Name: fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue
Uploaded: 2016-08-27T14:00:00
Description: Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

This work was supported by the NIDA Intramural Research Program (Bruce T. Hope, Yavin Shaham). F.J.R. was supported by an appointment to the NIDA Research Participation Program sponsored by the National Institutes of Health and administered by the Oak Ridge Institute for Science and Education, and received additional financial support from a Becas-Chile scholarship managed by CONICYT and the Universidad de los Andes, Santiago, Chile. The Johns Hopkins FACS Core facility was supported by Award P30AR053503 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institute of Health.

All experiments were performed in accordance with the Institutional Animal Care and Use Committee (IACUC) of the National Institutes of Health Guide for the Care and Use of Laboratory animals 16.
Note: All the steps below use low-binding centrifuge tubes that were kept on ice unless otherwise specified.
1. Preparation Before Tissue Collection
<ol>
	<li>Set the centrifuge to 4 oC.</li>
	<li>Fire polish a set of three glass Pasteur pipettes wit...

<ol>
	<li>Bossert, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ventral+medial+prefrontal+cortex+neuronal+ensembles+mediate+context-induced+relapse+to+heroin.">Ventral medial prefrontal cortex neuronal ensembles mediate context-induced relapse to heroin.</a> Nat Neurosci. 14, 420-422 (2011).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+nucleus+accumbens+shell+neuronal+ensembles+in+context-induced+reinstatement+of+cocaine-seeking.">Role of nucleus accumbens shell neuronal ensembles in context-induced reinstatement of cocaine-seeking.</a> J Neurosci. 34, 7437-7446 (2014).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+orbitofrontal+cortex+neuronal+ensembles+in+the+expression+of+incubation+of+heroin+craving.">Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving.</a> J Neurosci. 32, 11600-11609 (2012).</li><li>Koya, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+disruption+of+cocaine-activated+nucleus+accumbens+neurons+prevents+context-specific+sensitization.">Targeted disruption of cocaine-activated nucleus accumbens neurons prevents context-specific sensitization.</a> Nat Neurosci. 12, 1069-1073 (2009).</li><li>Cruz, F. C., Rubio, F. J., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+c-fos+to+study+neuronal+ensembles+in+corticostriatal+circuitry+of+addiction.">Using c-fos to study neuronal ensembles in corticostriatal circuitry of addiction.</a> Brain Research. 1628, 157-173 (2015).</li><li>Kamentsky, L. A., Melamed, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometric+cell+sorter.">Spectrophotometric cell sorter.</a> Science. 156, 1364-1365 (1967).</li><li>Kamentsky, L. A., Melamed, M. R., Derman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometer:+new+instrument+for+ultrarapid+cell+analysis.">Spectrophotometer: new instrument for ultrarapid cell analysis.</a> Science. 150, 630-631 (1965).</li><li>Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., Yang, X. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS-array+profiling+of+striatal+projection+neuron+subtypes+in+juvenile+and+adult+mouse+brains.">FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains.</a> Nat Neurosci. 9, 443-452 (2006).</li><li>Lobo, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+striatonigral+and+striatopallidal+medium+spiny+neurons+past,+present,+and+future.">Molecular profiling of striatonigral and striatopallidal medium spiny neurons past, present, and future.</a> Int Rev Neurobiol. 89, 1-35 (2009).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+purification+of+immunolabeled+cell+types+from+adult+rat+brain.">FACS purification of immunolabeled cell types from adult rat brain.</a> J Neurosci Methods. 203, 10-18 (2012).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+identifies+unique+cocaine-induced+gene+regulation+in+selectively+activated+adult+striatal+neurons.">FACS identifies unique cocaine-induced gene regulation in selectively activated adult striatal neurons.</a> J Neurosci. 31, 4251-4259 (2011).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+gene+alterations+are+induced+in+FACS-purified+Fos-positive+neurons+activated+during+cue-induced+relapse+to+heroin+seeking.">Unique gene alterations are induced in FACS-purified Fos-positive neurons activated during cue-induced relapse to heroin seeking.</a> J Neurochem. 124, 100-108 (2013).</li><li>Liu, Q. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+molecular+alterations+in+methamphetamine-activated+Fos-expressing+neurons+from+a+single+rat+dorsal+striatum+using+fluorescence-activated+cell+sorting+(FACS).">Detection of molecular alterations in methamphetamine-activated Fos-expressing neurons from a single rat dorsal striatum using fluorescence-activated cell sorting (FACS).</a> J Neurochem. 128, 173-185 (2014).</li><li>Rubio, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Context-induced+reinstatement+of+methamphetamine+seeking+is+associated+with+unique+molecular+alterations+in+Fos-expressing+dorsolateral+striatum+neurons.">Context-induced reinstatement of methamphetamine seeking is associated with unique molecular alterations in Fos-expressing dorsolateral striatum neurons.</a> J Neurosci. 35, 5625-5639 (2015).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incubation+of+methamphetamine+craving+is+associated+with+selective+increases+in+expression+of+Bdnf+and+trkb,+glutamate+receptors,+and+epigenetic+enzymes+in+cue-activated+fos-expressing+dorsal+striatal+neurons.">Incubation of methamphetamine craving is associated with selective increases in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-activated fos-expressing dorsal striatal neurons.</a> J Neurosci. 35, 8232-8244 (2015).</li><li>US National Research Council. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guide for the care and use of laboratory animals. , (2011).</li><li>Koya, E., Margetts-Smith, G., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daun02+inactivation+of+behaviourally-activated+Fos-expressing+neuronal+ensembles.">Daun02 inactivation of behaviourally-activated Fos-expressing neuronal ensembles.</a> Current Protocols. , (2016).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+technologies+for+examining+the+role+of+neuronal+ensembles+in+drug+addiction+and+fear.">New technologies for examining the role of neuronal ensembles in drug addiction and fear.</a> Nat Rev Neurosci. 14, 743-754 (2013).</li><li>Mardones, G., Gonzalez, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+plasma+membrane+permeabilization+by+freeze-thawing+and+immunofluorescence+epitope+access+to+determine+the+topology+of+intracellular+membrane+proteins.">Selective plasma membrane permeabilization by freeze-thawing and immunofluorescence epitope access to determine the topology of intracellular membrane proteins.</a> J Immunol Methods. 275, 169-177 (2003).</li><li>Molyneaux, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DeCoN:+genome-wide+analysis+of+in+vivo+transcriptional+dynamics+during+pyramidal+neuron+fate+selection+in+neocortex.">DeCoN: genome-wide analysis of in vivo transcriptional dynamics during pyramidal neuron fate selection in neocortex.</a> Neuron. 85, 275-288 (2015).</li><li>Schwarz, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+fluorescence+activated+cell+sorting+to+examine+cell-type-specific+gene+expression+in+rat+brain+tissue.">Using fluorescence activated cell sorting to examine cell-type-specific gene expression in rat brain tissue.</a> J Vis Exp. , e52537 (2015).</li></ol>

FACS can be used to sort neurons and other cell types from either fresh or frozen adult brain tissue. As mentioned in the introduction, the ability to use frozen tissue allows optimal utilization of samples from animals that have undergone complex and protracted behavioral procedures, such as self-administration and relapse studies in addiction research. These behavioral procedures usually takes 1 - 2 hr or longer, and require all animals (10 - 20 total) be tested on the same day 13,18. It takes ~ 4 hr to proc...

During learning, animals form associations between complex sets of highly specific stimuli. This high-resolution information is thought to be encoded by alterations within specific patterns of sparsely distributed neurons called neuronal ensembles. Neuronal ensembles have recently been identified by the induction of immediately early genes (IEGs) such as Fos, Arc, and Zif268 and their protein products in neurons that were strongly activated during behavior or cue exposure. Fos-expressing neurons in particular have been shown to play causal roles in context and cue-specific learned behaviors 1-4. Thus, unique molecular neuroadaptations within these activated Fos-expressing neurons are top candidates for the neural mechanisms that encode learned associations formed during normal learning and abnormal learning disorders, such as addiction and post-traumatic stress disorder (PTSD) 5.
Fluorescence Activated Cell Sorting (FACS) has recently allowed analysis of unique molecular neuroadaptations within Fos-expressing neurons. Flow cytometry and cell sorting were developed in the 1960s 6,7 to characterize and isolate cells according to their light-scattering and immunofluorescent characteristics, and have long been used in immunology and cancer research. However flow cytometry and FACS requires dissociated single cells that are difficult to obtain from adult brain tissue. FACS was first used to isolate and analyze Green Fluorescent Protein (GFP)-expressing striatal neurons from transgenic mice that did not require antibody labeling 8,9. We developed an antibody-based FACS method 10 to isolate and assess molecular alterations in Fos-expressing neurons activated by drug and/or cues in wild type animals 11-15. In this method, neurons are labeled with an antibody against the general neuronal marker NeuN, while strongly activated neurons are labeled with an antibody against Fos. Although our initial method required pooling of up to 10 rats per sample for fresh tissue, subsequent modifications of the protocol allowed FACS isolation of Fos-expressing neurons and quantitative Polymerase Chain Reaction (qPCR) analysis of discrete brain areas from a single rat 13-15. Overall, unique molecular alterations were found in Fos-expressing neurons activated during a variety of context- and cue-activated behaviors in addiction research 12,14,15.
A major logistical problem with performing FACS on fresh tissue is that it takes one whole day to dissociate the tissue and process by FACS. In addition, only about four samples can be processed per day. This usually means that only one brain area can be assessed from each brain and the remaining brain areas have to be discarded. This is a major problem for low throughput behavioral procedures such as self-administration and extinction training that requires surgery and many weeks of intensive training. Furthermore, long and complicated behavioral procedures on test day makes it difficult to perform FACS on the same day. It would be a significant advantage to be able to freeze the brains from the animals immediately after behavioral testing, and then isolate Fos-expressing neurons from one or more brain areas at different times of the investigators&#39; choosing.
Here we demonstrate that our FACS protocol can be used to isolate Fos-expressing neurons (and other cell types) from both fresh and frozen brain tissue. As an example, we isolated Fos-expressing neurons from rat striatum after acute methamphetamine injections and from na&#239;ve rats without injections (control condition). However, this FACS protocol can be used following any behavioral or pharmacological treatment. Subsequent qPCR analysis of our samples indicated that gene expression from these cell types could be assessed with similar efficiency from both fresh and frozen tissue.

<table border="0" cellpadding="0" cellspacing="0" width="1274">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:455px;">Brain matrix</td>
			<td style="width:191px;">CellPoint Scientific</td>
			<td style="width:241px;">69-2160-1</td>
			<td style="width:388px;">to obtain coronal brain slices</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hibernate A low fluorescence&#160;</td>
			<td>Brain Bits</td>
			<td>HA-lf&#160;</td>
			<td>Buffer A&#39; in the protocol is used for processing tissue and cells from the dissociation to fixation steps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase&#160;</td>
			<td>Millipore</td>
			<td>SCR005</td>
			<td>Enzyme solution&#39; in the protocol is used for enzymatic digestion of tissue prior to trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protein LoBind Tube 1.5 mL, PCR clean</td>
			<td>Eppendorf</td>
			<td>22431081</td>
			<td>to prevent cell lost during the protocol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 40 &#181;m</td>
			<td>BD Falcon</td>
			<td>352340</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 100 &#181;m</td>
			<td>BD Falcon</td>
			<td>352360</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 5 ml round-bottom polystyrene test tube with cell strainer snap cap</td>
			<td>BD Bioscience</td>
			<td>352235</td>
			<td>to filter cell suspension before passing though the flow cytometer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pasteur Pipet, Glass</td>
			<td>NIH supply</td>
			<td>6640-00-782-6008</td>
			<td>to do tissue trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Milli-Mark Anti-NeuN-PE, Clone A60 (mouse monoclonal) antibody</td>
			<td>EMD Millipore</td>
			<td>FCMAB317PE</td>
			<td>antibody to detect neurons</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phospho-c-Fos (Ser32) (D82C12) XP Rabbit (Alexa Fluor 647 Conjugate)&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td>8677</td>
			<td>antibody to detect Fos-expressing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPI</td>
			<td>Sigma</td>
			<td>D8417</td>
			<td>to label nuclei</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PicoPure RNA Isolation Kit</td>
			<td>Applied Biosystems.</td>
			<td>KIT0204</td>
			<td>The kit includes the RNA extraction buffer for step 6.14. It is used to collect sorted cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript III first strand cDNA synthesis system</td>
			<td>Invitrogen</td>
			<td>18080-051</td>
			<td>to synthesize cDNA from RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan PreAmp Master Mix</td>
			<td>Applied Biosystems.</td>
			<td>4391128</td>
			<td>to do targeted-preamplification from cDNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan Advance Fast Master&#160;</td>
			<td>Applied Biosystems.</td>
			<td>4444963</td>
			<td>to do PCR using TaqMan probes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fos TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00487426_g1</td>
			<td>TaqMan probe/primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CACTCCAACAGCGTGAC</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GGCCCCTGGCAGAAAGTAG</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>TTCCCCCTGGTCCTTCTGA</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gfap TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00566603_m1</td>
			<td>TaqMan probe/primers for astrocityc gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iba-1 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00574125_g1</td>
			<td>TaqMan probe/primers for microglya gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CTCATGACCACAGTCCA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GACAACTTTGGCATCGTGGAA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>CACAGTCTTCTGAGTGGCAGTGA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo2 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn01767116_m1&#160;</td>
			<td>TaqMan probe/primers for oligodendrocytic gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P1000 pipettor</td>
			<td>Rainin</td>
			<td>17014382</td>
			<td>It is refered to as the pipette with a large tip diameter in steps 3.1 and 3.3 for mild tissue trituration and step 6.7 to resuspend cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">7500 Fast Real-time PCR system</td>
			<td>Applied Biosystems.</td>
			<td>446985</td>
			<td>for quantitative PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FACSAria I Cell Sorter</td>
			<td>BD Biosciences</td>
			<td></td>
			<td>for FACS sorting</td>
		</tr>
	</tbody>
</table>

fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific sets of sparsely distributed activated neurons called neuronal ensembles that mediate learned associations. Fluorescence Activated Cell Sorting (FACS) has recently been optimized for adult rat brain tissue and allowed isolation of activated neurons using antibodies against the neuronal marker NeuN and Fos protein, a marker of strongly activated neurons. Until now, Fos-expressing neurons and other cell types were isolated from fresh tissue, which entailed long processing days and allowed very limited numbers of brain samples to be assessed after lengthy and complex behavioral procedures. Here we found that yields of Fos-expressing neurons and Fos mRNA from dorsal striatum were similar between freshly dissected tissue and tissue frozen at -80 &#186;C for 3 - 21 days. In addition, we confirmed the phenotype of the NeuN-positive and NeuN-negative sorted cells by assessing gene expression of neuronal (NeuN), astrocytic (GFAP), oligodendrocytic (Oligo2) and microgial (Iba1) markers, which indicates that frozen tissue can also be used for FACS isolation of glial cell types. Overall, it is possible to collect, dissect and freeze brain tissue for multiple FACS sessions. This maximizes the amount of data obtained from valuable animal subjects that have often undergone long and complex behavioral procedures.

Sorting Fos-positive and Fos-negative neurons from fresh and frozen dorsal striatum tissue from single rats after acute methamphetamine injections.
The protocol described above was used to sort Fos-positive and Fos-negative neurons from a single rat dorsal striatum 90 min after an intraperitoneal injection of methamphetamine (5 mg/kg). Na&#239;ve rats in their home cages were used as controls. Dorsal striatum tissue was processe...

Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Here we present a Fluorescence Activated Cell Sorting (FACS) protocol to study molecular alterations in Fos-expressing neuronal ensembles from both fresh and frozen brain tissue. The use of frozen tissue allows FACS isolation of many brain areas over multiple sessions to maximize the use of valuable animal subjects.

Fluorescence Activated Cell Sorting (FACS) and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific ...

The overall goal of this procedure is to dissociate Fos-expressing neurons from fresh or frozen adult rat brain tissue for subsequent fluorescence activated cell sorting, or FACS. This method can be used to isolate neuronal cells of interest for identify the unique molecular neuroadaptation of behavioral activated neurons. The main advantage of this technique is that it allows the use of frozen tissue, facilitating the isolation of cells from multiple brain areas on different days.To process this fresh brain tissue, insert two or more prechilled razor blades into the slots of an ice-cold brain slicing matrix to cut one to two millimeter coronal slices containing the brain regions of interest, placing the sections onto a chilled glass plate as they are cut. First, dissect the brain region of interest, discard the other areas, and remove the white matter. To freeze the tissue, transfer the samples into a microtube, and submerge the tube in negative 40 degrees Celsius isopentane for 20 seconds for storage at negative 80 degrees Celsius until further processing.To mince the tissue, allow the samples to thaw on a cold glass plate for no more than one minute before covering the samples in one to two drops of Buffer A solution. Next, holding a razor blade completely vertical to the plate, mince the tissue 100 times in each orthogonal direction. To thoroughly mince the tissue, it is critical to keep the tissue wet with Buffer A and follow the specified mincing times and direction.It is critical to remove the majority of the white matter during the tissue dissection and to keep the tissue covered in Buffer A to improve mincing efficiency and to maintain the health of the cells. When the tissue has been thoroughly processed, use the razor blade to transfer the pieces into a microcentrifuge tube containing one milliliter of cold Buffer A, and invert the tube three to five times to submerge all of the minced tissue in the solution. To dissociate the tissue fragments into single-cell suspension, pellet the samples by centrifugation.Discard the supernatant. Then, slowly add one milliliter of cold, freshly-thawed enzyme solution down the inner wall of the microtube. And use a large tip diameter pipette to immediately aspirate and dispense the entirety of each pellet four times to disperse the minced tissue pieces.Next, quickly invert the microtube to prevent the pellets from sticking to the tube bottoms, and incubate the sample with end-over-end mixing for 30 minutes at four degrees Celsius. At the end of the digestion, centrifuge the tube again, and add 0.6 milliliters of cold Buffer A to the cells. Using the same pipette tip, immediately aspirate and dispense the pellets five times.Then, select a 1.3 millimeter glass pipette, and use it to gently triturate the samples 10 times. Place the sample on ice for two minutes to allow the debris and undissociated cells to settle to the bottom on the tube. Then, transfer the supernatant to a new 15 milliliter tube.Next, add 600 microliters of Buffer A solution to the remaining pellet, and use a 0.8 millimeter diameter pipette to triturate the sample an additional 10 times. After allowing the tissues to settle as just demonstrated, pool the supernatant with the first cell suspension, and add another 600 microliters of buffer to the pellet. Then, use a 0.4 millimeter pipette to triturate the sample, and place the tube on ice for two minutes to allow the tissues to settle.Following the mechanical trituration steps in the protocol is important for a successful sorting. Afterwards, pool the supernatant with the dissociated cells. Then, add 600 microliters of Buffer A to the sample, and repeat the 0.4 millimeter pipette trituration three more times.Place the tubes on ice for two minutes to allow the cells to settle. And then, pool the supernatant in a second 15 milliliter tube. Repeat the trituration process three more times, using the smallest glass pipette, significantly increases the yield of the cells for subsequent sorting.After all of the supernatants have been collected, add 800 microliters of negative 20 degrees Celsius 100%ethanol to four mirotubes on ice. Then, transfer 800 microliters of cells from the first tube of collected supernatant into each of the first two tubes of ethanol and 800 microliters of cells from the second tube of supernatant into each of the last two tubes of ethanol. Invert the tubes to mix the samples.Then, place the samples on ice for 15 minutes, with mixing by inversion every five minutes. At the end of the incubation, centrifuge the cells. Then, touching only the wall of the microtube, use a micropipette to slowly remove all but the last 50 microliters of each supernatant.Filter each of the two cell suspensions separately using two different pairs of cell strainers. The cells are then ready for labeling with antibodies against the cell markers of interest and sorting by flow cytometry. Analysis of fresh and frozen brain tissue samples reveals the presence of small homogeneous populations of neuronal cells with a similar size and granularity.The small homogeneous populations can be gated to exclude any cell aggregates, and the neurons can be identified by their NeuN and DAPI positivity. In both fresh and frozen tissue samples, NeuN mRNA levels are also significantly greater in the NeuN-positive populations than in the NeuN-negative populations. In contrast, the glial and olidogodendrocyte cell marker mRNA levels are greater in the NeuN-negative population than in the NeuN-positive population.A similar trend of higher microgial cell marker mRNA levels is observed in the NeuN-negative population, although this was not statistically significant. Further, Fos mRNA levels are greater in the Fos-positive neurons than in the Fos-negative neurons, with a three-fold increase of Fos mRNA in the Fos-positive neurons from fresh tissue, and an eleven-fold increase of Fos mRNA in Fos-positive neurons from frozen tissue, confirming the validity of the method for identifying specific genes of interest from flow-sorted cells under both fresh and frozen tissue conditions. While attempting this procedure, it's important to remember to follow the critical cell lysis prevention steps.Following this procedure, other methods like fluorescence activated cell sorting can be performed to isolate the cell subsets of interest for further downstream molecular analysis. Using frozen tissue allows the samples to be sorted on separate days, critical for experiments that involve lengthy and complicated tissue harvest and preparation procedures. This technique can also be used to prepare postmortem frozen human brain samples stored for several months or years for sorting by flow cytometry.This technique paved the way for researchers in the neuroscience field for exploring the molecular mechanisms underlying the behavior of Fos-expressing neurons or other immunolabeled wild-type cells of interest. After watching this video, you should have a good understanding of how to dissociate cells from fresh or frozen rat brain tissue for fluorescence activated cell sorting of neurons or cell types of interest.

fluorescence-activated-cell-sorting-facs-gene-expression-analysis-fos

Research

JoVE Journal

Neuroscience

Double Fluorescence in situ Hybridization in Fresh Brain Sections

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh frozen brain sections. Our group has successfully used this approach to study gene co-regulation. More specifically, we have used this dFISH method to explore the anatomical organization, neurochemical properties, and the impact of sensory experience in central sensory circuits, at single cell resolution. This protocol has been validated in brain tissue from mice, rats and songbirds but is expected to be easily adaptable to other vertebrate species, as well as to an array of non-neural tissues. In this film we provide a detailed demonstration of the main steps of this procedure.

Double Fluorescence in situ Hybridization in Fresh Brain Sections

This protocol involves a non-radioactive in-situ hybridization procedure that enables the simultaneous identification of two transcript species, at a single cell resolution, in thin sections of the vertebrate brain.

Here we describe a modified version of a double fluorescence in situ hybridization (dFISH) method optimized for detecting two mRNAs of interest in fresh ...

Optimized Analysis of DNA Methylation and Gene Expression from Small, Anatomically-defined Areas of the Brain

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to the display of physiological and behavioural phenotypes. Such environmental programming is likely to increase the susceptibility to metabolic, cardiovascular and mental diseases 3,4.
DNA methylation and histone modifications are considered key processes in the mediation of the gene-environment dialogue and appear also to underlay environmental programming 5. In mammals, DNA methylation typically comprises the covalent addition of a methyl group at the 5-position of cytosine within the context of CpG dinucleotides.
CpG methylation occurs in a highly tissue- and cell-specific manner making it a challenge to study discrete, small regions of the brain where cellular heterogeneity is high and tissue quantity limited. Moreover, because gene expression and methylation are closely linked events, increased value can be gained by comparing both parameters in the same sample.
Here, a step-by-step protocol (Figure 1) for the investigation of epigenetic programming in the brain is presented using the 'maternal separation' paradigm of early life adversity for illustrative purposes. The protocol describes the preparation of micropunches from differentially-aged mouse brains from which DNA and RNA can be simultaneously isolated, thus allowing DNA methylation and gene expression analyses in the same sample.

A streamlined workflow to study DNA methylation and gene expression changes upon early-life stress is shown. Starting from maternal separation of newborn mice and isolation of discrete brain tissues, we represent a protocol to simultaneously isolate DNA and RNA from brain tissue punches for subsequent bisulfite sequencing and RT-PCR analysis.

Exposure to diet, drugs and early life adversity during sensitive windows of life 1,2 can lead to lasting changes in gene expression that contribute to ...

An Optimized Procedure for Fluorescence-activated Cell Sorting (FACS) Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the intestine and lower urinary tract. Both during development and in mature tissues these cells are often widely dispersed throughout tissues so that isolation of discrete populations using methods like laser capture micro-dissection is difficult. They can however be directly visualized by expression of fluorescent reporters driven from regulatory regions of neuron-specific genes like Tyrosine hydroxylase (TH). We describe a method optimized for high yields of viable TH+ neuronal progenitors from fetal mouse visceral tissues, including intestine and lower urogenital tract (LUT), based on dissociation and fluorescence-activated cell sorting (FACS). 
The Th gene encodes the rate-limiting enzyme for production of catecholamines. Enteric neuronal progenitors begin to express TH during their migration in the fetal intestine1 and TH is also present in a subset of adult pelvic ganglia neurons2-4 . The first appearance of this lineage and the distribution of these neurons in other aspects of the LUT, and their isolation has not been described. Neuronal progenitors expressing TH can be readily visualized by expression of EGFP in mice carrying the transgene construct Tg(Th-EGFP)DJ76Gsat/Mmnc1. We imaged expression of this transgene in fetal mice to document the distribution of TH+ cells in the developing LUT at 15.5 days post coitus (dpc), designating the morning of plug detection as 0.5 dpc, and observed that a subset of neuronal progenitors in the coalescing pelvic ganglia express EGFP. 
To isolate LUT TH+ neuronal progenitors, we optimized methods that were initially used to purify neural crest stem cells from fetal mouse intestine2-6. Prior efforts to isolate NC-derived populations relied upon digestion with a cocktail of collagenase and trypsin to obtain cell suspensions for flow cytometry. In our hands these methods produced cell suspensions from the LUT with relatively low viability. Given the already low incidence of neuronal progenitors in fetal LUT tissues, we set out to optimize dissociation methods such that cell survival in the final dissociates would be increased. We determined that gentle dissociation in Accumax (Innovative Cell Technologies, Inc), manual filtering, and flow sorting at low pressures allowed us to achieve consistently greater survival (&gt;70% of total cells) with subsequent yields of neuronal progenitors sufficient for downstream analysis. The method we describe can be broadly applied to isolate a variety of neuronal populations from either fetal or adult murine tissues.

An Optimized Procedure for Fluorescence-activated Cell Sorting FACS Isolation of Autonomic Neural Progenitors from Visceral Organs of Fetal Mice

An optimized procedure to purify neural crest-derived neuronal progenitors from fetal mouse tissues is described. This method takes advantage of expression from fluorescent reporter alleles to isolate discrete populations by fluorescence-activated cell sorting (FACS). The technique can be applied to isolate neuronal subpopulations throughout development or from adult tissues.

During development neural crest (NC)-derived neuronal progenitors migrate away from the neural tube to form autonomic ganglia in visceral organs like the ...

Laser Capture Microdissection of Enriched Populations of Neurons or Single Neurons for Gene Expression Analysis After Traumatic Brain Injury

Long-term cognitive disability after TBI is associated with injury-induced neurodegeneration in the hippocampus-a region in the medial temporal lobe that is critical for learning, memory and executive function.1,2 Hence our studies focus on gene expression analysis of specific neuronal populations in distinct subregions of the hippocampus. The technique of laser capture microdissection (LCM), introduced in 1996 by Emmert-Buck, et al.,3 has allowed for significant advances in gene expression analysis of single cells and enriched populations of cells from heterogeneous tissues such as the mammalian brain that contains thousands of functional cell types.4 We use LCM and a well established rat model of traumatic brain injury (TBI) to investigate the molecular mechanisms that underlie the pathogenesis of TBI. Following fluid-percussion TBI, brains are removed at pre-determined times post-injury, immediately frozen on dry ice, and prepared for sectioning in a cryostat. The rat brains can be embedded in OCT and sectioned immediately, or stored several months at -80 &deg;C before sectioning for laser capture microdissection. Additionally, we use LCM to study the effects of TBI on circadian rhythms. For this, we capture neurons from the suprachiasmatic nuclei that contain the master clock of the mammalian brain. Here, we demonstrate the use of LCM to obtain single identified neurons (injured and degenerating, Fluoro-Jade-positive, or uninjured, Fluoro-Jade-negative) and enriched populations of hippocampal neurons for subsequent gene expression analysis by real time PCR and/or whole-genome microarrays. These LCM-enabled studies have revealed that the selective vulnerability of anatomically distinct regions of the rat hippocampus are reflected in the different gene expression profiles of different populations of neurons obtained by LCM from these distinct regions. The results from our single-cell studies, where we compare the transcriptional profiles of dying and adjacent surviving hippocampal neurons, suggest the existence of a cell survival rheostat that regulates cell death and survival after TBI.

We describe how to use laser capture microdissection (LCM) to obtain enriched populations of hippocampal neurons or single neurons from frozen sections of the injured rat brain for subsequent gene expression analysis using quantitative real time PCR and/or whole-genome microarrays.

Long-term cognitive disability after TBI is associated with injury-induced neurodegeneration in the hippocampus-a region in the medial temporal lobe that ...

Analysis of Gene Expression Changes in the Rat Hippocampus After Deep Brain Stimulation of the Anterior Thalamic Nucleus

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective treatment for several movement disorders that have failed to respond to medication. Recent progress in the field of DBS surgery has begun to extend the application of this surgical technique to other conditions as diverse as morbid obesity, depression and obsessive compulsive disorder. Despite these expanding indications, little is known about the underlying physiological mechanisms that facilitate the beneficial effects of DBS surgery. One approach to this question is to perform gene expression analysis in neurons that receive the electrical stimulation. Previous studies have shown that neurogenesis in the rat dentate gyrus is elicited in DBS targeting of the anterior nucleus of the thalamus1. DBS surgery targeting the ATN is used widely for treatment refractory epilepsy. It is thus of much interest for us to explore the transcriptional changes induced by electrically stimulating the ATN. In this manuscript, we describe our methodologies for stereotactically-guided DBS surgery targeting the ATN in adult male Wistar rats. We also discuss the subsequent steps for tissue dissection, RNA isolation, cDNA preparation and quantitative RT-PCR for measuring gene expression changes. This method could be applied and modified for stimulating the basal ganglia and other regions of the brain commonly clinically targeted. The gene expression study described here assumes a candidate target gene approach for discovering molecular players that could be directing the mechanism for DBS.

The mechanism underlying the therapeutic effects of Deep Brain Stimulation (DBS) surgery needs investigation. The methods presented in this manuscript describe an experimental approach to examine the cellular events triggered by DBS by analyzing the gene expression profile of candidate genes that can facilitate neurogenesis post DBS surgery.

Deep brain stimulation (DBS) surgery, targeting various regions of the brain such as the basal ganglia, thalamus, and subthalamic regions, is an effective ...

Using Fluorescence Activated Cell Sorting to Examine Cell-Type-Specific Gene Expression in Rat Brain Tissue

The brain is comprised of four primary cell types including neurons, astrocytes, microglia and oligodendrocytes. Though they are not the most abundant cell type in the brain, neurons are the most widely studied of these cell types given their direct role in impacting behaviors. Other cell types in the brain also impact neuronal function and behavior via the signaling molecules they produce. Neuroscientists must understand the interactions between the cell types in the brain to better understand how these interactions impact neural function and disease. To date, the most common method of analyzing protein or gene expression utilizes the homogenization of whole tissue samples, usually with blood, and without regard for cell type. This approach is an informative approach for examining general changes in gene or protein expression that may influence neural function and behavior; however, this method of analysis does not lend itself to a greater understanding of cell-type-specific gene expression and the effect of cell-to-cell communication on neural function. Analysis of behavioral epigenetics has been an area of growing focus which examines how modifications of the deoxyribonucleic acid (DNA) structure impact long-term gene expression and behavior; however, this information may only be relevant if analyzed in a cell-type-specific manner given the differential lineage and thus epigenetic markers that may be present on certain genes of individual neural cell types. The Fluorescence Activated Cell Sorting (FACS) technique described below provides a simple and effective way to isolate individual neural cells for the subsequent analysis of gene expression, protein expression, or epigenetic modifications of DNA. This technique can also be modified to isolate more specific neural cell types in the brain for subsequent cell-type-specific analysis.

The goal of this protocol is to use the fluorescence activated cell sorting (FACS) technique to sort specific types of neural cells for subsequent analysis of cell-type-specific gene expression, epigenetic markers, and or protein expression.

The brain is comprised of four primary cell types including neurons, astrocytes, microglia and oligodendrocytes. Though they are not the most abundant ...

Isolation of Cerebral Capillaries from Fresh Human Brain Tissue

Understanding blood-brain barrier function under physiological and pathophysiological conditions is critical for the development of new therapeutic strategies that hold the promise to enhance brain drug delivery, improve brain protection, and treat brain disorders. However, studying the human blood-brain barrier function is challenging. Thus, there is a critical need for appropriate models. In this regard, brain capillaries isolated from human brain tissue represent a unique tool to study barrier function as close to the human in vivo situation as possible. Here, we describe an optimized protocol to isolate capillaries from human brain tissue at a high yield and with consistent quality and purity. Capillaries are isolated from fresh human brain tissue using mechanical homogenization, density-gradient centrifugation, and filtration. After the isolation, the human brain capillaries can be used for various applications including leakage assays, live cell imaging, and immune-based assays to study protein expression and function, enzyme activity, or intracellular signaling. Isolated human brain capillaries are a unique model to elucidate the regulation of the human blood-brain barrier function. This model can provide insights into central nervous system (CNS) pathogenesis, which will help the development of therapeutic strategies for treating CNS disorders.

Isolated brain capillaries from human brain tissue can be used as a preclinical model to study barrier function under physiological and pathophysiological conditions. Here, we present an optimized protocol to isolate brain capillaries from fresh human brain tissue.

Understanding blood-brain barrier function under physiological and pathophysiological conditions is critical for the development of new therapeutic ...

Optimization of Laser-Capture Microdissection for the Isolation of Enteric Ganglia from Fresh-Frozen Human Tissue

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). We have identified five steps in the workflow that are crucial for obtaining RNA isolates from enteric ganglia with sufficiently high quality and quantity for RNA-seq. First, when preparing intestinal tissue, each sample must have all excess liquid removed by blotting prior to flattening the serosa as much as possible across the bottom of large base molds. Samples are then quickly frozen atop a slurry of dry ice and 2-methylbutane. Second, when sectioning the tissue, it is important to position cryomolds so that intestinal sections parallel the full plane of the myenteric plexus, thereby yielding the greatest surface area of enteric ganglia per slide. Third, during LCM, polyethylene napthalate (PEN)-membrane slides offer the greatest speed and flexibility in outlining the non-uniform shapes of enteric ganglia when collecting enteric ganglia. Fourth, for distinct visualization of enteric ganglia within sections, ethanol-compatible dyes, like Cresyl Violet, offer excellent preservation of RNA integrity relative to aqueous dyes. Finally, for the extraction of RNA from captured ganglia, we observed differences between commercial RNA extraction kits that yielded superior RNA quantity and quality, while eliminating DNA contamination. Optimization of these factors in the current protocol greatly accelerates the workflow and yields enteric ganglia samples with exceptional RNA quality and quantity.

The goal of this protocol is to obtain high-integrity RNA samples from enteric ganglia isolated from unfixed, freshly-resected human intestinal tissue using laser capture microdissection (LCM). This protocol involves preparing flash-frozen samples of human intestinal tissue, cryosectioning, ethanolic staining and dehydration, LCM, and RNA extraction.

The purpose of this method is to obtain high-integrity RNA samples from enteric ganglia collected from unfixed, freshly-resected human intestinal tissue ...

Primary Cell Culture of Purified GABAergic or Glutamatergic Neurons Established through Fluorescence-activated Cell Sorting

The overall goal of this protocol is to generate purified neuronal cultures derived from either GABAergic or glutamatergic neurons. Purified neurons can be cultured in defined media for 16 days in vitro and are amenable to any analyses typically performed on dissociated cultures, including electrophysiological, morphological and survival analyses. The major advantage of these cultures is that specific cell types can be selectively studied in the absence of complex external influences, such as those arising from glial cells or other neuron types. When planning experiments with purified cells, however, it is important to note that neurons strongly depend on glia-conditioned media for their growth and survival. In addition, glutamatergic neurons further depend on glia-secreted factors for the establishment of synaptic transmission. We therefore also describe a method for co-culturing neurons and glial cells in a non-contact arrangement. Using these methods, we have identified major differences between the development of GABAergic and glutamatergic neuronal networks. Thus, studying cultures of purified neurons has great potential for furthering our understanding of how the nervous system develops and functions. Moreover, purified cultures may be useful for investigating the direct action of pharmacological agents, growth factors or for exploring the consequences of genetic manipulations on specific cell types. As more and more transgenic animals become available, labeling additional specific cell types of interest, we expect that the protocols described here will grow in their applicability and potential.

This protocol describes a cell sorting based method for the purification and culture of fluorescent GABAergic or glutamatergic neurons from the neocortex and hippocampus of postnatal mice or rats.

The overall goal of this protocol is to generate purified neuronal cultures derived from either GABAergic or glutamatergic neurons. Purified neurons can ...

Combining Multiplex Fluorescence In Situ Hybridization with Fluorescent Immunohistochemistry on Fresh Frozen or Fixed Mouse Brain Sections

Fluorescent in situ hybridization (FISH) is a molecular technique that identifies the presence and spatial distribution of specific RNA transcripts within cells. Neurochemical phenotyping of functionally identified neurons usually requires concurrent labelling with multiple antibodies (targeting protein) using immunohistochemistry (IHC) and optimization of in situ hybridization (targeting RNA), in tandem. A &#34;neurochemical signature&#34; to characterize particular neurons may be achieved however complicating factors include the need to verify FISH and IHC targets before combining the methods, and the limited number of RNAs and proteins that may be targeted simultaneously within the same tissue section.
Here we describe a protocol, using both fresh frozen and fixed mouse brain preparations, which detects multiple mRNAs and proteins in the same brain section using RNAscope FISH followed by fluorescence immunostaining, respectively. We use the combined method to describe the expression pattern of low abundance mRNAs (e.g., galanin receptor 1) and high abundance mRNAs (e.g., glycine transporter 2), in immunohistochemically identified brainstem nuclei.
Key considerations for protein labelling downstream of the FISH assay extend beyond tissue preparation and optimization of FISH probe labelling. For example, we found that antibody binding and labelling specificity can be detrimentally affected by the protease step within the FISH probe assay. Proteases catalyze hydrolytic cleavage of peptide bonds, facilitating FISH probe entry into cells, however they may also digest the protein targeted by the subsequent IHC assay, producing off target binding. The subcellular location of the targeted protein is another factor contributing to IHC success following FISH probe assay. We observed IHC specificity to be retained when the targeted protein is membrane bound, whereas IHC targeting cytoplasmic protein required extensive troubleshooting. Finally, we found handling of slide-mounted fixed frozen tissue more challenging than fresh frozen tissue, however IHC quality was overall better with fixed frozen tissue, when combined with RNAscope.

Combining Multiplex Fluorescence In Situ Hybridization with Fluorescent Immunohistochemistry on Fresh Frozen or Fixed Mouse Brain Sections

This protocol describes a method for combining fluorescence in situ hybridization (FISH) and fluorescence immunohistochemistry (IHC) in both fresh frozen and fixed mouse brain sections, with the goal of achieving multilabel FISH and fluorescence IHC signal. IHC targeted cytoplasmic and membrane attached proteins.

Fluorescent in situ hybridization (FISH) is a molecular technique that identifies the presence and spatial distribution of specific RNA transcripts within ...