This work was supported by the NIDA Intramural Research Program (Bruce T. Hope, Yavin Shaham). F.J.R. was supported by an appointment to the NIDA Research Participation Program sponsored by the National Institutes of Health and administered by the Oak Ridge Institute for Science and Education, and received additional financial support from a Becas-Chile scholarship managed by CONICYT and the Universidad de los Andes, Santiago, Chile. The Johns Hopkins FACS Core facility was supported by Award P30AR053503 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institute of Health.

All experiments were performed in accordance with the Institutional Animal Care and Use Committee (IACUC) of the National Institutes of Health Guide for the Care and Use of Laboratory animals 16.
Note: All the steps below use low-binding centrifuge tubes that were kept on ice unless otherwise specified.
1. Preparation Before Tissue Collection
<ol>
	<li>Set the centrifuge to 4 oC.</li>
	<li>Fire polish a set of three glass Pasteur pipettes wit...

<ol>
	<li>Bossert, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ventral+medial+prefrontal+cortex+neuronal+ensembles+mediate+context-induced+relapse+to+heroin.">Ventral medial prefrontal cortex neuronal ensembles mediate context-induced relapse to heroin.</a> Nat Neurosci. 14, 420-422 (2011).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+nucleus+accumbens+shell+neuronal+ensembles+in+context-induced+reinstatement+of+cocaine-seeking.">Role of nucleus accumbens shell neuronal ensembles in context-induced reinstatement of cocaine-seeking.</a> J Neurosci. 34, 7437-7446 (2014).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+orbitofrontal+cortex+neuronal+ensembles+in+the+expression+of+incubation+of+heroin+craving.">Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving.</a> J Neurosci. 32, 11600-11609 (2012).</li><li>Koya, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+disruption+of+cocaine-activated+nucleus+accumbens+neurons+prevents+context-specific+sensitization.">Targeted disruption of cocaine-activated nucleus accumbens neurons prevents context-specific sensitization.</a> Nat Neurosci. 12, 1069-1073 (2009).</li><li>Cruz, F. C., Rubio, F. J., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+c-fos+to+study+neuronal+ensembles+in+corticostriatal+circuitry+of+addiction.">Using c-fos to study neuronal ensembles in corticostriatal circuitry of addiction.</a> Brain Research. 1628, 157-173 (2015).</li><li>Kamentsky, L. A., Melamed, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometric+cell+sorter.">Spectrophotometric cell sorter.</a> Science. 156, 1364-1365 (1967).</li><li>Kamentsky, L. A., Melamed, M. R., Derman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spectrophotometer:+new+instrument+for+ultrarapid+cell+analysis.">Spectrophotometer: new instrument for ultrarapid cell analysis.</a> Science. 150, 630-631 (1965).</li><li>Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., Yang, X. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS-array+profiling+of+striatal+projection+neuron+subtypes+in+juvenile+and+adult+mouse+brains.">FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains.</a> Nat Neurosci. 9, 443-452 (2006).</li><li>Lobo, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+profiling+of+striatonigral+and+striatopallidal+medium+spiny+neurons+past,+present,+and+future.">Molecular profiling of striatonigral and striatopallidal medium spiny neurons past, present, and future.</a> Int Rev Neurobiol. 89, 1-35 (2009).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+purification+of+immunolabeled+cell+types+from+adult+rat+brain.">FACS purification of immunolabeled cell types from adult rat brain.</a> J Neurosci Methods. 203, 10-18 (2012).</li><li>Guez-Barber, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FACS+identifies+unique+cocaine-induced+gene+regulation+in+selectively+activated+adult+striatal+neurons.">FACS identifies unique cocaine-induced gene regulation in selectively activated adult striatal neurons.</a> J Neurosci. 31, 4251-4259 (2011).</li><li>Fanous, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+gene+alterations+are+induced+in+FACS-purified+Fos-positive+neurons+activated+during+cue-induced+relapse+to+heroin+seeking.">Unique gene alterations are induced in FACS-purified Fos-positive neurons activated during cue-induced relapse to heroin seeking.</a> J Neurochem. 124, 100-108 (2013).</li><li>Liu, Q. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+molecular+alterations+in+methamphetamine-activated+Fos-expressing+neurons+from+a+single+rat+dorsal+striatum+using+fluorescence-activated+cell+sorting+(FACS).">Detection of molecular alterations in methamphetamine-activated Fos-expressing neurons from a single rat dorsal striatum using fluorescence-activated cell sorting (FACS).</a> J Neurochem. 128, 173-185 (2014).</li><li>Rubio, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Context-induced+reinstatement+of+methamphetamine+seeking+is+associated+with+unique+molecular+alterations+in+Fos-expressing+dorsolateral+striatum+neurons.">Context-induced reinstatement of methamphetamine seeking is associated with unique molecular alterations in Fos-expressing dorsolateral striatum neurons.</a> J Neurosci. 35, 5625-5639 (2015).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incubation+of+methamphetamine+craving+is+associated+with+selective+increases+in+expression+of+Bdnf+and+trkb,+glutamate+receptors,+and+epigenetic+enzymes+in+cue-activated+fos-expressing+dorsal+striatal+neurons.">Incubation of methamphetamine craving is associated with selective increases in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-activated fos-expressing dorsal striatal neurons.</a> J Neurosci. 35, 8232-8244 (2015).</li><li>US National Research Council. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Guide for the care and use of laboratory animals. , (2011).</li><li>Koya, E., Margetts-Smith, G., Hope, B. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daun02+inactivation+of+behaviourally-activated+Fos-expressing+neuronal+ensembles.">Daun02 inactivation of behaviourally-activated Fos-expressing neuronal ensembles.</a> Current Protocols. , (2016).</li><li>Cruz, F. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+technologies+for+examining+the+role+of+neuronal+ensembles+in+drug+addiction+and+fear.">New technologies for examining the role of neuronal ensembles in drug addiction and fear.</a> Nat Rev Neurosci. 14, 743-754 (2013).</li><li>Mardones, G., Gonzalez, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+plasma+membrane+permeabilization+by+freeze-thawing+and+immunofluorescence+epitope+access+to+determine+the+topology+of+intracellular+membrane+proteins.">Selective plasma membrane permeabilization by freeze-thawing and immunofluorescence epitope access to determine the topology of intracellular membrane proteins.</a> J Immunol Methods. 275, 169-177 (2003).</li><li>Molyneaux, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DeCoN:+genome-wide+analysis+of+in+vivo+transcriptional+dynamics+during+pyramidal+neuron+fate+selection+in+neocortex.">DeCoN: genome-wide analysis of in vivo transcriptional dynamics during pyramidal neuron fate selection in neocortex.</a> Neuron. 85, 275-288 (2015).</li><li>Schwarz, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+fluorescence+activated+cell+sorting+to+examine+cell-type-specific+gene+expression+in+rat+brain+tissue.">Using fluorescence activated cell sorting to examine cell-type-specific gene expression in rat brain tissue.</a> J Vis Exp. , e52537 (2015).</li></ol>

FACS can be used to sort neurons and other cell types from either fresh or frozen adult brain tissue. As mentioned in the introduction, the ability to use frozen tissue allows optimal utilization of samples from animals that have undergone complex and protracted behavioral procedures, such as self-administration and relapse studies in addiction research. These behavioral procedures usually takes 1 - 2 hr or longer, and require all animals (10 - 20 total) be tested on the same day 13,18. It takes ~ 4 hr to proc...

During learning, animals form associations between complex sets of highly specific stimuli. This high-resolution information is thought to be encoded by alterations within specific patterns of sparsely distributed neurons called neuronal ensembles. Neuronal ensembles have recently been identified by the induction of immediately early genes (IEGs) such as Fos, Arc, and Zif268 and their protein products in neurons that were strongly activated during behavior or cue exposure. Fos-expressing neurons in particular have been shown to play causal roles in context and cue-specific learned behaviors 1-4. Thus, unique molecular neuroadaptations within these activated Fos-expressing neurons are top candidates for the neural mechanisms that encode learned associations formed during normal learning and abnormal learning disorders, such as addiction and post-traumatic stress disorder (PTSD) 5.
Fluorescence Activated Cell Sorting (FACS) has recently allowed analysis of unique molecular neuroadaptations within Fos-expressing neurons. Flow cytometry and cell sorting were developed in the 1960s 6,7 to characterize and isolate cells according to their light-scattering and immunofluorescent characteristics, and have long been used in immunology and cancer research. However flow cytometry and FACS requires dissociated single cells that are difficult to obtain from adult brain tissue. FACS was first used to isolate and analyze Green Fluorescent Protein (GFP)-expressing striatal neurons from transgenic mice that did not require antibody labeling 8,9. We developed an antibody-based FACS method 10 to isolate and assess molecular alterations in Fos-expressing neurons activated by drug and/or cues in wild type animals 11-15. In this method, neurons are labeled with an antibody against the general neuronal marker NeuN, while strongly activated neurons are labeled with an antibody against Fos. Although our initial method required pooling of up to 10 rats per sample for fresh tissue, subsequent modifications of the protocol allowed FACS isolation of Fos-expressing neurons and quantitative Polymerase Chain Reaction (qPCR) analysis of discrete brain areas from a single rat 13-15. Overall, unique molecular alterations were found in Fos-expressing neurons activated during a variety of context- and cue-activated behaviors in addiction research 12,14,15.
A major logistical problem with performing FACS on fresh tissue is that it takes one whole day to dissociate the tissue and process by FACS. In addition, only about four samples can be processed per day. This usually means that only one brain area can be assessed from each brain and the remaining brain areas have to be discarded. This is a major problem for low throughput behavioral procedures such as self-administration and extinction training that requires surgery and many weeks of intensive training. Furthermore, long and complicated behavioral procedures on test day makes it difficult to perform FACS on the same day. It would be a significant advantage to be able to freeze the brains from the animals immediately after behavioral testing, and then isolate Fos-expressing neurons from one or more brain areas at different times of the investigators&#39; choosing.
Here we demonstrate that our FACS protocol can be used to isolate Fos-expressing neurons (and other cell types) from both fresh and frozen brain tissue. As an example, we isolated Fos-expressing neurons from rat striatum after acute methamphetamine injections and from na&#239;ve rats without injections (control condition). However, this FACS protocol can be used following any behavioral or pharmacological treatment. Subsequent qPCR analysis of our samples indicated that gene expression from these cell types could be assessed with similar efficiency from both fresh and frozen tissue.

<table border="0" cellpadding="0" cellspacing="0" width="1274">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:455px;">Brain matrix</td>
			<td style="width:191px;">CellPoint Scientific</td>
			<td style="width:241px;">69-2160-1</td>
			<td style="width:388px;">to obtain coronal brain slices</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hibernate A low fluorescence&#160;</td>
			<td>Brain Bits</td>
			<td>HA-lf&#160;</td>
			<td>Buffer A&#39; in the protocol is used for processing tissue and cells from the dissociation to fixation steps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase&#160;</td>
			<td>Millipore</td>
			<td>SCR005</td>
			<td>Enzyme solution&#39; in the protocol is used for enzymatic digestion of tissue prior to trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protein LoBind Tube 1.5 mL, PCR clean</td>
			<td>Eppendorf</td>
			<td>22431081</td>
			<td>to prevent cell lost during the protocol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 40 &#181;m</td>
			<td>BD Falcon</td>
			<td>352340</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer, 100 &#181;m</td>
			<td>BD Falcon</td>
			<td>352360</td>
			<td>to filter cell suspension</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Falcon 5 ml round-bottom polystyrene test tube with cell strainer snap cap</td>
			<td>BD Bioscience</td>
			<td>352235</td>
			<td>to filter cell suspension before passing though the flow cytometer</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pasteur Pipet, Glass</td>
			<td>NIH supply</td>
			<td>6640-00-782-6008</td>
			<td>to do tissue trituration</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Milli-Mark Anti-NeuN-PE, Clone A60 (mouse monoclonal) antibody</td>
			<td>EMD Millipore</td>
			<td>FCMAB317PE</td>
			<td>antibody to detect neurons</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phospho-c-Fos (Ser32) (D82C12) XP Rabbit (Alexa Fluor 647 Conjugate)&#160;</td>
			<td>Cell Signaling Technology&#160;</td>
			<td>8677</td>
			<td>antibody to detect Fos-expressing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DAPI</td>
			<td>Sigma</td>
			<td>D8417</td>
			<td>to label nuclei</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PicoPure RNA Isolation Kit</td>
			<td>Applied Biosystems.</td>
			<td>KIT0204</td>
			<td>The kit includes the RNA extraction buffer for step 6.14. It is used to collect sorted cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Superscript III first strand cDNA synthesis system</td>
			<td>Invitrogen</td>
			<td>18080-051</td>
			<td>to synthesize cDNA from RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan PreAmp Master Mix</td>
			<td>Applied Biosystems.</td>
			<td>4391128</td>
			<td>to do targeted-preamplification from cDNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TaqMan Advance Fast Master&#160;</td>
			<td>Applied Biosystems.</td>
			<td>4444963</td>
			<td>to do PCR using TaqMan probes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fos TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00487426_g1</td>
			<td>TaqMan probe/primers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CACTCCAACAGCGTGAC</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GGCCCCTGGCAGAAAGTAG</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NeuN Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>TTCCCCCTGGTCCTTCTGA</td>
			<td>nucleotide sequence for neuronal gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gfap TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00566603_m1</td>
			<td>TaqMan probe/primers for astrocityc gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iba-1 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn00574125_g1</td>
			<td>TaqMan probe/primers for microglya gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>CTCATGACCACAGTCCA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Forward primer</td>
			<td>Applied Biosystems.</td>
			<td>GACAACTTTGGCATCGTGGAA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gapdh Reverse primer</td>
			<td>Applied Biosystems.</td>
			<td>CACAGTCTTCTGAGTGGCAGTGA</td>
			<td>nucleotide sequence for reference/housekeeping gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Oligo2 TaqMan probe</td>
			<td>Applied Biosystems.</td>
			<td>Rn01767116_m1&#160;</td>
			<td>TaqMan probe/primers for oligodendrocytic gene marker</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">P1000 pipettor</td>
			<td>Rainin</td>
			<td>17014382</td>
			<td>It is refered to as the pipette with a large tip diameter in steps 3.1 and 3.3 for mild tissue trituration and step 6.7 to resuspend cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">7500 Fast Real-time PCR system</td>
			<td>Applied Biosystems.</td>
			<td>446985</td>
			<td>for quantitative PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FACSAria I Cell Sorter</td>
			<td>BD Biosciences</td>
			<td></td>
			<td>for FACS sorting</td>
		</tr>
	</tbody>
</table>

fluorescence activated cell sorting (facs) and gene expression analysis of fos-expressing neurons from fresh and frozen rat brain tissue

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific sets of sparsely distributed activated neurons called neuronal ensembles that mediate learned associations. Fluorescence Activated Cell Sorting (FACS) has recently been optimized for adult rat brain tissue and allowed isolation of activated neurons using antibodies against the neuronal marker NeuN and Fos protein, a marker of strongly activated neurons. Until now, Fos-expressing neurons and other cell types were isolated from fresh tissue, which entailed long processing days and allowed very limited numbers of brain samples to be assessed after lengthy and complex behavioral procedures. Here we found that yields of Fos-expressing neurons and Fos mRNA from dorsal striatum were similar between freshly dissected tissue and tissue frozen at -80 &#186;C for 3 - 21 days. In addition, we confirmed the phenotype of the NeuN-positive and NeuN-negative sorted cells by assessing gene expression of neuronal (NeuN), astrocytic (GFAP), oligodendrocytic (Oligo2) and microgial (Iba1) markers, which indicates that frozen tissue can also be used for FACS isolation of glial cell types. Overall, it is possible to collect, dissect and freeze brain tissue for multiple FACS sessions. This maximizes the amount of data obtained from valuable animal subjects that have often undergone long and complex behavioral procedures.

Sorting Fos-positive and Fos-negative neurons from fresh and frozen dorsal striatum tissue from single rats after acute methamphetamine injections.
The protocol described above was used to sort Fos-positive and Fos-negative neurons from a single rat dorsal striatum 90 min after an intraperitoneal injection of methamphetamine (5 mg/kg). Na&#239;ve rats in their home cages were used as controls. Dorsal striatum tissue was processe...

Watch this Scientific Journal Video about Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue at JoVE.com

Fluorescence Activated Cell Sorting FACS and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Here we present a Fluorescence Activated Cell Sorting (FACS) protocol to study molecular alterations in Fos-expressing neuronal ensembles from both fresh and frozen brain tissue. The use of frozen tissue allows FACS isolation of many brain areas over multiple sessions to maximize the use of valuable animal subjects.

Fluorescence Activated Cell Sorting (FACS) and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific ...

The overall goal of this procedure is to dissociate Fos-expressing neurons from fresh or frozen adult rat brain tissue for subsequent fluorescence activated cell sorting, or FACS. This method can be used to isolate neuronal cells of interest for identify the unique molecular neuroadaptation of behavioral activated neurons. The main advantage of this technique is that it allows the use of frozen tissue, facilitating the isolation of cells from multiple brain areas on different days.To process this fresh brain tissue, insert two or more prechilled razor blades into the slots of an ice-cold brain slicing matrix to cut one to two millimeter coronal slices containing the brain regions of interest, placing the sections onto a chilled glass plate as they are cut. First, dissect the brain region of interest, discard the other areas, and remove the white matter. To freeze the tissue, transfer the samples into a microtube, and submerge the tube in negative 40 degrees Celsius isopentane for 20 seconds for storage at negative 80 degrees Celsius until further processing.To mince the tissue, allow the samples to thaw on a cold glass plate for no more than one minute before covering the samples in one to two drops of Buffer A solution. Next, holding a razor blade completely vertical to the plate, mince the tissue 100 times in each orthogonal direction. To thoroughly mince the tissue, it is critical to keep the tissue wet with Buffer A and follow the specified mincing times and direction.It is critical to remove the majority of the white matter during the tissue dissection and to keep the tissue covered in Buffer A to improve mincing efficiency and to maintain the health of the cells. When the tissue has been thoroughly processed, use the razor blade to transfer the pieces into a microcentrifuge tube containing one milliliter of cold Buffer A, and invert the tube three to five times to submerge all of the minced tissue in the solution. To dissociate the tissue fragments into single-cell suspension, pellet the samples by centrifugation.Discard the supernatant. Then, slowly add one milliliter of cold, freshly-thawed enzyme solution down the inner wall of the microtube. And use a large tip diameter pipette to immediately aspirate and dispense the entirety of each pellet four times to disperse the minced tissue pieces.Next, quickly invert the microtube to prevent the pellets from sticking to the tube bottoms, and incubate the sample with end-over-end mixing for 30 minutes at four degrees Celsius. At the end of the digestion, centrifuge the tube again, and add 0.6 milliliters of cold Buffer A to the cells. Using the same pipette tip, immediately aspirate and dispense the pellets five times.Then, select a 1.3 millimeter glass pipette, and use it to gently triturate the samples 10 times. Place the sample on ice for two minutes to allow the debris and undissociated cells to settle to the bottom on the tube. Then, transfer the supernatant to a new 15 milliliter tube.Next, add 600 microliters of Buffer A solution to the remaining pellet, and use a 0.8 millimeter diameter pipette to triturate the sample an additional 10 times. After allowing the tissues to settle as just demonstrated, pool the supernatant with the first cell suspension, and add another 600 microliters of buffer to the pellet. Then, use a 0.4 millimeter pipette to triturate the sample, and place the tube on ice for two minutes to allow the tissues to settle.Following the mechanical trituration steps in the protocol is important for a successful sorting. Afterwards, pool the supernatant with the dissociated cells. Then, add 600 microliters of Buffer A to the sample, and repeat the 0.4 millimeter pipette trituration three more times.Place the tubes on ice for two minutes to allow the cells to settle. And then, pool the supernatant in a second 15 milliliter tube. Repeat the trituration process three more times, using the smallest glass pipette, significantly increases the yield of the cells for subsequent sorting.After all of the supernatants have been collected, add 800 microliters of negative 20 degrees Celsius 100%ethanol to four mirotubes on ice. Then, transfer 800 microliters of cells from the first tube of collected supernatant into each of the first two tubes of ethanol and 800 microliters of cells from the second tube of supernatant into each of the last two tubes of ethanol. Invert the tubes to mix the samples.Then, place the samples on ice for 15 minutes, with mixing by inversion every five minutes. At the end of the incubation, centrifuge the cells. Then, touching only the wall of the microtube, use a micropipette to slowly remove all but the last 50 microliters of each supernatant.Filter each of the two cell suspensions separately using two different pairs of cell strainers. The cells are then ready for labeling with antibodies against the cell markers of interest and sorting by flow cytometry. Analysis of fresh and frozen brain tissue samples reveals the presence of small homogeneous populations of neuronal cells with a similar size and granularity.The small homogeneous populations can be gated to exclude any cell aggregates, and the neurons can be identified by their NeuN and DAPI positivity. In both fresh and frozen tissue samples, NeuN mRNA levels are also significantly greater in the NeuN-positive populations than in the NeuN-negative populations. In contrast, the glial and olidogodendrocyte cell marker mRNA levels are greater in the NeuN-negative population than in the NeuN-positive population.A similar trend of higher microgial cell marker mRNA levels is observed in the NeuN-negative population, although this was not statistically significant. Further, Fos mRNA levels are greater in the Fos-positive neurons than in the Fos-negative neurons, with a three-fold increase of Fos mRNA in the Fos-positive neurons from fresh tissue, and an eleven-fold increase of Fos mRNA in Fos-positive neurons from frozen tissue, confirming the validity of the method for identifying specific genes of interest from flow-sorted cells under both fresh and frozen tissue conditions. While attempting this procedure, it's important to remember to follow the critical cell lysis prevention steps.Following this procedure, other methods like fluorescence activated cell sorting can be performed to isolate the cell subsets of interest for further downstream molecular analysis. Using frozen tissue allows the samples to be sorted on separate days, critical for experiments that involve lengthy and complicated tissue harvest and preparation procedures. This technique can also be used to prepare postmortem frozen human brain samples stored for several months or years for sorting by flow cytometry.This technique paved the way for researchers in the neuroscience field for exploring the molecular mechanisms underlying the behavior of Fos-expressing neurons or other immunolabeled wild-type cells of interest. After watching this video, you should have a good understanding of how to dissociate cells from fresh or frozen rat brain tissue for fluorescence activated cell sorting of neurons or cell types of interest.

fluorescence-activated-cell-sorting-facs-gene-expression-analysis-fos

Research

JoVE Journal

Neuroscience

28.7K visualizações.  NIDA, NIH, DHHS. The overall goal of this procedure is to dissociate Fos-expressing neurons from fresh or frozen adult rat brain tissue for subsequent fluorescence activated cell sorting, or FACS. This method can be used to isolate neuronal cells of interest for identify the unique molecular neuroadaptation of behavioral activated neurons. The main advantage of this technique is that it allows the use of frozen tissue, facilitating the isolation of cells from multiple brain areas on different days.To p...