspan="2">Peptidyl-prolyl cis 트랜스 isomerase CYP18-3-처럼</td>
			<td>B. napus</td>
			<td>XP_009101932</td>
			<td>18.3</td>
			<td>128</td>
		</tr>
<tr>
<td>CIV_19</td>
			<td>45</td>
			<td colspan="2">시스 틴 lyase CORI3 처럼</td>
			<td>B. rapa</td>
			<td>XP_009108611</td>
			<td>48.3</td>
			<td>177</td>
		</tr>
</tbody></table>표 3: 복잡 한 IV에서 단백질 구성 요소 식별. 여러 tRNA ligases와 추가 단백질 tRNA 바인딩 단지 내 발견 되었습니다 후 3D 페이지 spectrometric 분석을 대량 MALDI TOF를 사용 하 여.

Watch this Scientific Journal Video about Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes at JoVE.com

Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

체 관 부 수액 샘플링 브라시카 napus 단백질 및 Ribonucleoprotein 단지의 3D-페이지에서

여기에 우리가 큰 네이티브 단백질: 단백질 및 단백질의 단백질 구성을 분석 하는 프로토콜을 제시: oilseed 강간에서 핵 산 복합물 (B. napus) 체 관 부 exudate 블루 결합 3D polyacrylamide 젤 전기 이동 법 (페이지) 방식을 사용 하 여 네이티브 대량 spectrometric 식별 뒤의 변성 페이지 두 개 (10 억).

Sampling the phloem of higher plants is often laborious and significantly dependent on the plant species. However, proteome studies under denaturing ...

phloem-sap-sampling-from-brassica-napus-for-3d-page-protein

Research

Education

JoVE Journal

JoVE Core

Biology

Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

Fundamentals

Macromolecules

SCIENTISTS IN ACTION

13.7K 조회수.  Universität Hamburg. 여기에 우리가 큰 네이티브 단백질: 단백질 및 단백질의 단백질 구성을 분석 하는 프로토콜을 제시: oilseed 강간에서 핵 산 복합물 (B. napus) 체 관 부 exudate 블루 결합 3D polyacrylamide 젤 전기 이동 법 (페이지) 방식을 사용 하 여 네이티브 대량 spectrometric 식별 뒤의 변성 페이지 두 개 (10 억).

비디오: Phloem Sap Sampling from Brassica napus for 3D-PAGE of Protein and Ribonucleoprotein Complexes

Purification and Visualization of Influenza A Viral Ribonucleoprotein Complexes

The influenza A viral genome consists of eight negative-sense, single stranded RNA molecules, individually packed with multiple copies of the influenza A nucleoprotein (NP) into viral ribonulceoprotein particles (vRNPs). The influenza vRNPs are enclosed within the viral envelope. During cell entry, however, these vRNP complexes are released into the cytoplasm, where they gain access to the host nuclear transport machinery. In order to study the nuclear import of influenza vRNPs and the replication of the influenza genome, it is useful to work with isolated vRNPs so that other components of the virus do not interfere with these processes. Here, we describe a procedure to purify these vRNPs from the influenza A virus. The procedure starts with the disruption of the influenza A virion with detergents in order to release the vRNP complexes from the enveloped virion. The vRNPs are then separated from the other components of the influenza A virion on a 33-70% discontinuous glycerol gradient by velocity sedimentation. The fractions obtained from the glycerol gradient are then analyzed on via SDS-PAGE after staining with Coomassie blue. The peak fractions containing NP are then pooled together and concentrated by centrifugation. After concentration, the integrity of the vRNPs is verified by visualization of the vRNPs by transmission electron microscopy after negative staining. The glycerol gradient purification is a modification of that from Kemler et al. (1994)1, and the negative staining has been performed by Wu et al. (2007).2

The genome of the influenza A virus consists of eight separate complexes of RNA and proteins, termed viral ribonucleoprotein complexes (vRNPs). This paper describes the glycerol gradient purification and transmission electron microscopy visualization of influenza A vRNPs.

인플루엔자 바이러스성 Ribonucleoprotein의 단지의 정화 및 시각화

The influenza A viral genome consists of eight negative-sense, single stranded RNA molecules, individually packed with multiple copies of the influenza A ...

연구

생물학

Identification of protein complexes with quantitative proteomics in S. cerevisiae

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as important intracellular signalling molecules. However, unlike proteins, lipids are small hydrophobic molecules that traffic primarily by poorly described nonvesicular routes, which are hypothesized to occur at membrane contact sites (MCSs). MCSs are regions where the endoplasmic reticulum (ER) makes direct physical contact with a partnering organelle, e.g., plasma membrane (PM). The ER portion of ER-PM MCSs is enriched in lipid-synthesizing enzymes, suggesting that lipid synthesis is directed to these sites and implying that MCSs are important for lipid traffic. Yeast is an ideal model to study ER-PM MCSs because of their abundance, with over 1000 contacts per cell, and their conserved nature in all eukaryotes. Uncovering the proteins that constitute MCSs is critical to understanding how lipids traffic is accomplished in cells, and how they act as signaling molecules. We have found that an ER called Scs2p localize to ER-PM MCSs and is important for their formation. We are focused on uncovering the molecular partners of Scs2p. Identification of protein complexes traditionally relies on first resolving purified protein samples by gel electrophoresis, followed by in-gel digestion of protein bands and analysis of peptides by mass spectrometry. This often limits the study to a small subset of proteins. Also, protein complexes are exposed to denaturing or non-physiological conditions during the procedure. To circumvent these problems, we have implemented a large-scale quantitative proteomics technique to extract unbiased and quantified data. We use stable isotope labeling with amino acids in cell culture (SILAC) to incorporate staple isotope nuclei in proteins in an untagged control strain. Equal volumes of tagged culture and untagged, SILAC-labeled culture are mixed together and lysed by grinding in liquid nitrogen. We then carry out an affinity purification procedure to pull down protein complexes. Finally, we precipitate the protein sample, which is ready for analysis by high-performance liquid chromatography/ tandem mass spectrometry. Most importantly, proteins in the control strain are labeled by the heavy isotope and will produce a mass/ charge shift that can be quantified against the unlabeled proteins in the bait strain. Therefore, contaminants, or unspecific binding can be easily eliminated. By using this approach, we have identified several novel proteins that localize to ER-PM MCSs. Here we present a detailed description of our approach. 

Here we describe a new quantitative proteomics technique for identifying protein complexes in Saccharomyces cerevisiae. In this study, we have used the SILAC method together with affinity purification followed by tandem mass spectrometry to identify with high specificity the binding partners of an ER protein, Scs2p.

S. cerevisiae의의 양적 proteomics와 단백질 단지의 식별

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as ...

Using the GELFREE 8100 Fractionation System for Molecular Weight-Based Fractionation with Liquid Phase Recovery

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based fractionation. The system is comprised of single-use, 8-sample capacity cartridges and a benchtop GELFREE Fractionation Instrument. During separation, a constant voltage is applied between the anode and cathode reservoirs, and each protein mixture is electrophoretically driven from a loading chamber into a specially designed gel column gel. Proteins are concentrated into a tight band in a stacking gel, and separated based on their respective electrophoretic mobilities in a resolving gel. As proteins elute from the column, they are trapped and concentrated in liquid phase in the collection chamber, free of the gel. The instrument is then paused at specific time intervals, and fractions are collected using a pipette. This process is repeated until all desired fractions have been collected. If fewer than 8 samples are run on a cartridge, any unused chambers can be used in subsequent separations.
This novel technology facilitates the quick and simple separation of up to 8 complex protein mixtures simultaneously, and offers several advantages when compared to previously available fractionation methods. This system is capable of fractionating up to 1mg of total protein per channel, for a total of 8mg per cartridge. Intact proteins over a broad mass range are separated on the basis of molecular weight, retaining important physiochemical properties of the analyte. The liquid phase entrapment provides for high recovery while eliminating the need for band or spot cutting, making the fractionation process highly reproducible1.

The accompanying video describes the use of the GELFREE 8100 Fractionation System, which partitions complex protein samples on the basis of molecular weight and recovers the fractions in liquid phase. The video describes how the technology works, how it is used, and provides resultant data, with polyacrylamide gel electrophoresis analysis of fractionated bovine liver homogenate.

액상 복구와 분자량 기반 분류에 대한 GELFREE 8100 분획화 시스템을 사용하여

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based ...

Analyzing Large Protein Complexes by Structural Mass Spectrometry

Living cells control and regulate their biological processes through the coordinated action of a large number of proteins that assemble themselves into an array of dynamic, multi-protein complexes1. To gain a mechanistic understanding of the various cellular processes, it is crucial to determine the structure of such protein complexes, and reveal how their structural organization dictates their function. Many aspects of multi-protein complexes are, however, difficult to characterize, due to their heterogeneous nature, asymmetric structure, and dynamics. Therefore, new approaches are required for the study of the tertiary levels of protein organization.
One of the emerging structural biology tools for analyzing macromolecular complexes is mass spectrometry (MS)2-5. This method yields information on the complex protein composition, subunit stoichiometry, and structural topology. The power of MS derives from its high sensitivity and, as a consequence, low sample requirement, which enables examination of protein complexes expressed at endogenous levels. Another advantage is the speed of analysis, which allows monitoring of reactions in real time. Moreover, the technique can simultaneously measure the characteristics of separate populations co-existing in a mixture. 
Here, we describe a detailed protocol for the application of structural MS to the analysis of large protein assemblies. The procedure begins with the preparation of gold-coated capillaries for nanoflow electrospray ionization (nESI). It then continues with sample preparation, emphasizing the buffer conditions which should be compatible with nESI on the one hand, and enable to maintain complexes intact on the other. We then explain, step-by-step, how to optimize the experimental conditions for high mass measurements and acquire MS and tandem MS spectra. Finally, we chart the data processing and analyses that follow. Rather than attempting to characterize every aspect of protein assemblies, this protocol introduces basic MS procedures, enabling the performance of MS and MS/MS experiments on non-covalent complexes. Overall, our goal is to provide researchers unacquainted with the field of structural MS, with knowledge of the principal experimental tools.

Mass spectrometry has proven to be a valuable tool for analyzing large protein complexes. This method enables insights into the composition, stoichiometry and overall architecture of multi-subunit assemblies. Here, we describe, step-by-step, how to perform a structural mass spectrometry analysis, and characterize macromolecular structures.

구조 질량 분광법에 의해 큰 단백질 단지 분석

Living cells control and regulate their biological processes through the coordinated action of a large number of proteins that assemble themselves into an ...

A Noninvasive Hair Sampling Technique to Obtain High Quality DNA from Elusive Small Mammals

Noninvasive genetic sampling approaches are becoming increasingly important to study wildlife populations. A number of studies have reported using noninvasive sampling techniques to investigate population genetics and demography of wild populations1. This approach has proven to be especially useful when dealing with rare or elusive species2. While a number of these methods have been developed to sample hair, feces and other biological material from carnivores and medium-sized mammals, they have largely remained untested in elusive small mammals. In this video, we present a novel, inexpensive and noninvasive hair snare targeted at an elusive small mammal, the American pika (Ochotona princeps). We describe the general set-up of the hair snare, which consists of strips of packing tape arranged in a web-like fashion and placed along travelling routes in the pikas&#x2019; habitat. We illustrate the efficiency of the snare at collecting a large quantity of hair that can then be collected and brought back to the lab. We then demonstrate the use of the DNA IQ system (Promega) to isolate DNA and showcase the utility of this method to amplify commonly used molecular markers including nuclear microsatellites, amplified fragment length polymorphisms (AFLPs), mitochondrial sequences (800bp) as well as a molecular sexing marker. Overall, we demonstrate the utility of this novel noninvasive hair snare as a sampling technique for wildlife population biologists. We anticipate that this approach will be applicable to a variety of small mammals, opening up areas of investigation within natural populations, while minimizing impact to study organisms.

We present a noninvasive sampling approach to efficiently collect hair samples from elusive small mammals, as shown for the American pika. We demonstrate the utility of this method by extracting DNA from sampled hair and amplifying several types of molecular markers commonly used in studies of wildlife ecology and conservation.

엘루시브 작은 포유류의 고품질 DNA를 얻기 위해 비침 투 헤어 샘플링 기법

Noninvasive genetic sampling approaches are becoming increasingly important to study wildlife populations. A number of studies have reported using ...

Biochemical Reconstitution of Steroid Receptor&#x2022;Hsp90 Protein  Complexes and Reactivation of Ligand Binding

Hsp90 is an essential and highly abundant molecular chaperone protein that has been found to regulate more than 150 eukaryotic signaling proteins, including transcription factors (e.g. nuclear receptors, p53) and protein kinases (e.g. Src, Raf, Akt kinase) involved in cell cycling, tumorigenesis, apoptosis, and multiple eukaryotic signaling pathways 1,2. Of these many 'client' proteins for hsp90, the assembly of steroid receptor&bull;hsp90 complexes is the best defined (Figure 1). We present here an adaptable glucocorticoid receptor (GR) immunoprecipitation assay and in vitro GR&bull;hsp90 reconstitution method that may be readily used to probe eukaryotic hsp90 functional activity, hsp90-mediated steroid receptor ligand binding, and molecular chaperone cofactor requirements. For example, this assay can be used to test hsp90 cofactor requirements and the effects of adding exogenous compounds to the reconstitution process. 
The GR has been a particularly useful system for studying hsp90 because the receptor must be bound to hsp90 to have an open ligand binding cleft that is accessible to steroid 3. Endogenous, unliganded GR is present in the cytoplasm of mammalian cells noncovalently bound to hsp90. As found in the endogenous GR&bull;hsp90 heterocomplex, the GR ligand binding cleft is open and capable of binding steroid. If hsp90 dissociates from the GR or if its function is inhibited, the receptor is unable to bind steroid and requires reconstitution of the GR&bull;hsp90 heterocomplex before steroid binding activity is restored 4 . GR can be immunoprecipitated from cell cytosol using a monoclonal antibody, and proteins such as hsp90 complexed to the GR can be assayed by western blot. Steroid binding activity of the immunoprecipitated GR can be determined by incubating the immunopellet with [3H]steroid. 
Previous experiments have shown hsp90-mediated opening of the GR ligand binding cleft requires hsp70, a second molecular chaperone also essential for eukaryotic cell viability. Biochemical activity of hsp90 and hsp70 are catalyzed by co-chaperone proteins Hop, hsp40, and p23 5. A multiprotein chaperone machinery containing hsp90, hsp70, Hop, and hsp40 are endogenously present in eukaryotic cell cytoplasm, and reticulocyte lysate provides a chaperone-rich protein source 6. 
In the method presented, GR is immunoadsorbed from cell cytosol and stripped of the endogenous hsp90/hsp70 chaperone machinery using mild salt conditions. The salt-stripped GR is then incubated with reticulocyte lysate, ATP, and K+, which results in the reconstitution of the GR&bull;hsp90 heterocomplex and reactivation of steroid binding activity 7. This method can be utilized to test the effects of various chaperone cofactors, novel proteins, and experimental hsp90 or GR inhibitors in order to determine their functional significance on hsp90-mediated steroid binding 8-11.

An in vitro method for preparing functional glucocorticoid receptor (GR)&#x2022;hsp90 protein complexes from purified proteins and cellular lysates is described. The method utilizes immunoadsorption of recombinant GR followed by salt-stripping and protein complex reconstitution. The importance of cofactors and buffer conditions are discussed, as are potential method applications.

스테로이드 수용체의 생화 학적 리간드의 Reconstitution • Hsp90 단백질 단지와 재가입 바인딩

Hsp90 is an essential and highly abundant molecular chaperone protein that has been found to regulate more than 150 eukaryotic signaling proteins, ...

Method for the Isolation and Identification of mRNAs, microRNAs and Protein Components of Ribonucleoprotein Complexes from Cell Extracts using RIP-Chip

As a result of the development of high-throughput sequencing and efficient microarray analysis, global gene expression analysis has become an easy and readily available form of data collection. In many research and disease models however, steady state levels of target gene mRNA does not always directly correlate with steady state protein levels. Post-transcriptional gene regulation is a likely explanation of the divergence between the two. Driven by the binding of RNA Binding Proteins (RBP), post-transcriptional regulation affects mRNA localization, stability and translation by forming a Ribonucleoprotein (RNP) complex with target mRNAs. Identifying these unknown de novo mRNA targets from cellular extracts in the RNP complex is pivotal to understanding mechanisms and functions of the RBP and their resulting effect on protein output. This protocol outlines a method termed RNP immunoprecipitation-microarray (RIP-Chip), which allows for the identification of specific mRNAs associated in the ribonucleoprotein complex, under changing experimental conditions, along with options to further optimize an experiment for the individual researcher. With this important experimental tool, researchers can explore the intricate mechanisms associated with post-transcriptional gene regulation as well as other ribonucleoprotein interactions.

A step by step protocol to isolating and identifying RNA associated complexes through RIP-Chip.

RIP 칩을 사용하여 세포 추출물에서 mRNAs, microRNAs 및 Ribonucleoprotein 단지의 단백질 구성 요소의 분리 및 확인에 방법

As a result of the development of high-throughput sequencing and efficient microarray analysis, global gene expression analysis has become an easy and ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

식물 단백질 복합체의 번역 후 변형의 확인

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

An in vivo Crosslinking Approach to Isolate Protein Complexes From Drosophila Embryos

Many cellular processes are controlled by multisubunit protein complexes. Frequently these complexes form transiently and require native environment to assemble. Therefore, to identify these functional protein complexes, it is important to stabilize them in vivo before cell lysis and subsequent purification. Here we describe a method used to isolate large bona fide protein complexes from Drosophila embryos. This method is based on embryo permeabilization and stabilization of the complexes inside the embryos by in vivo crosslinking using a low concentration of formaldehyde, which can easily cross the cell membrane. Subsequently, the protein complex of interest is immunopurified followed by gel purification and analyzed by mass spectrometry. We illustrate this method using purification of a Tudor protein complex, which is essential for germline development. Tudor is a large protein, which contains multiple Tudor domains - small modules that interact with methylated arginines or lysines of target proteins. This method can be adapted for isolation of native protein complexes from different organisms and tissues.

An in vivo Crosslinking Approach to Isolate Protein Complexes From Drosophila Embryos

Multi-component protein complexes play crucial roles during cellular function and development. Here we describe a method used to isolate native protein complexes from Drosophila embryos after in vivo crosslinking followed by purification of the crosslinked complexes for subsequent structure-function analysis.

생체</em에서 단백질 복합체를 분리> 가교 접근 초파리 태아

Many cellular processes are controlled by multisubunit protein complexes. Frequently these complexes form transiently and require native environment to ...

Sampling Blood from the Lateral Tail Vein of the Rat

Blood samples are commonly obtained in many experimental contexts to measure targets of interest, including hormones, immune factors, growth factors, proteins, and glucose, yet the composition of the blood is dynamically regulated and easily perturbed. One factor that can change the blood composition is the stress response triggered by the sampling procedure, which can contribute to variability in the measures of interest. Here we describe a procedure for blood sampling from the lateral tail vein in the rat. This procedure offers significant advantages over other more commonly used techniques. It permits rapid sampling with minimal pain or invasiveness, without anesthesia or analgesia. Additionally, it can be used to obtain large volume samples (upwards of 1 ml in some rats), and it may be used repeatedly across experimental days. By minimizing the stress response and pain resulting from blood sampling, measures can more accurately reflect the true basal state of the animal, with minimal influence from the sampling procedure itself.

Blood samples are useful for assessing biomarkers of physiological states or disease in vivo. Here we describe the methodology to sample blood from the lateral tail vein in the rat. This method provides rapid samples with minimal pain and invasiveness.

쥐의 측면 꼬리 정맥에서 혈액을 샘플링

Blood samples are commonly obtained in many experimental contexts to measure targets of interest, including hormones, immune factors, growth factors, ...