Nos gustaría agradecer al Dr. Wesley Wang por sentar las bases para este protocolo y su valiosa tutoría. Este trabajo fue parcialmente apoyado por los Institutos Nacionales de Salud (Subvenciones R01GM127575 y R01GM121584) y la Fundación Welch (Subvención A-1715).

1. Construcción del plásmido
<ol><li>Comience por decidir qué proteína histona será acetilada y en qué sitio de lisina. Mutar el sitio al codón de parada ámbar (TAG) usando mutagénesis dirigida por el sitio. NOTA: Hay cuatro plásmidos previamente diseñados utilizados para la expresión de proteínas histonas. Las cuatro proteínas de histonas se clonaron en el vector pETDuet-1 con una etiqueta de histidina N-terminal. La histona H4 también incluye una etiqueta SUMO, el origen de la replicación colE1 con un número de copia de aproximadamente 40, resistente a la ampicilina, y un promotor T7.<ol>
<li>Diseñe cebadores delanteros e inversos que contengan una mutación TAG en el sitio deseado (reemplazando un codón de lisina existente con el codón de parada ámbar) en uno de los cuatro plásmidos de proteína histona.</li>
		<li>Utilice la PCR del plásmido entero para amplificar el PLÁSMIDO QUE CONTIENE. Determinar una temperatura de recocido adecuada para los cebadores. En general, la temperatura de fusión (Tm)de los cebadores menos 5 °C será suficiente. Si se experimenta dificultad para obtener un producto de PCR, se puede utilizar un gradiente de temperatura alrededor de Tm - 5 °C para optimizar la temperatura de recocido para la amplificación. NOTA: En este experimento se utilizó una PFU polimerasa expresada internamente durante 30 ciclos con las siguientes condiciones: 94 °C para 30 s (desnaturalización), temperatura de recocido para 30 s y 72 °C durante 6 min (o 1 min por kilobase-pares). Para obtener más detalles sobre este tipo de método de PCR, consulte Liu y Naismith7.</li>
		<li>Limpie el producto de PCR con un kit de limpieza de PCR siguiendo el protocolo del fabricante. Analizar el producto de PCR mediante electroforesis en gel de agarosa y posterior tinción de bromuro de etidio.</li>
		<li>Ligar el plásmido incubando con T4 ligasa durante la noche a 16 °C.</li>
	</ol>
</li>
	<li>Primero transforme el PLÁSMIDO QUE CONTIENE TAG (AmpR)en Escherichia coliquímicamente competente. Recoger un mínimo de 4 colonias de la transformación y purificar el plásmido. Haga las existencias de la célula de cada uno con glicerol usando métodos estándar y almacene en -80 °C. Enviar para la secuenciación para confirmar la mutación tag deseada.</li>
	<li>Una vez confirmada la secuencia, co-transformar el plásmido que contiene TAG (AmpR)con pEVOL-AckRS (ChlR)en CobB químicamente competente (la única histona lisina desacetilasa conocida en E. coli.)deleción bl21 células utilizando el método de choque térmico. pEVOL es un plásmido con un origen p15A de número de copia medio a número de copia bajo. NOTA: La serie pEVOL de plásmidos se construyó en base a estudios previos que mostraron que un aumento de la expresión del par ortogonal aaRS/ARNtTyr fue eficaz en la disminución del truncamiento de proteínas y en el aumento de los rendimientos generales de proteínas mutantes8. Si las células de deleción CobB no son accesibles, proceda con células BL21 químicamente competentes. CobB es una sirtuina-como la histona lisina deacetilasa y nicotinamida se puede añadir en una concentración final de 5 mM durante la expresión de la proteína histona para inhibir CobB como un enfoque alternativo9.</li>
	<li>Haga un stock de celda y guárdelo a -80 °C.</li>
</ol>2. Expresión de proteínas histonas acetiladas
<ol><li>Preparar 1 L de medios 2YT en autoclave (o volumen de elección) en un matraz de cultivo.</li>
	<li>Inocular 20 mL de medios 2YT que contengan los antibióticos apropiados con el stock celular co-transformado que tiene el plásmido que contiene TAG (AmpR)y pEVOL-AckRS (ChlR)y crecer a 37 °C a OD = 0,6 (4-6 h).</li>
	<li>Añadir los antibióticos apropiados a la 1 L de medio autoclave 2YT e inocular con el cultivo de arranque de 20 mL. Crecer a 37 °C a OD = 0.6-0.8 (2-3 h).</li>
	<li>Añadir agentes inductores y acetilsilesina (AcK) a las concentraciones finales de IPTG 1 mM, arabinosa al 0,2% y AcK 5 mM.</li>
	<li>Cultivar el cultivo a 37 °C durante 6-8 h.</li>
	<li>Células pellet a 2.700 x g durante 15 min.</li>
	<li>Guarde el pellet celular a -80 °C durante la noche.</li>
	<li>A partir de este paso, mantenga la muestra en hielo todo el tiempo. Disuelva el pellet celular en 50 mL de tampón de lisis de histonas por 1 L de cultivo.</li>
	<li>Sonicar de acuerdo con el siguiente ciclo: 1 s encendido, 1 s apagado, total a tiempo: 3 min al 60% de amplitud.</li>
	<li>Cuerpos de inclusión de pellets a 41.600 x g durante 45 min.</li>
	<li>Deseche los cuerpos de inclusión sobrenadante y resuspend en 30 mL de tampón de lisis de histonas. La inclusión de pellets augura 41.600 x g durante 30 min.</li>
	<li>Deseche los cuerpos de inclusión sobrenadante y resuspend en 30 mL de tampón de lavado de pellets. Cuerpos de inclusión de pellets a 41.600 x g durante 30 min.</li>
	<li>Deseche el sobrenadante y disuelva los cuerpos de inclusión en 25 mL de tampón de clorhidrato de guanidina (GuHCl) de 6 M. Incubar con agitación a 37 °C durante 1 h. NOTA: Si es necesario, los cuerpos de inclusión se pueden incubar con agitación durante la noche a 4 °C.</li>
	<li>La inclusión de pellets augura 41.600 x g durante 45 min. Incubar el sobrenadante con 1 mL de resina de Ni-NTA equilibrada con tampón GuHCl de 6 M durante 2 h.</li>
	<li>Proceder con la purificación de Ni-NTA en condiciones desnaturalizado. Lave la columna con 3 volúmenes de columna de tampón de lavado de columna. Proteína de histona acetilada eluto con 10 mL de tampón de elución. NOTA: Intentar concentrar la proteína aquí es una opción, pero las histonas acetiladas son muy impredecibles y pueden precipitarse fácilmente. No se recomienda concentrar más allá de 2 mL en volumen total.</li>
	<li>Dializar extensamente la proteína acetilada de la histona contra el almacenador intermediario del ácido acético del 5% para quitar las sales. Dializar durante 3 h a la vez a 4 °C, intercambiando por tampón fresco un mínimo de 6 veces. NOTA: Para mejorar la pureza de las proteínas, existe la opción de dializar contra el agua pura. Sin embargo, esto causa precipitaciones significativas y reducción en el rendimiento que puede ser indeseable para las proteínas de histonas acetiladas de bajo rendimiento.</li>
	<li>Alícuota y liofilizar la proteína, y almacenar indefinidamente a -80 °C. Las proteínas de histonas de tipo salvaje generalmente producen 10-50 mg/L, mientras que las proteínas de histonas acetiladas producen menos de 10 mg/L dependiendo del sitio específico de lisina. Por ejemplo, H3K79Ac promedia 5 mg/L.</li>
</ol>3. Expresión de proteínas histonas de tipo salvaje
<ol><li>Para ensamblar nucleosomas completos, exprese las 4 proteínas de histonas. Al expresar y purificar histonas de tipo salvaje el protocolo es el mismo que el de las histonas acetiladas excepto las siguientes:<ol>
<li>No realice la cotransformación. No utilice pEVOL-AcKRS para la expresión de histonas de tipo salvaje. Ajuste los antibióticos en consecuencia.</li>
		<li>No use una línea celular de deleción cobb ni agregue nicotinamida, AcK o arabinosa durante la inducción de la expresión celular.</li>
	</ol>
</li>
</ol>4. Preparación de ADN 601
NOTA: Una secuencia de ADN optimizada previamente diseñada para dirigir el posicionamiento del nucleosoma se ensambla con octómeros de histonas para producir mononucleosoma con alta eficiencia. Esta secuencia se conoce como ADN 601 o la secuencia de Widom. Esta secuencia se ha convertido en la secuencia de ADN estándar para estudios in vitro de nucleosomas desde ensayos de remodelación de cromatina hasta mediciones de molécula única10.
<ol><li>Para preparar cantidades significativas de ADN 601 para el ensamblaje de nucleosomas, transforme pGEM-3z/601 en células Top 10 y cultive 10 mL de cultivo para amplificación y extracción de plásmidos. Use un kit de extracción de plásmidos y siga las recomendaciones del fabricante.</li>
	<li>Utilice una polimerasa PFU expresada internamente (más eficiente) para este protocolo de amplificación. Configurar una reacción de PCR: Para una reacción de 250 μL, utilice 207.5 μL en autoclave MQ H2O, 25 μL 10x PFU Buffer, 5 μL Forward Primer: ctggagaatcccggtgccg, 5 μL Reverse Primer: acaggatgtatatatctgacacg, 5 μL dNTP mix, 2.5 μL PFU enzyme. Por lo general, ejecutamos 60 reacciones a la vez para obtener suficiente ADN para ensamblar.</li>
	<li>Utilice una temperatura de recocido de 52 °C durante 30 s y un tiempo de extensión de 30 s si utiliza PFU polimerasa. De lo contrario, siga las condiciones recomendadas por los fabricantes.</li>
	<li>Una vez que se realiza la PCR, utilice un kit de limpieza de PCR de elección para purificar el producto de PCR.</li>
</ol>5. Ensamblaje del octómero de histonas
<ol><li>Disolver las alícuotas de pellets de proteína histona H2A, H2B, H3 y H4 para que haya un stock separado de cada proteína histona en GuHCl Buffer con un volumen total de 100 μL.</li>
	<li>Calcule la concentración de cada proteína histona midiendo la absorbancia A280.</li>
	<li>Si la absorbancia es mayor que 1 para cualquier proteína, diluir con tampón GuHCl para obtener una concentración más precisa.</li>
	<li>Combine las proteínas H2A y H2B en una proporción molar de 1:1 y diluya a una concentración total de proteínas de 4 μg/μL. Repita para H3 y H4.</li>
	<li>Dializar secuencialmente a 4 °C contra 2 M TE tampón durante la noche, 1 M TE tampón 2 h y 0,5 M TE tampón 5 h. NOTA: El segundo y tercer paso de la diálisis hace que las conformaciones inestables de la proteína se precipiten. Se espera ver fuertes precipitaciones en estos pasos.</li>
	<li>Eliminar los precipitados por centrifugación a 16.800 x g a 4 °C.</li>
	<li>De nuevo, calcule la concentración de dímeros de histonas (mezcla H2A/H2B) y tetrámeros (mezcla H3/H4) que miden la absorbancia A280.</li>
	<li>Mezcle dímeros y tetrámeros en una relación molar de 1:1 y ajuste el NaCl a 2 M mediante la adición de NaCl sólido.</li>
	<li>El octómero de histonas se puede almacenar a 4 °C y es más estable que los dímeros y tetrámeros. Nunca congele el octómero de histonas, ya que esto puede causar desmontaje.</li>
	<li>Si se ensambla con histonas acetiladas, simplemente reemplace la proteína de tipo salvaje con la proteína acetilada en el procedimiento.</li>
</ol>6. Ensamblaje de nucleosomas
<ol><li>Utilice un tampón 100x TE y NaCl sólido para ajustar el ADN 601 al tampón TE 2M. Agregue el ADN 601 en el tampón 2M TE al octómero de histonas en una relación molar de 0.85:1 a 0.90:1. Se puede agregar una proporción más baja de ADN si el ADN libre está presente en el análisis de cambio de gel.</li>
	<li>Transfiera la mezcla ADN-histona una bolsa de diálisis y colótela en aproximadamente 200 mL de tampón de 2M TE (o más si se ensamblan múltiples muestras) y revuelva muy suavemente a 4 °C.</li>
	<li>Configure una bomba peristáltica para purgar para que gotee lentamente sin tampón de TE de sal. Cuando el volumen se haya duplicado aproximadamente, vierta la mitad del volumen. Haga esto al menos 4 veces en total. Con una bomba esto puede tomar 4-8 h dependiendo del volumen de partida. Los nucleosomas se forman cuando la concentración de sal se reduce a 150 mM (medida por el medidor de salinidad).</li>
	<li>Después de que la concentración de sal se reduce a 150 mM, dializar contra un tampón de TE de 20 mM durante la noche.</li>
	<li>Eliminar los precipitados por centrifugación y medir la concentración de los nucleosomas mediante la lectura A260 utilizando un lector de placas.</li>
	<li>Añadir la proteasa His-TEV (TEV: nucleosoma 1:30, w:w ) e incubar durante la noche a 4 °C para eliminar todas las etiquetas de histidina. Retire las impurezas de la etiqueta de histidina de la solución de nucleosoma por la resina de Ni-NTA tire hacia abajo.</li>
	<li>Para posicionar el nucleosoma y homogeneizar la muestra, incubar a 60 °C durante 1 h. NOTA: Para los sitios acetilados que son particularmente inestables, este paso puede no ser aconsejable.</li>
	<li>Almacenar nucleosomas a corto plazo (unas semanas) a 4 °C.</li>
	<li>Para el almacenamiento a largo plazo, dializar nucleosomas contra tampón de almacenamiento y almacenarlos a -80 °C.</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

No hay intereses financieros contrapuestos que declarar por ninguno de los autores.

Es esencial seguir este protocolo en cada detalle durante un experimento. Los nucleosomas no son muy estables y se ha dedicado mucho ensayo y error a la determinación de este protocolo. Es clave eliminar los precipitados en cada paso (o siempre que se observen) porque las partículas pueden interferir fácilmente con los procesos de ensamblaje. Mantenga siempre muestras de histonas en hielo. Si los nucleosomas se almacenan a 4 °C durante demasiado tiempo, pueden desmontar espontáneamente. Asegúrese de verificar cualq...

Hemos utilizado PylRS y tRNAPyl para sintetizar y ensamblar mononucleosomas reconstituidos con histonas acetiladas específicas del sitio. PylRS ha demostrado ser invaluable como una herramienta de expansión de código genético para producir proteínas con modificaciones postraduccionales (PTMs) y ha sido genéticamente evolucionado para incorporar alrededor de 200 ncAAs diferentes. PylRS incorpora en un codón de parada ámbar, eliminando la competencia de otros aminoácidos durante la traducción. PylRS fue descubierto por primera vez en arqueas metanógenas, y desde entonces se ha utilizado en biología química para incorporar nuevos grupos químicos reactivos en las proteínas1,2.
MmAcKRS1 fue evolucionado a partir de Methanosarcina mazei PylRS y frecuentemente utilizado en nuestro laboratorio para la síntesis de proteínas acetiladas3,4,5,6. MmAcKRS1 suministra AcK en un sitio de mutación ámbar en el ARNm de elección durante la traducción en Escherichia coli. Esta técnica se ha utilizado previamente para incorporar AcK en los sitios de lisina K4, K9, K14, K18, K23, K27, K36, K56, K64 y K79 histona H3 para estudiar la actividad de sirtuina 1, 2, 6 y 7 en mononucleosomas acetilados4,5,6. Aquí detallamos este método para expresar histonas acetiladas y reconstituir nucleosomas acetilados.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.5 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>1 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>100x TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>2 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>20 mM TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>6 M GuHCl</td>
			<td></td>
			<td></td>
			<td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>Acetyllysine</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Column Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisherbrand&#160;Variable-Flow Chemical Transfer Pump</td>
			<td>Fischer Scientific</td>
			<td>15-077-67</td>
			<td></td>
		</tr>
		<tr>
			<td>His-TEV protease</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Histone Lysis Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td>
		</tr>
		<tr>
			<td>Ni-NTA Resin</td>
			<td></td>
			<td></td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td>
		</tr>
		<tr>
			<td>PCR Clean-Up Kit</td>
			<td>Epoch Life Sicences</td>
			<td>2360050</td>
			<td></td>
		</tr>
		<tr>
			<td>Pellet Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>petDUET-His-SUMO-TEV-H4</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2A</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2B</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pEVOL-AckRS</td>
			<td>Addgene</td>
			<td>137976</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-3z/601</td>
			<td>Addgene</td>
			<td>26656</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

Las proteínas de histonas acetiladas se pueden expresar fácilmente en Escherichia coli codificando un mutante, Nε-acetil-lisina (AcK)-específica methanosarcina mazi pirrolysine tRNA-sintetasa (MmAcKRS1) y su ARNt cognado (tRNAPyl)para ensamblar mononucleosomas reconstituidos con histonas acetiladas específicas del sitio. MmAcKRS1 y tRNAPyl entregan AcK en un sitio de mutación ámbar en el ARNm de elección durante la traducción en Escherichia coli. Esta técnica se ha utilizado extensivamente para incorporar AcK en los sitios de la lisina H3. La pirrolysyl-tRNA sintetasa (PylRS) se puede también evolucionar fácilmente para incorporar otros aminoácidos noncanonical (ncAAs) para la modificación o la funcionalización específica de la proteína del sitio. Aquí detallamos un método para incorporar AcK utilizando el sistema MmAcKRS1 en la histona H3 e integrar proteínas H3 acetiladas en mononucleosomas reconstituidos. Los mononucleosomas reconstitudos acetilados se pueden utilizar en análisis bioquímicos y obligatorios, determinación de la estructura, y más. La obtención de mononucleosomas modificados es crucial para diseñar experimentos relacionados con el descubrimiento de nuevas interacciones y la comprensión de la epigenética.

Los dímeros, tetrámeros y octómeros se pueden evaluar ejecutando un gel 12% SDS PAGE (Figura 1 y Figura 2). Aquí se puede ver que algunos de los tetrámeros acetilados tienen un rendimiento menor que otros (Figura 1). De hecho, cuanto más cerca de la región central, menor es el rendimiento observado. Esto es más probable debido a la acetilación que interfiere con el montaje del tetrámero cua...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Aquí presentamos un método para expresar proteínas de histonas acetiladas utilizando la expansión del código genético y ensamblar nucleosomas reconstituidos in vitro.

Sitio Específico De La Acetilación De Lisina De Histonas Para La Reconstitución De Nucleosomas Utilizando La Expansión Del Código Genético En Escherichia coli

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K vistas.  Texas A&M University. Aquí presentamos un método para expresar proteínas de histonas acetiladas utilizando la expansión del código genético y ensamblar nucleosomas reconstituidos in vitro.

Video: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique applications for OMV where traditional nanoparticles are proving too difficult to synthesize. To date, all Gram-negative bacteria have been shown to produce OMV demonstrating packaging of a variety of cargo that includes small molecules, peptides, proteins and genetic material. Based on their diverse cargo, OMV are implicated in many biological processes ranging from cell-cell communication to gene transfer and delivery of virulence factors depending upon which bacteria are producing the OMV. Only recently have bacterial OMV become accessible for use across a wide range of applications through the development of techniques to control and direct packaging of recombinant proteins into OMV. This protocol describes a method for the production, purification, and use of enzyme packaged OMV providing for improved overall production of recombinant enzyme, increased vesiculation, and enhanced enzyme stability. Successful utilization of this protocol will result in the creation of a bacterial strain that simultaneously produces a recombinant protein and directs it for OMV encapsulation through creating a synthetic linkage between the recombinant protein and an outer membrane anchor protein. This protocol also details methods for isolating OMV from bacterial cultures as well as proper handling techniques and things to consider when adapting this protocol for use for other unique applications such as: pharmaceutical drug delivery, medical diagnostics, and environmental remediation.

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

A protocol for the production, purification, and use of enzyme packaged outer membrane vesicles (OMV) providing for enhanced enzyme stability for implementation across diverse applications is presented.

Dirigida Packaging de proteínas dentro de la membrana externa de vesículas de<em&gt; Escherichia coli</em&gt;: Diseño, Producción y Purificación

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique ...

Investigación

Bioquímica

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many of these conditions cause protein unfolding in the cell and have detrimental impact on the survival of the organism. A group of unrelated, stress-specific molecular chaperones have been shown to play essential roles in the survival of these stress conditions. While fully folded and chaperone-inactive before stress, these proteins rapidly unfold and become chaperone-active under specific stress conditions. Once activated, these conditionally disordered chaperones bind to a large number of different aggregation-prone proteins, prevent their aggregation and either directly or indirectly facilitate protein refolding upon return to non-stress conditions. The primary approach for gaining a more detailed understanding about the mechanism of their activation and client recognition involves the purification and subsequent characterization of these proteins using in vitro chaperone assays. Follow-up in vivo stress assays are absolutely essential to independently confirm the obtained in vitro results.
This protocol describes in vitro and in vivo methods to characterize the chaperone activity of E. coli HdeB, an acid-activated chaperone. Light scattering measurements were used as a convenient read-out for HdeB&#39;s capacity to prevent acid-induced aggregation of an established model client protein, MDH, in vitro. Analytical ultracentrifugation experiments were applied to reveal complex formation between HdeB and its client protein LDH, to shed light into the fate of client proteins upon their return to non-stress conditions. Enzymatic activity assays of the client proteins were conducted to monitor the effects of HdeB on pH-induced client inactivation and reactivation. Finally, survival studies were used to monitor the influence of HdeB&#39;s chaperone function in vivo.

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

This study describes biophysical, biochemical and molecular techniques to characterize the chaperone activity of Escherichia coli HdeB under acidic pH conditions. These methods have been successfully applied for other acid-protective chaperones such as HdeA and can be modified to work for other chaperones and stress conditions.

Detección de la actividad dependiente del pH de<em&gt; Escherichia coli</em&gt; Acompañante HdeB<em&gt; In Vitro</em&gt; y<em&gt; En Vivo</em

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many ...

Efficient and Site-specific Antibody Labeling by Strain-promoted Azide-alkyne Cycloaddition

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is protein conjugation by genetically introducing an unnatural amino acid containing a bioorthogonal functional group. This report describes a detailed protocol for site-specific antibody conjugation. The protocol includes experimental details for the genetic incorporation of an azide-containing amino acid, and the conjugation reaction by strain-promoted azide-alkyne cycloaddition (SPAAC). This strain-promoted reaction proceeds by simple mixing of the reacting molecules at physiological pH and temperature, and does not require additional reagents such as copper(I) ions and copper-chelating ligands. Therefore, this method would be useful for general protein conjugation and development of antibody drug conjugates (ADCs).

Here, we present a protocol to site-specifically introduce chemical probes into an antibody fragment by genetically incorporating an azide-containing amino acid, and subsequently coupling the azide with a chemical probe by strain-promoted azide-alkyne cycloaddition (SPAAC).

Eficiente y específica del sitio del anticuerpo etiquetado por cicloadición de azida-alquino Strain-promovido

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is ...

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

La reconstitución de los nucleosomas con histonas hermanas marcadas con isótopos diferencialmente

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. The relative levels of different tRNAs, and the ratio of aminoacylated tRNA to total tRNA, known as the charging level, are important factors in determining the accuracy and speed of translation. Therefore, the abundance and charging levels of tRNAs are important variables to measure when studying protein synthesis, for example under various stress conditions. Here, we describe a method for harvesting tRNA and directly measuring both the relative abundance and the absolute charging level of specific tRNA species in Escherichia coli. The tRNA is harvested in such a way that the labile bond between the tRNA and its amino acid is preserved. The RNA is then subjected to gel electrophoresis and Northern blotting, which results in separation of the charged and uncharged tRNAs. The levels of specific tRNAs in different samples can be compared due to the addition of spike-in cells for normalization. Prior to RNA purification, we add 5% of E. coli cells that overproduce the rare tRNAselC to each sample. The amount of the tRNA species of interest in a sample is then normalized to the amount of tRNAselC in the same sample. Addition of spike-in cells prior to RNA purification has the advantage over addition of purified spike-in RNAs that it also accounts for any differences in cell lysis efficiency between samples.

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Here we present a method for directly measuring transfer RNA charging levels from purified Escherichia coli RNA as well as a way to compare relative levels of transfer RNA, or any other short RNA, across different samples based on the addition of spike-in cells expressing a reference gene.

Cuantificación de la abundancia y la carga de los niveles de ARN de transferencia en Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. ...

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts of recombinant RNAs are limited. Here, we describe a protocol to produce large amounts of recombinant RNA in Escherichia coli based on co-expression of a chimeric molecule that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. Viroids are relatively small, non-coding, highly base-paired circular RNAs that are infectious to higher plants. The host plant tRNA ligase is an enzyme recruited by viroids that belong to the family Avsunviroidae, such as Eggplant latent viroid (ELVd), to mediate RNA circularization during viroid replication. Although ELVd does not replicate in E. coli, an ELVd precursor is efficiently transcribed by the E. coli RNA polymerase and processed by the embedded hammerhead ribozymes in bacterial cells, and the resulting monomers are circularized by the co-expressed tRNA ligase reaching a remarkable concentration. The insertion of an RNA of interest into the ELVd scaffold enables the production of tens of milligrams of the recombinant RNA per liter of bacterial culture in regular laboratory conditions. A main fraction of the RNA product is circular, a feature that facilitates the purification of the recombinant RNA to virtual homogeneity. In this protocol, a complementary DNA (cDNA) corresponding to the RNA of interest is inserted in a particular position of the ELVd cDNA in an expression plasmid that is used, along the plasmid to co-express eggplant tRNA ligase, to transform E. coli. Co-expression of both molecules under the control of strong constitutive promoters leads to production of large amounts of the recombinant RNA. The recombinant RNA can be extracted from the bacterial cells and separated from the bulk of bacterial RNAs taking advantage of its circularity.

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

Here, we present a protocol to produce large amounts of recombinant RNA in Escherichia coli by co-expressing a chimeric RNA that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. The main product is a circular molecule that facilitates purification to homogeneity.

Producción a gran escala de ARN recombinante en un andamio Circular utilizando un sistema derivado de Viroide en Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts ...

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic acid (sRNA) molecules and target messenger RNAs (mRNAs). In addition, site-directed mutagenesis is used to map specific protein binding sites to RNA. A 2-step and 3-step PCR based introduction of mutations is described. The approach is relevant to all protein-RNA and RNA-RNA interaction studies. In short, the technique relies on designing primers with the desired mutation(s), and through 2 or 3 steps of PCR synthesizing a PCR product with the mutation. The PCR product is then used for cloning. Here, we describe how to perform site-directed mutagenesis with both the 2- and 3-step approach to introduce mutations to the sRNA, McaS, and the mRNA, csgD, to investigate RNA-RNA and RNA-protein interactions. We apply this technique to investigate RNA interactions; however, the technique is applicable to all mutagenesis studies (e.g., DNA-protein interactions, amino-acid substitution/deletion/addition). It is possible to introduce any kind of mutation except for non-natural bases but the technique is only applicable if a PCR product can be used for downstream application (e.g., cloning and template for further PCR).

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in deoxyribonucleic acid (DNA). This protocol describes how to do site-directed mutagenesis with a 2-step and 3-step polymerase chain reaction (PCR) based approach, which is applicable to any DNA fragment of interest.

Mutagénesis sitio-dirigida para In Vitro e In Vivo experimentos, ejemplificados con las interacciones de la ARN en Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic ...

In Vitro Ubiquitination and Deubiquitination Assays of Nucleosomal Histones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination of chromatin function and DNA-associated processes. This modification involves a sequential action of several enzymes including E1 ubiquitin-activating, E2 ubiquitin-conjugating and E3 ubiquitin-ligase and is reversed by deubiquitinases (DUBs). Ubiquitination induces degradation of proteins or alteration of protein function including modulation of enzymatic activity, protein-protein interaction and subcellular localization. A critical step in demonstrating protein ubiquitination or deubiquitination is to perform in vitro reactions with purified components. Effective ubiquitination and deubiquitination reactions could be greatly impacted by the different components used, enzyme co-factors, buffer conditions, and the nature of the substrate.&#160; Here, we provide step-by-step protocols for conducting ubiquitination and deubiquitination reactions. We illustrate these reactions using minimal components of the mouse Polycomb Repressive Complex 1 (PRC1), BMI1, and RING1B, an E3 ubiquitin ligase that monoubiquitinates histone H2A on lysine 119. Deubiquitination of nucleosomal H2A is performed using a minimal Polycomb Repressive Deubiquitinase (PR-DUB) complex formed by the human deubiquitinase BAP1 and the DEUBiquitinase ADaptor (DEUBAD) domain of its co-factor ASXL2. These ubiquitination/deubiquitination assays can be conducted in the context of either recombinant nucleosomes reconstituted with bacteria-purified proteins or native nucleosomes purified from mammalian cells. We highlight the intricacies that can have a significant impact on these reactions and we propose that the general principles of these protocols can be swiftly adapted to other E3 ubiquitin ligases and deubiquitinases.

Ubiquitination is a post-translational modification that plays important roles in cellular processes and is tightly coordinated by deubiquitination. Defects in both reactions underlie human pathologies. We provide protocols for conducting ubiquitination and deubiquitination reaction in vitro using purified components.

Ensayos in Vitro Ubiquitination y Deubiquitination de histonas nucleosomales

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination ...

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein aggregation. The accumulation of protein aggregates in bacterial cells can lead to significant alterations in the cellular phenotypic behavior, including a reduction in growth rates, stress resistance, and virulence. Several experimental procedures exist for the examination of these stressor-mediated phenotypes. This paper describes an optimized assay for the extraction and visualization of aggregated and soluble proteins from different Escherichia coli strains after treatment with a silver-ruthenium-containing antimicrobial. This compound is known to generate reactive oxygen species and causes widespread protein aggregation. 
The method combines a centrifugation-based separation of protein aggregates and soluble proteins from treated and untreated cells with subsequent separation and visualization by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie staining. This approach is simple, fast, and allows a qualitative comparison of protein aggregate formation in different E. coli strains. The methodology has a wide range of applications, including the possibility to investigate the impact of other proteotoxic antimicrobials on in vivo protein aggregation in a wide range of bacteria. Moreover, the protocol can be used to identify genes that contribute to increased resistance to proteotoxic substances. Gel bands can be used for the subsequent identification of proteins that are particularly prone to aggregation.

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

This protocol describes the extraction and visualization of aggregated and soluble proteins from Escherichia coli after treatment with a proteotoxic antimicrobial. Following this procedure allows a qualitative comparison of protein aggregate formation in vivo in different bacterial strains and/or between treatments.

Extracción y visualización de agregados proteicos después del tratamiento de Escherichia coli con un estresor proteotóxico

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

Ensayo pulldown junto con coexpresión en células bacterianas como una herramienta eficiente en el tiempo para probar interacciones desafiantes proteína-proteína

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...