Los autores desean agradecer a Moriarity Branden, Largaespada David, y Keng Vicente de la Universidad de Minnesota, y Dupuy Adán en la Universidad de Iowa por su ayuda en el desarrollo del protocolo descrito anteriormente.

1. Crianza y Envejecimiento de Animales Transgénicos <ol><li> Seleccione las cepas de ratones transgénicos apropiados para su experimento. Un experimento típico se utilizan tres líneas transgénicas; una transposasa condicional del ratón, un ratón que alberga un concatémero de transposones, y un ratón que expresan la recombinasa Cre en las células que se cree que las células de origen para el cáncer deseada. Si el cáncer que está siendo modelado tiene una mutación conocida en un gran porcentaje de los pacientes puede ser deseable incluir esta mutación en el inicio. Ejemplos de estos &quot;predisponentes&quot; mutaciones incluyen Kras activados, TP53 dominantes negativos o un alelo Pten floxed. Mediante la adición de una mutación que predispone el modelo puede representar mejor el cáncer humano (véase 1.3). Transposasa Varios Bella Durmiente transposón y ratones están disponibles en el Instituto Nacional del Cáncer Ratón Repository ( <a href="http://mouse.ncifcrf.gov/" target="_blank">http://mouse.ncifcrf.gov/</a> ). </li><li> Ratones raza transposasa condicionales con ratones portadores de los transposones de obtener eventualmente ratones homocigotos para ambos alelos si es posible. Raza descendencia homocigota para ratones que expresan la recombinasa Cre para generar sus triples ratones transgénicos experimentales (Figura 2). Nota: La obtención de ratones homocigotos no siempre es posible o ideal. Por ejemplo, p53 negativos ratones homocigotos dominantes son mucho más difíciles de criar que los ratones heterocigotos. Además, es útil para asegurarse de que las camadas seguir la genética mendeliana para confirmar que el método de obtención tiene éxito. </li><li> Si se utiliza un fondo predispuesto, ratones primera raza con la transposasa a ratones con el alelo de predisposición. Simultáneamente, los ratones de raza expresar Cre recombinasa a ratones portadores de los transposones. Crear ratones homocigotos para cada alelo, si es posible. Por último, criar la descendencia homocigota de los planes de mejoramiento dos anteriores para generar anim cuádruple transgénico experimentalals. </li><li> Además de los animales de experimentación, generar cohortes de control de ratones. El grupo de control normalmente consta de camada de la cría experimental que sólo heredan dos de los tres alelos (Figura 2). En el caso de un fondo predispuesto, ratones, incluyendo tres de los cuatro alelos también será necesario. </li><li> Monitorear los ratones experimentales y de control al día durante el desarrollo del tumor y / o moribundity. Sigue a tu animal de Atención Institucional y el empleo Comisión (IACUC) requisitos para la cría de animales. Además, es típico para determinar una edad en la que se va a sacrificar a un animal si no se ha convertido aún moribundo. Dieciocho meses es una edad típica en la que los ratones son sacrificados. </li></ol> 2. La necropsia de animales transgénicos <table border="1"><tbody><tr><td> Nombre del reactivo </td><td> Empresa </td><td> Número de catálogo </td></tr><tr><td> Sure-Seal Inducción de Cámara </td><td> Brain Tree Científico </td><td> EZ-177 </td></tr><tr><td> Criovial </td><td> BioExpress </td><td> C-3355-2 </td></tr><tr><td> 10% formalina tamponada </td><td> Sigma Aldrich </td><td> HT501128-4L </td></tr></tbody></table> Reactivos Tabla 1. Necesario. <ol><li> Cuando el ratón está moribundo o se ha llegado al final de la vida útil determinada, practicar la eutanasia en animales utilizando un CO 2 cámara siguiendo las directrices de su IACUC. Generalmente, colocar al animal en una cámara de gas limpio, abrir el tanque de gas y ajustar el regulador a leer no más de 5 libras por pulgada cuadrada. Llene lentamente para minimizar la irritación nasal y ocular y la aversión al CO 2. Asegúrese de que el corazón del animal ya no late y no responde cuando se toca los ojos. </li><li> Vaporizador exterior de ratón sacrificado con 70% de etanol. </li><li> Coloque el ratón sobre una tabla necropsia y asegurar con pasadores de disección. Con unas tijeras und pinzas para abrir ratón y extraer los órganos. La determinación de los órganos que deben recogerse proyecto es dependiente. Sin embargo, se recomienda siempre para recoger el bazo y el hígado como estos órganos a menudo dar importante información sobre por qué el ratón estaba moribundo. También recoger el esternón para el análisis del potencial de médula ósea. Además, siempre es beneficioso para recoger cualquier órgano o tejido que parece anormal. </li><li> Tejidos y tumores que están recogidos deben ser dividida en cuatro secciones. Una sección se fija en 10% formalina tamponada durante 18 h seguido por 70% de etanol. Esta sección se puede utilizar para la tinción H &amp; E y / o IHC. Las tres secciones restantes, que son generalmente de 50 a 100 mg de tamaño, son congelaron rápidamente en nitrógeno líquido. Éstos se pueden utilizar para el ADN, el ARN y el aislamiento de proteínas. </li><li> Tirar los pañuelos de la canal y el resto según las directrices de IACUC. </li></ol> 3. Aislamiento de ADN genómico de tumores <table border="1"><tbody><tr><td> &lt;Nombre&gt; fuerte del reactivo </td><td> Empresa </td><td> Número de catálogo </td></tr><tr><td> Proteína solución de precipitación </td><td> Qiagen </td><td> 158910 </td></tr><tr><td> Tampón de lisis celular </td><td> Qiagen </td><td> 158906 </td></tr><tr><td> Proteinasa K </td><td> Qiagen </td><td> 158920 </td></tr><tr><td> RNasa A </td><td> Qiagen </td><td> 158924 </td></tr><tr><td> Tampón TE </td><td> Promega </td><td> V6232 </td></tr></tbody></table> Reactivos Tabla 2. Necesario. <ol><li> Finamente picada congelada la muestra de tumor (50 a 100 mg) utilizando una cuchilla de afeitar limpia. </li><li> Place picado tejido en un tubo de microcentrífuga de 1,5 ml y añadir 1 ml de tampón de lisis celular que contiene 5 l de proteinasa K solución (20 mg / ml). </li><li> Vortex a fondo. </li><li> Incubar en un 55 ° C agitador regulado a 250 rpm durante al menos 4 horas, preferentemente durante la noche. </li><li> Añadir 1 l de RNasa A una solución (10 mg / ml) y se invierte el tubo 25 veces. </li><li> Incubar a 37 ° C durante 30 min. </li><li> Enfriar a temperatura ambiente colocando en hielo durante 3 min. </li><li> Añadir 333 l solución de precipitación de proteínas y agitar vigorosamente. </li><li> Centrifugar a 14.000 rpm 10 min. Las proteínas deben pellet. Si pellet es muy pequeña, de nuevo vórtice, incubar en hielo durante 5 min, y luego volver a centrifugar. </li><li> Vierta el ADN que contiene sobrenadante a un tubo de centrífuga limpio 15 ml. </li><li> Añadir un volumen igual de isopropanol 100% y mezclar invirtiendo suavemente 50 veces. </li><li> Centrifugar a 3.500 rpm durante 3 min. </li><li> Desechar el sobrenadante. </li><li> Añadir 1 ml de etanol al 70% y se invierte tubo varias veces para lavar el sedimento. </li><li> Transferir el sedimento lavado junto con el etanol a un tubo de microcentrífuga de 1,5 ml. </li><li> Centrifugar a 14.000 rpm durante 5 min a 4 ° C. </li><li> Se retira etanol y se invierte el tubo se seque al aire (aproximadamente de 5 a 30 min). </li><li> Resuspender el ADN pellet en 50 a 500 l de TE dependiendo del tamaño del precipitado de ADN. </li><li> Opcional incubación a 37 ° C para resuspender el ADN. </li><li> Almacenar a 4 ° C, o -20 ° C para el almacenamiento a largo plazo. </li></ol> 4. Enlazador mediada-PCR genómico utilizando ADN de los tumores <table border="1"><tbody><tr><td> Nombre del reactivo </td><td> Empresa </td><td> Número de catálogo </td></tr><tr><td> BFAI </td><td> New England Biolabs </td><td> R0568S </td></tr><tr><td> NlaIII </td><td> New England Biolabs </td><td> R0125S </td></tr><tr><td> MinElute placas de 96 pocillos </td><td> Qiagen </td><td> 28051 </td></tr><tr><td> QIAvac 96 Vacuum manifold </td><td> Qiagen </td><td> 19504 </td></tr><tr><td> Múltiples microplaca Genie, 120V </td><td> Scientific Industries, Inc. </td><td> SI-4000 </td></tr><tr><td> ADN ligasa de T4 con tampón de ligación 5x </td><td> Invitrogen </td><html><td> 15224-041 </td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td></tr><tr><td> 25 mM de dNTPs </td><td> BioExpress </td><td> C-5014-200 </td></tr><tr><td> Platinum Taq </td><td> Invitrogen </td><td> 10966-034 </td></tr><tr><td> FastStart Taq ADN polimerasa </td><td> Roche </td><td> 12032929001 </td></tr><tr><td> Agarosa </td><td> Promega </td><td> V3121 </td></tr><tr><td> Tampón TAE </td><td> Promega </td><td> V4271 </td></tr><tr><td> Tampón TE </td><td> Promega </td><td> V6232 </td></tr><tr><td> El bromuro de etidio </td><td> Promega </td><td> H5041 </td></tr></tbody></table> Reactivos Tabla 3. Necesario. Secuencias de engarce BFAI enlazador + 5 &#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3&#39; BFAI enlazador-5 &#39;Phos-TAGTCCCTTAAGCGGAG 3&#39;NH2 &quot;&gt; Enlazador NlaIII + 5&#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 &#39; NlaIII enlazador-5 &#39;-Phos GTCCCTTAAGCGGAGCC 3&#39; Primer secuencias Primaria PCR directo lado derecho (NlaIII): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC Primaria PCR adelante del lado izquierdo (BFAI): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC Primaria inversa PCR para el lado de la derecha y la izquierda: Spl Link1 1 GTAATACGACTCACTATAGGGC Secundario lado derecho de PCR directo: Ejemplo de un código de barras secundario Illumina cebador 5 &#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (la de la N representan el código de barras 12 pb, la secuencia en mayúsculas se requieren para la plataforma Illumina, y la secuencia en minúsculas se unirá al transposón.) Secundaria PCR adelante del lado izquierdo: Ejemplo de un código de barras de segunda Illuminadary 5&#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa cebador (la de la N representan el código de barras 12 pb, la secuencia en mayúsculas se requieren para la plataforma Illumina, y la secuencia en minúsculas se unirá al transposón.) Secundaria inversa PCR para el lado derecho e izquierdo: conector cebador anidado inversa 5 &#39;CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC <ol><li> Recocer el + y - enlazadores para ambos enlazadores bfai y enlazadores NlaII mediante la mezcla de 50 l de enlazador + (100 mM) con 50 l de enlazador-(100 M) y añadir 2 l de NaCl (5 M) en un tubo de microcentrífuga de 1,5 ml. Lugar en 95 ° C del bloque de calor durante 5 min. Apagar bloque de calentamiento y dejar enfriar lentamente a temperatura ambiente (esto tarda una hora o más). Después de enfriar, los enlazadores recocidas puede ser almacenado en un congelador a -20 ° C hasta que se necesite. </li><li> Preparar dos alícuotas de la ADN del tumor, cada parte alícuota que contenía 1 mg de ADN. Una alícuota será digerido ingenioha enzima de restricción que corte cerca de la &quot;derecha&quot; fin del transposón. La segunda alícuota se digiere con una enzima de restricción que corta cerca de la &quot;izquierda&quot; fin del transposón. Esto se hace para maximizar las posibilidades de amplificar cada sitio de inserción del transposón. </li><li> Digerir el ADN del tumor en una alícuota con el &quot;derecho&quot; NlaII enzima lado, y digerir el ADN del tumor en la parte alícuota que utilice el lado &quot;izquierdo&quot; enzima BFAI: mezcle 1 l de enzima, 5 l Buffer 10x NEB # 4, ADN ( 1 g) y ddH 2 O hasta un volumen total de 50 l. Digerir el ADN durante la noche a 37 ° C en baño de agua o incubadora. </li><li> Calentar inactivar enzimas (BFAI = 80 ° C durante 20 min, NlaIII = 65 ° C durante 20 min). </li><li> Limpiar las muestras digeridas por la colocación de muestras en MinElute placa de 96 pocillos, en lugar placa de colector de vacío y el vacío durante aproximadamente 15 min hasta que los pozos aspecto seco. </li><li> Retire la placa del distribuidor de vacío e inferior blot de placa de 96 pocillos con una toalla de papel para eliminar todo liquid </li><li> Añadir 30 l ddH 2 O a cada pocillo y agitar en un conjunto agitador orbital a temperatura alta durante 2 min, o pipetear arriba y abajo de 20 a 40 veces. </li><li> Traslado volumen total en los pozos (30 l) de MinElute placa de 96 pocillos en placas de 96 pocillos limpios. </li><li> Realizar reacciones de ligación enlazador con el ADN digerido de la etapa 4,8 y enlazadores de paso 4,1. Mezclar 10 l de ADN digerido, 4 l tampón de ligación 5x, 5,5 enlazadores mu l recocido (950 g / l), 0,5 l ligasa de T4 (5 U / l). </li><li> Incubar durante 4 horas a toda la noche a 16 ° C. </li><li> Calentar inactivar la ligasa de ADN de T4 a 65 ° C durante 10 min. </li><li> Limpie la ligadura con MinElute placas de 96 pocillos y un colector de vacío como se describe en los pasos 4,5 hasta 4,6. </li><li> Resuspender en 30 l H 2 O y traslado a un lugar limpio placa de 96 pocillos. </li><li> Realizar una segunda digestión del ADN con el fin de destruir restos concatémero transposones. Esto se consigue cortando el DNA una segunda vez usando una enzima que corta el plásmido vector ADN que se utilizó para crear los ratones transgénicos que contienen el transposón concatémero. </li><li> Digerir el ADN utilizando BamHI (lado izquierdo y derecho): Mezcla de 25 l de enlazador-ligated ADN de paso 4,13, 5 l tampón NEB 10x # 3, 0,5 l BamHI (20 U / l), 0,5 l de BSA (10 mg / ml ) y 19 l ddH 2 O. </li><li> Recopilación de 3-6 horas o durante la noche a 37 ° C. </li><li> Realizar primaria PCR utilizando un cebador específico para el transposón y un cebador específico para el enlazador. Estos pueden variar dependiendo de lo que transposón y el enlazador está utilizando. Los cebadores enumerados en la tabla por encima de cebador de trabajo para el T2/Onc y transposones T2/Onc2. </li><li> PCR primaria: 5 l tampón 10x, 2,0 l de MgCl2 (50 mM), 4 dNTPs mu l (2,5 nM), 1 l Cebador 1 (20 mM), 1 l Cebador 2 (20 mM), 0,25 l Platinum Taq (5 U / l), 3 l de ADN digerido con enlazadores (cantidad puede variar), hasta 50 l ddH 2 O. </li><li> Programa de PCR: 94 ° C durante 5 min, 30 ciclos de 94 ° C por 30 seg, 60 y dpor ejemplo, C por 30 seg, 72 ° C durante 90 sec. Extensión final a 72 ° C durante 5 min. </li><li> Limpiar producto de PCR usando MinElute placas de 96 pocillos y un colector de vacío como se describió anteriormente. </li><li> Resuspender en 30 l H 2 O y traslado a un lugar limpio placa de 96 pocillos. </li><li> Hacer una dilución 1:75 de la 1 ° PCR mediante la dilución de 2 l de ADN de la etapa 148 en 4,21 l ddH O 2 </li><li> Realizar PCR secundaria utilizando versiones de los cebadores anidados que también tienen la secuencia requerida para la máquina Illumina GAIIx así como un código de barras de base 12 par que es única para cada muestra de tumor de procesado (véase la tabla anterior cebador para ejemplos de estos cebadores). </li><li> PCR secundaria: 10 l Tampón 10x con MgCl2, 8 mu l dNTPs (2,5 mM), 1 l Illumina código de barras cebador secundario (20 mM), 1 Nest Illumina 1 l cebador secundario (20 mM), 0,25 l de Taq FastStart (5 U / l ), 2 l de ADN primarios 1:75 PCR diluido, hasta 100 l ddH 2 O. </li><li> Programa de PCR: 94 °; C durante 2 min, 30 ciclos de 94 ° C durante 30 s, 53 ° C durante 45 segundos, 72 ° C durante 90 segundos. Extensión final a 72 ° C durante 5 min. </li><li> Ejecutar 45 l de esta reacción de PCR en un gel de agarosa al 1% que contiene bromuro de etidio (0,5 mg / ml). Debe haber una &quot;mancha&quot; de los productos de PCR que representan a los amplicones de inserciones de transposones muchos diferentes en el tumor (Figura 3). </li><li> Limpiar restante 50 l de producto de PCR utilizando MinElute placas de 96 pocillos y un colector de vacío como se describió anteriormente. Lavar una vez utilizando 50 l ddH 2 O en los pocillos y aspirar de nuevo. </li><li> Resuspender en 30 l de TE y transferir a una placa de 96 pocillos limpia. </li><li> Determinar la concentración de ADN en cada muestra. Combinar cantidades iguales de ADN en un solo tubo de microcentrífuga de 1,5 ml. Esta será la biblioteca que se secuenciaron en un solo carril de una máquina Illumina HiSeq 2000. Es posible secuencia de varios cientos de tumores en un solo carril de una ejecución de Illumina. </li><li> Presentarel único tubo que contiene cantidades iguales de ADN de todos los tumores para la secuenciación. Esto se puede hacer por su institución o comercialmente. </li></ol> 5. Análisis de inserciones de transposones <ol><li> Software para el análisis de transposón inserción de datos está disponible para su descarga gratuita a través de SourceForge ( <a href="http://sourceforge.net/projects/tapdancebio/" target="_blank">http://sourceforge.net/projects/tapdancebio/</a> ). El programa, llamado Tapdance, requiere que el archivo de secuencia de la plataforma Illumina y un código de barras a un archivo de texto plano biblioteca. </li></ol>

<ol>
	<li>Fearon, E. R., Vogelstein, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+model+for+colorectal+tumorigenesis.">A genetic model for colorectal tumorigenesis.</a> Cell. 61, 759-767 (1990).</li><li>Wood, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genomic+Landscapes+of+Human+Breast+and+Colorectal+Cancers.">The Genomic Landscapes of Human Breast and Colorectal Cancers.</a> Science. 318, 1108-1113 (2007).</li><li>Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsv&#225;k, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Reconstruction+of+Sleeping+Beauty,+a+Tc1-like+Transposon+from+Fish,+and+Its+Transposition+in+Human+Cells.">Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells.</a> Cell. 91, 501-510 (1997).</li><li>Starr, T. K., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+using+the+Sleeping+Beauty+transposon.">Cancer gene discovery using the Sleeping Beauty transposon.</a> Cell Cycle. 4, 1744-1748 (2005).</li><li>Mueller, P. R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Footprinting+of+a+Muscle+Specific+Enhancer+by+Ligation+Mediated+PCR.">In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR.</a> Science. 246, 780-786 (1989).</li><li>Bergemann, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+methods+for+finding+common+insertion+sites+and+co-occurring+common+insertion+sites+in+transposon-+and+virus-based+genetic+screens.">New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens.</a> Nucleic acids research. 40, 3822-3833 (2012).</li><li>Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Harnessing+transposons+for+cancer+gene+discovery.">Harnessing transposons for cancer gene discovery.</a> Nature Reviews Cancer. 10, 696-706 (2010).</li><li>Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+in+solid+tumours+using+transposon-based+somatic+mutagenesis+in+the+mouse.">Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse.</a> Nature. 436, 272-276 (2005).</li><li>Starr, T. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transposon-based+genetic+screen+in+mice+identifies+genes+altered+in+colorectal+cancer.">A transposon-based genetic screen in mice identifies genes altered in colorectal cancer.</a> Science. 323, 1747-1750 (2009).</li><li>Keng, V. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+transposon-based+insertional+mutagenesis+screen+for+genes+associated+with+mouse+hepatocellular+carcinoma.">A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma.</a> Nature. 27, 264-274 (2009).</li><li>Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+mutagenesis+using+a+highly+mobile+somatic+Sleeping+Beauty+transposon+system.">Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system.</a> Nature. 436, 221-226 (2005).</li></ol>

Los autores no tienen nada que revelar.

Una pantalla hacia delante genética utilizando la Bella Durmiente transposón sistema proporciona un método para la identificación de las mutaciones que causan cáncer. Mediante la selección del promotor apropiado para controlar la recombinasa Cre en adición a cualquier mutaciones que predisponen, la pantalla SB identificará conocidos y nuevos genes candidatos cáncer. El éxito de una pantalla SB depende en gran medida de los ratones seleccionados para la creación d...

<table border="1"><tbody><tr><td> Nombre del reactivo </td><td> Empresa </td><td> Número de catálogo </td><td> Comentarios (opcional) </td></tr><tr><td> Sure-Seal inducción Cámara </td><td> Brain Tree Científico </td><td> EZ-177 </td><td></td></tr><tr><td> Criovial </td><td> BioExpress </td><td> C-3355-2 </td><td></td></tr><tr><td> 10% formalina tamponada </td><td> Sigma Aldrich </td><td> HT501128-4L </td><td></td></tr><tr><td> Proteína solución de precipitación </td><td> Qiagen </td><td> 158910 </td><td></td></tr><tr><td> Tampón de lisis celular </td><td> Qiagen </td><td> 158906 </td><td></td></tr><tr><td> Proteinasa K </td><td> Qiagen </td><td> 158920 </td><td></td></tr><tr><td> RNasa A </td><td> Qiagen </td><td> 158924 </td><td></td></tr><tr><td> Tampón TE </td> &lt;td&gt; Promega </td><td> V6232 </td><td></td></tr><tr><td> BFAI </td><td> New England Biolabs </td><td> R0568S </td><td></td></tr><tr><td> NlaIII </td><td> New England Biolabs </td><td> R0125S </td><td></td></tr><tr><td> MinElute placas de 96 pocillos </td><td> Qiagen </td><td> 28051 </td><td></td></tr><tr><td> QIAvac 96 Vacuum manifold </td><td> Qiagen </td><td> 19504 </td><td></td></tr><tr><td> Múltiples microplaca Genie, 120V </td><td> Scientific Industries, Inc. </td><td> SI-4000 </td><td></td></tr><tr><td> ADN ligasa de T4 con tampón de ligación 5x </td><td> Invitrogen </td><td> 15224-041 </td><td></td></tr><tr><td> BamHI </td><td> New England Biolabs </td><td> R0136S </td><td></td></tr><tr><td> DNTPs 25 mM </td><td> BioExpress </td><td> C-5014-200 </td><td></td></tr><tr><td> Platinum Taq </td><td> Invitrogen </td><td&gt; 10966-034 </td><td></td></tr><tr><td> FastStart Taq ADN polimerasa </td><td> Roche </td><td> 12032929001 </td><td></td></tr><tr><td> Agarosa </td><td> Promega </td><td> V3121 </td><td></td></tr><tr><td> Tampón TAE </td><td> Promega </td><td> V4271 </td><td></td></tr><tr><td> Tampón TE </td><td> Promega </td><td> V6232 </td><td></td></tr><tr><td> El bromuro de etidio </td><td> Promega </td><td> H5041 </td><td></td></tr></tbody></table>

identification of sleeping beauty transposon insertions in solid tumors using linker-mediated pcr

Los análisis genómicos, proteómicos, transcriptómica y epigenómico de tumores humanos indican que hay miles de anomalías dentro de cada genoma del cáncer en comparación con el tejido normal correspondiente. Sobre la base de estos análisis es evidente que hay muchos conductores no descubiertos genéticas del cáncer 1. Lamentablemente, estos conductores están ocultos dentro de un número mucho mayor de anomalías de pasajeros en el genoma que no contribuyen directamente a la formación de tumores. Otro aspecto del genoma del cáncer es que hay una considerable heterogeneidad genética dentro de similares tipos de tumores. Cada tumor pueden albergar diferentes mutaciones que proporcionan una ventaja selectiva para la formación de tumor 2. Realización de una pantalla hacia delante imparcial genética en ratones proporciona las herramientas para generar tumores y analizar su composición genética, mientras que la reducción del fondo de mutaciones de pasajeros. La Bella Durmiente (SB) transposón sistema es uno de esos métodos 3. El sistema utiliza SB móvil vectores (transposones) que se pueden insertar en el genoma de la enzima transposasa. Las mutaciones se limitan a un tipo específico de célula mediante el uso de un alelo condicional transposasa que se activa por la recombinasa Cre. Muchas líneas de ratón que expresan existen recombinasa Cre en tejidos específicos. Al cruzar una de estas líneas con el alelo transposasa condicional (por ejemplo, Lox-stop-Lox-SB11), el sistema SB se activa sólo en las células que expresan la recombinasa Cre. La recombinasa Cre extirpará una casete de tope que bloquea la expresión del alelo de la transposasa, activando de este modo mutagénesis de transposones en el tipo de célula designada. Una pantalla SB es iniciada por la cría de tres cepas de ratones transgénicos para que los ratones experimentales llevar un alelo condicional transposasa, un concatémero de transposones, y un alelo específico de tejido de recombinasa Cre. Estos ratones se dejaron envejecer hasta que se forman los tumores y se convierten moribundo. Los ratones son luegoADN genómico practicó la necropsia y se aísla de los tumores. A continuación, el ADN genómico se somete a enlazador mediada-PCR (LM-PCR) que resulta en la amplificación de loci genómicos que contienen un transposón SB. LM-PCR realizada en un solo tumor se traducirá en cientos de amplicones diferentes que representan a los cientos de loci genómicos que contienen inserciones de transposones en un solo tumor 4. Las inserciones de transposones en todos los tumores son analizados y los sitios comunes de inserción (IIC) se identifican usando un método estadístico adecuado 5. Los genes dentro de la CEI es muy probable que sea oncogenes o genes supresores de tumores, y se consideran los genes candidatos cáncer. Las ventajas de utilizar el sistema de SB para identificar genes candidatos cáncer son: 1) el transposón puede ser fácilmente localizado en el genoma, ya que su secuencia es conocida, 2) transposición se puede dirigir a casi cualquier tipo de célula y 3) el transposón es capaz de introduciendo al mismo tiempo de ganancia y pérdida de función de las mutaciones 6. El following protocolo describe cómo diseñar y ejecutar una pantalla hacia delante genético utilizando el sistema de transposón SB para identificar genes candidatos cáncer (Figura 1).

Después de que el método de obtención se ha establecido, los criadores deben producir una camada cada 19-21 días. Tamaño de la camada puede variar entre 5 y 12 crías, dependiendo de la edad de los criadores y el fondo genético. Además, asegúrese de que el genotipo de la camada siguiente genética mendeliana como una manera de confirmar que el método de obtención es a la vez correcta y exitosa. Para el experimento para tener éxito, la incidencia de tumores en los animales experime...

Watch this Scientific Journal Video about Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR at JoVE.com

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Un método de identificación de conductores desconocidos de la carcinogénesis utilizando un enfoque imparcial se describe. El método utiliza el<em&gt; La Bella Durmiente</em&gt; Transposón como un mutágeno aleatorio dirigido a tejidos específicos. Mapeo genómico de inserciones de transposones que impulsan la formación de tumores identifica nuevos oncogenes y genes supresores tumorales

Identificación de los<em&gt; La Bella Durmiente</em&gt; Transposón inserciones en tumores sólidos utilizando vinculador mediada por PCR

Genomic, proteomic, transcriptomic, and epigenomic analyses of human tumors indicate that there are thousands of anomalies within each cancer genome ...

identification-sleeping-beauty-transposon-insertions-solid-tumors

Research

JoVE Journal

Medicine

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

14.0K vistas.  University of Minnesota, Minneapolis. Un método de identificación de conductores desconocidos de la carcinogénesis utilizando un enfoque imparcial se describe. El método utiliza el La Bella Durmiente Transposón como un mutágeno aleatorio dirigido a tejidos específicos. Mapeo genómico de inserciones de transposones que impulsan la formación de tumores identifica nuevos oncogenes y genes supresores tumorales

Video: Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Establishment and Propagation of Human Retinoblastoma Tumors in Immune Deficient Mice

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited time. These cultured tumorspheres may exhibit markedly different cellular phenotypes when compared to the original tumors. Demonstration that cultured cells have the capability of forming new tumors is important to ensure that cultured cells model the biology of the original tumor. 
Here we present a protocol for propagating human retinoblastoma tumors in vivo using Rag2-/- immune deficient mice. Cultured human retinoblastoma tumorspheres of low passage or cells obtained from freshly harvested human retinoblastoma tumors injected directly into the vitreous cavity of murine eyes form tumors within 2-4 weeks. These tumors can be harvested and either further passaged into murine eyes in vivo or grown as tumorspheres in vitro. Propagation has been successfully carried out for at least three passages thus establishing a continuing source of human retinoblastoma tissue for further experimentation. 
Wesley S. Bond and Lalita Wadhwa are co-first authors.

A method is described to propagate human retinoblastoma tumors in mice. Tumor cells are directly injected into the eyes of immune deficient mice. Secondary tumors have been successfully established using both cells directly harvested from human tumors and cultured tumorspheres.

Establecimiento y propagación de los tumores del retinoblastoma humanos en ratones con deficiencia inmune

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited ...

Investigación

Medicina

Evaluation of Nanoparticle Uptake in Tumors in Real Time Using Intravital Imaging

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle uptake in tumors at the microscopic level1,2,3, highlighting the utility of a suitable xenograft model in which to perform detailed uptake analyses. Here, we use high-resolution intravital imaging to evaluate nanoparticle uptake in human tumor xenografts in a modified, shell-less chicken embryo model. The chicken embryo model is particularly well-suited for these in vivo analyses because it supports the growth of human tumors, is relatively inexpensive and does not require anesthetization or surgery 4,5. Tumor cells form fully vascularized xenografts within 7 days when implanted into the chorioallantoic membrane (CAM) 6. The resulting tumors are visualized by non-invasive real-time, high-resolution imaging that can be maintained for up to 72 hours with little impact on either the host or tumor systems. Nanoparticles with a wide range of sizes and formulations administered distal to the tumor can be visualized and quantified as they flow through the bloodstream, extravasate from leaky tumor vasculature, and accumulate at the tumor site. We describe here the analysis of nanoparticles derived from Cowpea mosaic virus (CPMV) decorated with near-infrared fluorescent dyes and/or polyethylene glycol polymers (PEG) 7, 8, 9,10,11. Upon intravenous administration, these viral nanoparticles are rapidly internalized by endothelial cells, resulting in global labeling of the vasculature both outside and within the tumor7,12. PEGylation of the viral nanoparticles increases their plasma half-life, extends their time in the circulation, and ultimately enhances their accumulation in tumors via the enhanced permeability and retention (EPR) effect 7, 10,11. The rate and extent of accumulation of nanoparticles in a tumor is measured over time using image analysis software. This technique provides a method to both visualize and quantify nanoparticle dynamics in human tumors.

We present a novel approach to quantify nanoparticle localization in the vasculature of human xenografted tumors using dynamic, real-time intravital imaging in an avian embryo model.

Evaluación de la absorción de nanopartículas en los tumores en tiempo real utilizando intravital imagen

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle ...

Heterogeneity Mapping of Protein Expression in Tumors using Quantitative Immunofluorescence

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of areas of distinct differentiation into recognized histological subtypes, or different pathological grade, often there are more subtle differences in phenotype which defy accurate classification (Figure 1). Ultimately, since morphology is dictated by the underlying molecular phenotype, areas with visible differences are likely to be accompanied by differences in the expression of proteins which orchestrate cellular function and behavior, and therefore, appearance. The significance of visible and invisible (molecular) heterogeneity for prognosis is unknown, but recent evidence suggests that, at least at the genetic level, heterogeneity exists in the primary tumor1,2, and some of these sub-clones give rise to metastatic (and therefore lethal) disease. 
Moreover, some proteins are measured as biomarkers because they are the targets of therapy (for instance ER and HER2 for tamoxifen and trastuzumab (Herceptin), respectively). If these proteins show variable expression within a tumor then therapeutic responses may also be variable. The widely used histopathologic scoring schemes for immunohistochemistry either ignore, or numerically homogenize the quantification of protein expression. Similarly, in destructive techniques, where the tumor samples are homogenized (such as gene expression profiling), quantitative information can be elucidated, but spatial information is lost. Genetic heterogeneity mapping approaches in pancreatic cancer have relied either on generation of a single cell suspension3, or on macrodissection4. A recent study has used quantum dots in order to map morphologic and molecular heterogeneity in prostate cancer tissue5, providing proof of principle that morphology and molecular mapping is feasible, but falling short of quantifying the heterogeneity. Since immunohistochemistry is, at best, only semi-quantitative and subject to intra- and inter-observer bias, more sensitive and quantitative methodologies are required in order to accurately map and quantify tissue heterogeneity in situ.
We have developed and applied an experimental and statistical methodology in order to systematically quantify the heterogeneity of protein expression in whole tissue sections of tumors, based on the Automated QUantitative Analysis (AQUA) system6. Tissue sections are labeled with specific antibodies directed against cytokeratins and targets of interest, coupled to fluorophore-labeled secondary antibodies. Slides are imaged using a whole-slide fluorescence scanner. Images are subdivided into hundreds to thousands of tiles, and each tile is then assigned an AQUA score which is a measure of protein concentration within the epithelial (tumor) component of the tissue. Heatmaps are generated to represent tissue expression of the proteins and a heterogeneity score assigned, using a statistical measure of heterogeneity originally used in ecology, based on the Simpson's biodiversity index7.
To date there have been no attempts to systematically map and quantify this variability in tandem with protein expression, in histological preparations. Here, we illustrate the first use of the method applied to ER and HER2 biomarker expression in ovarian cancer. Using this method paves the way for analyzing heterogeneity as an independent variable in studies of biomarker expression in translational studies, in order to establish the significance of heterogeneity in prognosis and prediction of responses to therapy.

Here we describe a method to quantify molecular heterogeneity in histological sections of tumor material using quantitative immunofluorescence, image analysis, and a statistical measure of heterogeneity. The method is intended for use in clinical biomarker development and analysis.

Mapeo de la heterogeneidad de la expresión de proteínas en los tumores utilizando inmunofluorescencia cuantitativa

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of ...

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process including development1, apoptosis2, and cell cycle regulation3. MiRNAs are estimated to regulate the expression of 30% to 90% of human genes4 by binding to their target messenger RNAs (mRNAs)5. Widespread dysregulation of miRNAs has been reported in various diseases and cancer subtypes6. Due to their prevalence and unique structure, these small molecules are likely to be the next generation of biomarkers, therapeutic agents and/or targets.
Methods used to investigate miRNA expression include SYBR green I dye- based as well as Taqman-probe based qPCR. If miRNAs are to be effectively used in the clinical setting, it is imperative that their detection in fresh and/or archived clinical samples be accurate, reproducible, and specific. qPCR has been widely used for validating expression of miRNAs in whole genome analyses such as microarray studies7. The samples used in this protocol were from patients who underwent radical prostatectomy for clinically localized prostate cancer; however other tissues and cell lines can be substituted in. Prostate specimens were snap-frozen in liquid nitrogen after resection. Clinical variables and follow-up information for each patient were collected for subsequent analysis8.
Quantification of miRNA levels in prostate tumor samples. The main steps in qPCR analysis of tumors are: Total RNA extraction, cDNA synthesis, and detection of qPCR products using miRNA-specific primers. Total RNA, which includes mRNA, miRNA, and other small RNAs were extracted from specimens using TRIzol reagent. Qiagen's miScript System was used to synthesize cDNA and perform qPCR (Figure 1). Endogenous miRNAs are not polyadenylated, therefore during the reverse transcription process, a poly(A) polymerase polyadenylates the miRNA. The miRNA is used as a template to synthesize cDNA using oligo-dT and Reverse Transcriptase. A universal tag sequence on the 5' end of oligo-dT primers facilitates the amplification of cDNA in the PCR step. PCR product amplification is detected by the level of fluorescence emitted by SYBR Green, a dye which intercalates into double stranded DNA. Specific miRNA primers, along with a Universal Primer that binds to the universal tag sequence will amplify specific miRNA sequences. 
The miScript Primer Assays are available for over a thousand human-specific miRNAs, and hundreds of murine-specific miRNAs. Relative quantification method was used here to quantify the expression of miRNAs. To correct for variability amongst different samples, expression levels of a target miRNA is normalized to the expression levels of a reference gene. The choice of a gene on which to normalize the expression of targets is critical in relative quantification method of analysis. Examples of reference genes typically used in this capacity are the small RNAs RNU6B, RNU44, and RNU48 as they are considered to be stably expressed across most samples. In this protocol, RNU6B is used as the reference gene.

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR qPCR

Quantitative Real Time polymerase chain reaction (qPCR) is a rapid and sensitive method to investigate the expression levels of various microRNA (miRNA) molecules in tumor samples. Using this method expression of hundreds of different miRNA molecules can be amplified, quantified, and analyzed from the same cDNA template.

Detección de microARN en tumores de próstata por el cuantitativo PCR en tiempo real (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process ...

In vitro Organoid Culture of Primary Mouse Colon Tumors

Several human and murine colon cancer cell lines have been established, physiologic integrity of colon tumors such as multiple cell layers, basal-apical polarity, ability to differentiate, and anoikis are not maintained in colon cancer derived cell lines. The present study demonstrates a method for culturing primary mouse colon tumor organoids adapted from Sato T et al. 1, which retains important physiologic features of colon tumors. This method consists of mouse colon tumor tissue collection, adjacent normal colon epithelium dissociation, colon tumor cells digestion into single cells, embedding colon tumor cells into matrigel, and selective culture based on the principle that tumor cells maintain growth on limiting nutrient conditions compared to normal epithelial cells.
The primary tumor organoids if isolated from genetically modified mice provide a very useful system to assess tumor autonomous function of specific genes. Moreover, the tumor organoids are amenable to genetic manipulation by virus meditated gene delivery; therefore signaling pathways involved in the colon tumorigenesis could also be extensively investigated by overexpression or knockdown. Primary tumor organoids culture provides a physiologic relevant and feasible means to study the mechanisms and therapeutic modalities for colon tumorigenesis.

In vitro Organoid Culture of Primary Mouse Colon Tumors

A simple method to establish primary murine colon tumor organoid is described. This method utilizes the feature that colon tumor cells survive and grow into organoids in media containing limited growth factors, whereas normal colon epithelial do not.

In vitro organoide Cultura de tumores de colon primarios Ratón

Several  human and murine colon cancer cell lines have been established, physiologic  integrity of colon tumors such as multiple cell layers, basal-apical ...

Cerebrospinal Fluid MicroRNA Profiling Using Quantitative Real Time PCR

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their translational repression. Changes in miRNA expression have been shown to be involved in the development of all major complex diseases. Furthermore, recent findings showed that miRNAs can be secreted to the extracellular environment and enter the bloodstream and other body fluids where they can circulate with high stability. The function of such circulating miRNAs remains largely elusive, but systematic high throughput approaches, such as miRNA profiling arrays, have lead to the identification of miRNA signatures in several pathological conditions, including neurodegenerative disorders and several types of cancers. In this context, the identification of miRNA expression profile in the cerebrospinal fluid, as reported in our recent study, makes miRNAs attractive candidates for biomarker analysis.
There are several tools available for profiling microRNAs, such as microarrays, quantitative real-time PCR (qPCR), and deep sequencing. Here, we describe a sensitive method to profile microRNAs in cerebrospinal fluids by quantitative real-time PCR. We used the Exiqon microRNA ready-to-use PCR human panels I and II V2.R, which allows detection of 742 unique human microRNAs. We performed the arrays in triplicate runs and we processed and analyzed data using the GenEx Professional 5 software.
Using this protocol, we have successfully profiled microRNAs in various types of cell lines and primary cells, CSF, plasma, and formalin-fixed paraffin-embedded tissues.

We describe a protocol of real time PCR to profile microRNAs in the cerebrospinal fluid (CSF). With the exception of RNA extraction protocols, the procedure can be extended to RNA extracted from other body fluids, cultured cells, or tissue specimens.

Líquido cefalorraquídeo MicroRNA perfiles utilizando cuantitativa en tiempo real PCR

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their ...

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent marker. Mouse models (brain tumor and arthritis) were used to evaluate the usefulness of this method. Saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles tagged with CellVue Maroon (CVM) fluorophore were administered intravenously. Animals were then placed in the rotational holder (MARS) of the in vivo imaging system. Images were acquired in 10&#176; steps over 380&#176;. A rectangular&#160;region of interest (ROI) was placed across the full image width at the model disease site. Within the ROI, and for every image, mean fluorescence intensity was computed after background subtraction. In the mouse models studied, the labeled nanovesicles were taken up in both the orthotopic and transgenic brain tumors, and in the arthritic sites (toes and ankles). Curve analysis of the multi angle image ROIs determined the angle with the highest signal. Thus, the optimal angle for imaging each disease site was characterized. The MAROI method applied to imaging of fluorescent compounds is a noninvasive, economical, and precise tool for in vivo quantitative analysis of the disease states in the described mouse models.

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo quantitation of a fluorescent marker delivered by saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles. Employing mouse models of cancer and arthritis, we demonstrate how the MAROI signal curve analysis can be used for the precise mapping and biological characterization of disease processes.

En vivo de imágenes óptico de tumores del cerebro y la artritis Usando fluorescente SAPC-DOPS nanovesículas

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent ...

Quantitative Mass Spectrometric Profiling of Cancer-cell Proteomes Derived From Liquid and Solid Tumors

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic biomarkers. However, methods for quantitative proteomic characterization of patient-derived tumors and in particular their cellular subpopulations are largely lacking. Here we describe an experimental set-up that allows quantitative analysis of proteomes of cancer cell subpopulations derived from either liquid or solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry followed by bioinformatic data analysis. To enrich specific cellular subsets, liquid tumors are first immunophenotyped by flow cytometry followed by FACS-sorting; for solid tumors, laser-capture microdissection is used to purify specific cellular subpopulations. In a second step, proteins are extracted from the purified cells and subsequently combined with a tumor-specific, SILAC-labeled spike-in standard that enables protein quantification. The resulting protein mixture is subjected to either gel electrophoresis or Filter Aided Sample Preparation (FASP) followed by tryptic digestion. Finally, tryptic peptides are analyzed using a hybrid quadrupole-orbitrap mass spectrometer, and the data obtained are processed with bioinformatic software suites including MaxQuant. By means of the workflow presented here, up to 8,000 proteins can be identified and quantified in patient-derived samples, and the resulting protein expression profiles can be compared among patients to identify diagnostic proteomic signatures or potential drug targets.

In-depth analyses of cancer cell proteomes facilitate identification of novel drug targets and diagnostic biomarkers. We describe an experimental workflow for quantitative analysis of (phospho-)proteomes in cancer cell subpopulations derived from liquid and solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry.

Misa cuantitativa espectrometría de perfiles de los proteomas de células del cáncer derivados de líquidos y tumores sólidos

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic ...

Spatial Measurements of Perfusion, Interstitial Fluid Pressure and Liposomes Accumulation in Solid Tumors

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and elevated IFP are linked to the heterogeneous intra-tumoral distribution of nanotechnology-based drug delivery systems such as liposomes. In the present study, the relationship between tumor microcirculation, elevated IFP, and accumulation of nanoparticles was investigated through in vivo experimentation. This was accomplished by evaluation of the tumor microcirculation using dynamic contrast enhanced computed tomography (DCE-CT) and measurement of tumor IFP using a novel image-guided robotic needle placement system connected to the micro-CT scanner. The intra-tumoral accumulation of liposomes was determined by CT image-based assessment of a nanoparticle liposomal formulation that stably encapsulate the contrast agent iohexol (CT-liposomes). CT imaging allowed for co-localization of the spatial distribution of tumor hemodynamics, IFP and CT-liposome accumulation in an individual subcutaneous xenograft mouse model of breast cancer. Measurements led to the discovery that perfusion and plasma volume fraction are strong mediators of the intra-tumoral distribution of liposomes. Furthermore, the results suggest that IFP plays an indirect role in mediating liposome distribution through modulating blood flow.

The heterogeneous intra-tumoral accumulation of liposomes has been linked to an abnormal tumor microenvironment. Herein methods are presented to measure tumor microcirculation by perfusion imaging and elevated interstitial fluid pressure (IFP) using an image-guided robotic system. Measurements are compared to the intra-tumoral accumulation of liposomes, determined using volumetric micro-CT imaging.

Las mediciones espaciales de perfusión, presión del fluido intersticial y liposomas acumulación en tumores sólidos

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and ...

Multicolor 3D Printing of Complex Intracranial Tumors in Neurosurgery

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. The model can be used for planning and simulating critical steps of a surgical approach. Therefore, it is important that anatomical structures such as blood vessels inside a tumor can be printed to be colored not only on their surface, but throughout their whole volume. During simulation this allows for the removal of certain parts (e.g., with a high-speed drill) and revealing internally located structures of a different color. Thus, diagnostic information from various imaging modalities (e.g., CT, MRI) can be combined in a single compact and tangible object.
However, preparation and printing of such a fully colored anatomical model remains a difficult task. Therefore, a step-by-step guide is provided, demonstrating the fusion of different cross-sectional imaging data sets, segmentation of anatomical structures, and creation of a virtual model. In a second step the virtual model is printed with volumetrically colored anatomical structures using a plaster-based color 3D binder jetting technique. This method allows highly accurate reproduction of patient-specific anatomy as shown in a series of 3D-printed petrous apex chondrosarcomas. Furthermore, the models created can be cut and drilled, revealing internal structures that allow for simulation of surgical procedures.

The protocol describes the fabrication of fully colored three-dimensional prints of patient-specific, anatomical skull models to be used for surgical simulation. The crucial steps of combining different imaging modalities, image segmentation, three-dimensional model extraction, and production of the prints are explained.

Impresión 3D multicolor de tumores intracraneales complejos en neurocirugía

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. ...