ברצוננו להודות לד"ר ווסלי וונג על הנחת היסודות לפרוטוקול הזה ולחונכותו החשובה. עבודה זו נתמכה בחלקה על ידי המכונים הלאומיים לבריאות (מענקים R01GM127575 ו R01GM121584) וקרן וולש (גרנט A-1715).

1. בניית פלסמיד
<ol><li>התחילו בהחלטה איזה חלבון היסטון יהיה אצטילאט ובאיזה אתר ליסטין. מוטציה האתר כדי לעצור ענבר קודון (TAG) באמצעות mutagenesis מכוון האתר. הערה: ישנם ארבעה פלסמידים שתוכננו בעבר מנוצלים לביטוי של חלבוני היסטון. כל ארבעת חלבוני ההיסטון שוכפלו לווקטור pETDuet-1 עם תג היסטידין N-terminal. Histone H4 כולל גם תג SUMO, המקור של colE1 שכפול עם מספר עותק של כ 40, אמיטצילין עמיד, ו מקדם T7.<ol>
<li>עצבו פריימרים קדמיים ומתהווכים המכילים מוטציית TAG באתר הרצוי (החלפת קודון ליצין קיים בקודון עצירת הענבר) באחד מארבעת פלסמידי החלבון של היסטון.</li>
		<li>השתמש ב- PCR שלם כדי להגביר את התג המכיל פלסמיד. קבעו טמפרטורת חישול מתאימה לפריימרים. באופן כללי, טמפרטורת ההיתוך (Tm)של פרייומרים מינוס 5 מעלות צלזיוס יהיה מספיק. אם יש קושי בהשגת מוצר PCR, ניתן להשתמש במעבר טמפרטורה סביב Tm - 5 °C (60 °F) כדי למטב את טמפרטורת חישול להגברה. הערה: בניסוי זה פולימראז PFU מבוטא בתוך הבית שימש במשך 30 מחזורים עם התנאים הבאים: 94 °C (94 °C (30 s (denaturation), חישול טמפרטורה עבור 30 s, ו 72 °C (6 דקות (או 1 דקה לקילו-בייס-זוגות). לפרטים נוספים על סוג זה של שיטת PCR ראו ליו ונייסמית'7.</li>
		<li>נקה את מוצר ה- PCR באמצעות ערכת ניקוי PCR על-ידי ביצוע פרוטוקול היצרן. לנתח את מוצר PCR על ידי אלקטרופורזה ג'ל agarose וכתמים אתידיום ברומיד הבאים.</li>
		<li>Ligate פלסמיד על ידי דגירה עם T4 ligase לילה ב 16 °C (66 °F).</li>
	</ol>
</li>
	<li>ראשית להפוך את תג המכיל פלסמיד (AmpR)לתוך כימית מוסמך Escherichia coli. בחר מינימום של 4 מושבות מהשינוי ולטהר את הפלסמיד. הפוך את מלאי התאים של כל אחד עם גליצרול בשיטות סטנדרטיות ולאחסן ב -80 מעלות צלזיוס. שלח רצף כדי לאשר את המוטציה הרצויה TAG.</li>
	<li>לאחר שהרצף מאושר, הפוך במשותף את הפלסמיד המכיל תג (AmpR)עם pEVOL-AckRS (ChlR)לקובB בעל יכולת כימית (הליסין deacetylase ההיסטון היחיד הידוע בתאי BL21 E. coli). pEVOL הוא פלסמיד עם מספר עותק בינוני למקור p15A בעל העתקה נמוכה. הערה: סדרת pEVOL של פלסמידים נבנו בהתבסס על מחקרים קודמים שהראו ביטוי מוגבר של זוג aaRS / tRNATyr אורתוגונלי היה יעיל בהפחתת חיתוך חלבון ובהגדלת התפוקה הכוללת של חלבונים מוטנטים8. אם תאי מחיקה של CobB אינם נגישים, המשך עם תאי BL21 בעלי יכולת כימית. CobB הוא ליצרין ליצרין דמוי סירטואין וניקוטינמיד ניתן להוסיף בריכוז סופי של 5 מ"מ במהלך ביטוי חלבון היסטון כדי לעכב את CobB כגישה חלופית9.</li>
	<li>הפוך מלאי תא ולאחסן ב -80 °C (69 °F).</li>
</ol>2. ביטוי חלבון histone אצטילאט
<ol><li>הכן 1 L של מדיה 2YT autoclaved (או נפח של בחירה) בבקבוק תרבות.</li>
	<li>לחסן 20 מ"ל של 2YT מדיה המכילה את האנטיביוטיקה המתאימה עם מלאי תאים טרנספורמציה משותפת כי יש פלסמיד המכיל תג (AmpR)ו pEVOL-AckRS (ChlR)ולגדול ב 37 °C (70 °F) כדי OD = 0.6 (4-6 שעות).</li>
	<li>הוסיפו את האנטיביוטיקה המתאימה ל-1 ליטר של מדיה 2YT אוטומטית וחסן עם תרבות המתנע של 20 מ"ל. לגדול ב 37 °C (70 °F) כדי OD = 0.6-0.8 (2-3 שעות).</li>
	<li>הוסף סוכני גרימת אצטיליסין (AcK) לריכוזים הסופיים של IPTG 1 מ"מ, 0.2% arabinose, ו AcK 5 mM.</li>
	<li>לגדל את התרבות ב 37 °C (67 °F) עבור 6-8 שעות.</li>
	<li>כדורי תאים ב 2,700 x g במשך 15 דקות.</li>
	<li>לאחסן את גלולת התא ב -80 מעלות צלזיוס לילה.</li>
	<li>מצעד זה ואילך לשמור את המדגם על הקרח כל הזמן. להמיס את גלולת התא ב 50 מ"ל של מאגר תמוגה היסטון לכל 1 L של תרבות.</li>
	<li>Sonicate על פי המחזור הבא: 1 s על, 1 הנחה, סה"כ בזמן: 3 דקות ב 60% משרעת.</li>
	<li>גופי הכללה גלולה ב 41,600 x g במשך 45 דקות.</li>
	<li>השלך את גופי ההכללה העל-טבעיים וההתחדשות ב- 30 מ"ל של מאגר תמוגה של היסטון. גלולה הכללה bodes ב 41,600 x g במשך 30 דקות.</li>
	<li>השלך את גופי הכללה supernatant ו resuspend ב 30 מ"ל של חיץ לשטוף גלולה. גופי הכללה גלולה ב 41,600 x g במשך 30 דקות.</li>
	<li>להשליך את גופי הכללה supernatant ולהמיס ב 25 מ"ל של 6 M Guanidine הידרוכלוריד (GuHCl) חיץ. דגירה עם עצבנות ב 37 °C (69 °F) עבור 1 שעות. הערה: במידת הצורך, גופי הכללה ניתן לדגור עם עצבנות לילה ב 4 מעלות צלזיוס.</li>
	<li>גלולה הכללה bodes ב 41,600 x g במשך 45 דקות. דגירה supernatant עם 1 מ"ל של שף Ni-NTA שווה עם 6 M GuHCl חיץ עבור 2 שעות.</li>
	<li>המשך עם טיהור Ni-NTA בתנאים מפורקים. שטפו את העמודה עם נפח של 3 עמודות של מאגר שטיפת עמודות. חלבון histone Elute עם 10 מ"ל של חיץ אלוטיון. הערה: ניסיון לרכז את החלבון כאן הוא אופציה אבל היסטוני אצטילציה הם מאוד בלתי צפויים והוא יכול בקלות לזרז. לא מומלץ להתרכז מעבר ל-2 מ"ל בנפח הכולל.</li>
	<li>דיאליז נרחב חלבון histone אצטילאט נגד 5% חומצה אצטית חוצץ כדי להסיר מלחים. Dialyze עבור 3 שעות בכל פעם ב 4 מעלות צלזיוס, החלפת חיץ טרי מינימום של 6 פעמים. הערה: לשיפור טוהר החלבון, קיימת אפשרות לחייג נגד מים טהורים. עם זאת, זה גורם משקעים משמעותיים וירידה בתפוקה אשר עשוי להיות לא רצוי עבור חלבונים histone אצטילציה בתשואה נמוכה.</li>
	<li>Aliquot ו lyophilize חלבון, ולאחסן ללא הגבלת זמן ב -80 מעלות צלזיוס. חלבוני היסטון מסוג פראי מניבים בדרך כלל 10-50 מ"ג/ל' ואילו חלבוני היסטון עם אצטילאט מניבים פחות מ-10 מ"ג/ליטר בהתאם לאתר הליצין הספציפי. לדוגמה, H3K79Ac ממוצעים 5 מ"ג / ליטר.</li>
</ol>3. ביטוי חלבון היסטון מסוג פראי
<ol><li>להרכבת נוקלאוזומים מלאים, יש לבטא את כל 4 חלבוני ההיסטון. כאשר מבטאים ומטהרים היסטונים מסוג פראי הפרוטוקול זהה להיסטוני האצטילאט למעט הדברים הבאים:<ol>
<li>אל תבצע המרה משותפת. אין להשתמש ב- pEVOL-AcKRS עבור ביטוי histone מסוג בר. התאימו אנטיביוטיקה בהתאם.</li>
		<li>אין להשתמש בקו תא מחיקה של CobB או להוסיף Nicotinamide, AcK או arabinose במהלך אינדוקציה של ביטוי תאי.</li>
	</ol>
</li>
</ol>4. הכנת 601 DNA
הערה: רצף דנ"א ממוטב שתוכנן בעבר למיקום נוקלאוזום ישיר מורכב עם תמנוני היסטון כדי לייצר מונונוקלאוזום ביעילות גבוהה. רצף זה נקרא 601 DNA או רצף Widom. רצף זה הפך לרצף הדנ"א הסטנדרטי למחקרי חוץ גופיות של נוקלאוזומים ממסיעות שיפוץ כרומטין למדידות מולקולה אחת10.
<ol><li>כדי להכין כמויות משמעותיות של 601 DNA להרכבה גרעינית, להפוך pGEM-3z/601 לתוך למעלה 10 תאים ולגדול 10 מ"ל של תרבות עבור הגברה פלסמיד ומיצוי. השתמש בערכת חילוץ פלסמיד ופעל בהתאם להמלצת היצרן.</li>
	<li>השתמש בפולימראז PFU מבוטא בתוך הארגון (יעיל יותר) עבור פרוטוקול הגברה זה. הגדר תגובת PCR: לתגובת 250 μL, להשתמש 207.5 μL autoclaved MQ H2O, 25 μL 10x PFU Buffer, 5 μL קדימה פריימר: ctggagaatccctggccg, 5 μL הפוך פריימר: acaggatgtatatatctctgacacg, 5 μL dNTP לערבב, 2.5 מיקרול PFU אנזים. אנחנו בדרך כלל רצים 60 תגובות בבת אחת כדי לקבל מספיק DNA להרכיב.</li>
	<li>השתמש בטמפרטורת חישול של 52 °C (70 °F) עבור 30 s וזמן הארכה של 30 s אם באמצעות פולימראז PFU. אחרת, פעל בהתאם לתנאים המומלצים על-ידי היצרנים.</li>
	<li>לאחר ש- PCR נעשה, השתמש בערכת ניקוי PCR לבחירתך כדי לטהר את מוצר PCR.</li>
</ol>5. הרכבה של אוקטמר היסטון
<ol><li>להמיס aliquots של כדורי חלבון histone H2A, H2B, H3, ו H4 כך שיש מלאי נפרד של כל חלבון histone במאגר GuHCl עם נפח כולל של 100 μL.</li>
	<li>לחשב את הריכוז של כל חלבון histone על ידי מדידת ספיגת A280.</li>
	<li>אם הספיגה גדולה מ-1 עבור חלבון כלשהו, יש לדלל עם מאגר GuHCl כדי לקבל ריכוז מדויק יותר.</li>
	<li>ערבבו חלבוני H2A ו-H2B ביחס טוחנת של 1:1 ודללו לריכוז חלבון כולל של 4 מיקרוגרם/μL. חזרו על הפעולה עבור H3 ו-H4.</li>
	<li>חייג ברצף ב- 4 °C (70 °F) מול מאגר TE של 2 M למשך לילה, מאגר TE M אחד עבור 2 שעות ומאגר TE של 0.5 M למשך 5 שעות. הערה: השלב השני והשלישי של הדיאליזה גורם קונפורמציות לא יציבות של חלבון לזרז החוצה. הוא צפוי לראות משקעים כבדים בשלבים אלה.</li>
	<li>הסר משקעים על ידי צנטריפוגה ב 16,800 x g ב 4 מעלות צלזיוס.</li>
	<li>שוב, לחשב את הריכוז של דימרים histone (תערובת H2A / H2B) ו tetramers (תערובת H3/H4) מדידת ספיגת A280.</li>
	<li>מערבבים דימרים וטטרמה ביחס טוחנת של 1:1 ומתאימים את NaCl ל-2 מ' על ידי תוספת של NaCl מוצק.</li>
	<li>תמנון Histone ניתן לאחסן ב 4 מעלות צלזיוס והוא יציב יותר מאשר dimers ו tetramers. לעולם אל תקפיא את תמנון היסטון מכיוון שזה יכול לגרום לפירוק.</li>
	<li>אם הרכבה עם היסטוני אצטילאט, פשוט להחליף את החלבון סוג הבר עם חלבון אצטילאט בהליך.</li>
</ol>6. הרכבה נוקלאוזום
<ol><li>השתמש במאגר TE 100x וב- NaCl מלא כדי להתאים 601 דנ"א למאגר TE של 2M. הוסף את ה- DNA של 601 במאגר TE של 2M לתמנון histone ביחס טוחנת של 0.85:1 ל- 0.90:1. ניתן להוסיף יחס נמוך יותר של דנ"א אם קיים דנ"א חופשי בניתוח משמרת הג'ל.</li>
	<li>מעבירים את תערובת הדנ"א-histone לשקית דיאליזה ומניחים כ-200 מ"ל של מאגר TE 2M (או יותר אם מרכיבים דגימות מרובות) ומערבבים בעדינות רבה ב-4 מעלות צלזיוס.</li>
	<li>הגדר משאבה פריסטלית לטיהור כדי לטפטף באיטיות ללא מאגר TE מלח. כאשר עוצמת הקול הוכפלה בערך, שפוך חצי מעוצמת הקול. עשה זאת לפחות 4 פעמים בסך הכל. עם משאבה זה יכול לקחת 4-8 שעות בהתאם לנפח ההתחלה. גרעינים נוצרים כאשר ריכוז המלח מצטמצם ל-150 מ"ר (נמדד על ידי מד מליחות).</li>
	<li>לאחר ריכוז המלח מצטמצם ל 150 מ"מ, dialyze נגד מאגר TE 20 מ"מ לילה.</li>
	<li>הסר משקעים על ידי צנטריפוגה ולמדוד את הריכוז של הגרעינים על ידי קריאהA 260 באמצעות קורא צלחת.</li>
	<li>הוסף פרוטאז His-TEV (TEV: נוקלאוזום 1:30, w:w) ודגר לילה ב 4 מעלות צלזיוס כדי להסיר את כל תגי היסטידין. הסר את זיהומים תג היסטידין מתמיסת הגרעין על ידי שף Ni-NTA למשוך למטה.</li>
	<li>כדי למקם את הגרעין הומוגנית המדגם, דגירה ב 60 °C (60 °F) במשך 1 שעות. הערה: עבור אתרים עם אצטילאט שאינם יציבים במיוחד, ייתכן שצעד זה לא מומלץ.</li>
	<li>יש לאחסן גרעינים לטווח קצר (כמה שבועות) ב-4 מעלות צלזיוס.</li>
	<li>לאחסון לטווח ארוך, נוקלאוזומים dialyze נגד מאגר אחסון ולאחסן ב -80 °C (60 °F).</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

אין אינטרסים כלכליים מתחרים להצהיר על ידי אף אחד מהכותבים.

זה חיוני כדי לעקוב אחר פרוטוקול זה בכל פרט במהלך ניסוי. Nucleosomes אינם יציבים מאוד הרבה ניסוי וטעייה נכנסה לתוך קביעת פרוטוקול זה. זה המפתח להסרת משקעים בכל שלב (או בכל פעם שנצפה) כי חלקיקים יכולים בקלות להפריע לתהליכי ההרכבה. תמיד לשמור דגימות היסטון על קרח. אם נוקלאוזומים מאוחסנים ב 4 מעלות צל...

השתמשנו ב-PylRS וב-tRNAPyl כדי לסנתז ולהרכיב מונונוקלאוזומים משוחזרים עם היסטוני אצטילציה ספציפיים לאתר. PylRS הוכיחה את עצמה ככלי להרחבת קוד גנטי לייצור חלבונים עם שינויים לאחר תרגום (PTMs) והתפתחה גנטית כדי לשלב כ -200 ncAAs שונים. PylRS משלבת בקודון עצירת ענבר, הסרת תחרות מחומצות אמינו אחרות במהלך התרגום. PylRS התגלה לראשונה בארכיאולוגיה מתנוגנית, ומאז נוצל בביולוגיה כימית כדי לשלב קבוצות כימיות תגובתיות חדשניות לחלבונים1,2.
MmAcKRS1 התפתח מ מתנוזרצ'ינה mazei PylRS ומשמש לעתים קרובות במעבדה שלנו לסינתזה של חלבונים acetylated3,4,5,6. MmAcKRS1 מספק AcK באתר מוטציה ענבר mRNA של בחירה במהלך התרגום ב Escherichia קולי. טכניקה זו שימשה בעבר לשלב AcK ב K4, K9, K14, K18, K23, K27, K36, K56, K64, ו K79 היסטון H3 לידין אתרים ללמוד את הפעילות של Sirtuin 1, 2, 6, ו 7 על מונונוקלאוזומים acetylated4,5,6. כאן אנו מפרטים שיטה זו כדי להביע היסטונים אצטילאטים ו לבנות מחדש נוקלאוזומים acetylated.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.5 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>1 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>100x TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>2 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>20 mM TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>6 M GuHCl</td>
			<td></td>
			<td></td>
			<td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>Acetyllysine</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Column Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisherbrand&#160;Variable-Flow Chemical Transfer Pump</td>
			<td>Fischer Scientific</td>
			<td>15-077-67</td>
			<td></td>
		</tr>
		<tr>
			<td>His-TEV protease</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Histone Lysis Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td>
		</tr>
		<tr>
			<td>Ni-NTA Resin</td>
			<td></td>
			<td></td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td>
		</tr>
		<tr>
			<td>PCR Clean-Up Kit</td>
			<td>Epoch Life Sicences</td>
			<td>2360050</td>
			<td></td>
		</tr>
		<tr>
			<td>Pellet Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>petDUET-His-SUMO-TEV-H4</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2A</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2B</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pEVOL-AckRS</td>
			<td>Addgene</td>
			<td>137976</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-3z/601</td>
			<td>Addgene</td>
			<td>26656</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

חלבוני histone אצטילאט יכול לבוא לידי ביטוי בקלות ב Escherichia coli קידוד מוטציה, Nε-אצטיל-ליצין (AcK) ספציפי מתנוסרצ'ינה מזי פירוסין tRNA-סינתטאז (MmAcKRS1) ו tRNA קוגנטיבי שלה (tRNAPyl)להרכיב מונונוקלאוזומים משוחזרים עם היסטון אצטילאט ספציפי לאתר. MmAcKRS1 ו- tRNAPyl מספקים AcK באתר מוטציה ענבר ב mRNA של בחירה במהלך התרגום ב Escherichia coli. טכניקה זו שימשה בהרחבה כדי לשלב AcK באתרי ליזין H3. סינתזת Pyrrolysyl-tRNA (PylRS) ניתן גם להתפתח בקלות לשלב חומצות אמינו לא קאנוניות אחרות (ncAAs) עבור שינוי חלבון ספציפי לאתר או פונקציונליזציה. כאן אנו מפרטים שיטה לשלב AcK באמצעות מערכת MmAcKRS1 לתוך H3 histone ולשלב חלבוני H3 אצטילאט לתוך mononucleosomes מחדש. מונונוקלאוזומים משוחזרים אצטילאטים יכולים לשמש מבחנים ביוכימיים ומחייבים, קביעת מבנה ועוד. השגת מונונוקלאוזומים מותאמים היא חיונית לתכנון ניסויים הקשורים לגילוי אינטראקציות חדשות והבנת אפיגנטיקה.

ניתן להעריך דימרים, טטרמרים ושמיניות על ידי הפעלת ג'ל SDS PAGE של 12%(איור 1 ואיור 2). כאן ניתן לראות שלחלק מהטטרמרים בעלי האצטילאט יש תשואה נמוכה יותר מאחרים (איור 1). למעשה, ככל שאזור הליבה קרוב יותר לאזור הליבה, כך התשואה נצפתה נמ?...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

כאן אנו מציגים שיטה לבטא חלבוני histone אצטילאט באמצעות הרחבת קוד גנטי להרכיב נוקלאוזומים מחדש במבחנה.

אתר ספציפי ליסין אצטילציה של היסטונים עבור שחזור Nucleosome באמצעות הרחבת קוד גנטי ב Escherichia קולי

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K Views.  Texas A&M University. כאן אנו מציגים שיטה לבטא חלבוני histone אצטילאט באמצעות הרחבת קוד גנטי להרכיב נוקלאוזומים מחדש במבחנה.

Video: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique applications for OMV where traditional nanoparticles are proving too difficult to synthesize. To date, all Gram-negative bacteria have been shown to produce OMV demonstrating packaging of a variety of cargo that includes small molecules, peptides, proteins and genetic material. Based on their diverse cargo, OMV are implicated in many biological processes ranging from cell-cell communication to gene transfer and delivery of virulence factors depending upon which bacteria are producing the OMV. Only recently have bacterial OMV become accessible for use across a wide range of applications through the development of techniques to control and direct packaging of recombinant proteins into OMV. This protocol describes a method for the production, purification, and use of enzyme packaged OMV providing for improved overall production of recombinant enzyme, increased vesiculation, and enhanced enzyme stability. Successful utilization of this protocol will result in the creation of a bacterial strain that simultaneously produces a recombinant protein and directs it for OMV encapsulation through creating a synthetic linkage between the recombinant protein and an outer membrane anchor protein. This protocol also details methods for isolating OMV from bacterial cultures as well as proper handling techniques and things to consider when adapting this protocol for use for other unique applications such as: pharmaceutical drug delivery, medical diagnostics, and environmental remediation.

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

A protocol for the production, purification, and use of enzyme packaged outer membrane vesicles (OMV) providing for enhanced enzyme stability for implementation across diverse applications is presented.

אריזת חלבון בימוי בתוך החיצון ממברנה השלפוחית ​​מ<em&gt; Coli Escherichia</em&gt;: עיצוב, ייצור טיהור

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique ...

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many of these conditions cause protein unfolding in the cell and have detrimental impact on the survival of the organism. A group of unrelated, stress-specific molecular chaperones have been shown to play essential roles in the survival of these stress conditions. While fully folded and chaperone-inactive before stress, these proteins rapidly unfold and become chaperone-active under specific stress conditions. Once activated, these conditionally disordered chaperones bind to a large number of different aggregation-prone proteins, prevent their aggregation and either directly or indirectly facilitate protein refolding upon return to non-stress conditions. The primary approach for gaining a more detailed understanding about the mechanism of their activation and client recognition involves the purification and subsequent characterization of these proteins using in vitro chaperone assays. Follow-up in vivo stress assays are absolutely essential to independently confirm the obtained in vitro results.
This protocol describes in vitro and in vivo methods to characterize the chaperone activity of E. coli HdeB, an acid-activated chaperone. Light scattering measurements were used as a convenient read-out for HdeB&#39;s capacity to prevent acid-induced aggregation of an established model client protein, MDH, in vitro. Analytical ultracentrifugation experiments were applied to reveal complex formation between HdeB and its client protein LDH, to shed light into the fate of client proteins upon their return to non-stress conditions. Enzymatic activity assays of the client proteins were conducted to monitor the effects of HdeB on pH-induced client inactivation and reactivation. Finally, survival studies were used to monitor the influence of HdeB&#39;s chaperone function in vivo.

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

This study describes biophysical, biochemical and molecular techniques to characterize the chaperone activity of Escherichia coli HdeB under acidic pH conditions. These methods have been successfully applied for other acid-protective chaperones such as HdeA and can be modified to work for other chaperones and stress conditions.

איתור של הפעילות תלויה pH של<em&gt; Coli Escherichia</em&gt; Chaperone HdeB<em&gt; במבחנה</em&gt; ו<em&gt; In vivo</em

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many ...

Efficient and Site-specific Antibody Labeling by Strain-promoted Azide-alkyne Cycloaddition

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is protein conjugation by genetically introducing an unnatural amino acid containing a bioorthogonal functional group. This report describes a detailed protocol for site-specific antibody conjugation. The protocol includes experimental details for the genetic incorporation of an azide-containing amino acid, and the conjugation reaction by strain-promoted azide-alkyne cycloaddition (SPAAC). This strain-promoted reaction proceeds by simple mixing of the reacting molecules at physiological pH and temperature, and does not require additional reagents such as copper(I) ions and copper-chelating ligands. Therefore, this method would be useful for general protein conjugation and development of antibody drug conjugates (ADCs).

Here, we present a protocol to site-specifically introduce chemical probes into an antibody fragment by genetically incorporating an azide-containing amino acid, and subsequently coupling the azide with a chemical probe by strain-promoted azide-alkyne cycloaddition (SPAAC).

יעיל אתר ספציפי תיוג נוגדן ידי cycloaddition יזיד-אלקין קדם-Strain

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is ...

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

כינון של נוקלאוזום עם דיפרנציאלי איזוטופ שכותרתו היסטונים אחות

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. The relative levels of different tRNAs, and the ratio of aminoacylated tRNA to total tRNA, known as the charging level, are important factors in determining the accuracy and speed of translation. Therefore, the abundance and charging levels of tRNAs are important variables to measure when studying protein synthesis, for example under various stress conditions. Here, we describe a method for harvesting tRNA and directly measuring both the relative abundance and the absolute charging level of specific tRNA species in Escherichia coli. The tRNA is harvested in such a way that the labile bond between the tRNA and its amino acid is preserved. The RNA is then subjected to gel electrophoresis and Northern blotting, which results in separation of the charged and uncharged tRNAs. The levels of specific tRNAs in different samples can be compared due to the addition of spike-in cells for normalization. Prior to RNA purification, we add 5% of E. coli cells that overproduce the rare tRNAselC to each sample. The amount of the tRNA species of interest in a sample is then normalized to the amount of tRNAselC in the same sample. Addition of spike-in cells prior to RNA purification has the advantage over addition of purified spike-in RNAs that it also accounts for any differences in cell lysis efficiency between samples.

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Here we present a method for directly measuring transfer RNA charging levels from purified Escherichia coli RNA as well as a way to compare relative levels of transfer RNA, or any other short RNA, across different samples based on the addition of spike-in cells expressing a reference gene.

כימות של רמות של RNAs העברה ב- Escherichia coli השפע וטעינה

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. ...

Purification and Reconstitution of TRPV1 for Spectroscopic Analysis

Polymodal ion channels transduce multiple stimuli of different natures into allosteric changes; these dynamic conformations are challenging to determine and remain largely unknown. With recent advances in single-particle cryo-electron microscopy (cryo-EM) shedding light on the structural features of agonist binding sites and the activation mechanism of several ion channels, the stage is set for an in-depth dynamic analysis of their gating mechanisms using spectroscopic approaches. Spectroscopic techniques such as electron paramagnetic resonance (EPR) and double electron-electron resonance (DEER) have been mainly restricted to the study of prokaryotic ion channels that can be purified in large quantities. The requirement for large amounts of functional and stable membrane proteins has hampered the study of mammalian ion channels using these approaches. EPR and DEER offer many advantages, including determination of the structure and dynamic changes of mobile protein regions, albeit at low resolution, that might be difficult to obtain by X-ray crystallography or cryo-EM, and monitoring reversible gating transition (i.e., closed, open, sensitized, and desensitized). Here, we provide protocols for obtaining milligrams of functional detergent-solubilized transient receptor potential cation channel subfamily V member 1 (TRPV1) that can be labeled for EPR and DEER spectroscopy.

This article describes specific methods to obtain biochemical quantities of detergent-solubilized TRPV1 for spectroscopic analysis. The combined protocols provide biochemical and biophysical tools that can be adapted to facilitate structural and functional studies for mammalian ion channels in a membrane-controlled environment.

טיהור, בנייתו מחדש של TRPV1 לניתוח Spectroscopic

Polymodal ion channels transduce multiple stimuli of different natures into allosteric changes; these dynamic conformations are challenging to determine ...

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts of recombinant RNAs are limited. Here, we describe a protocol to produce large amounts of recombinant RNA in Escherichia coli based on co-expression of a chimeric molecule that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. Viroids are relatively small, non-coding, highly base-paired circular RNAs that are infectious to higher plants. The host plant tRNA ligase is an enzyme recruited by viroids that belong to the family Avsunviroidae, such as Eggplant latent viroid (ELVd), to mediate RNA circularization during viroid replication. Although ELVd does not replicate in E. coli, an ELVd precursor is efficiently transcribed by the E. coli RNA polymerase and processed by the embedded hammerhead ribozymes in bacterial cells, and the resulting monomers are circularized by the co-expressed tRNA ligase reaching a remarkable concentration. The insertion of an RNA of interest into the ELVd scaffold enables the production of tens of milligrams of the recombinant RNA per liter of bacterial culture in regular laboratory conditions. A main fraction of the RNA product is circular, a feature that facilitates the purification of the recombinant RNA to virtual homogeneity. In this protocol, a complementary DNA (cDNA) corresponding to the RNA of interest is inserted in a particular position of the ELVd cDNA in an expression plasmid that is used, along the plasmid to co-express eggplant tRNA ligase, to transform E. coli. Co-expression of both molecules under the control of strong constitutive promoters leads to production of large amounts of the recombinant RNA. The recombinant RNA can be extracted from the bacterial cells and separated from the bulk of bacterial RNAs taking advantage of its circularity.

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

Here, we present a protocol to produce large amounts of recombinant RNA in Escherichia coli by co-expressing a chimeric RNA that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. The main product is a circular molecule that facilitates purification to homogeneity.

ייצור בקנה מידה גדול של RNAs רקומביננטי על גרדום מעגלית באמצעות מערכת נגזר וירואיד ב- Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts ...

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic acid (sRNA) molecules and target messenger RNAs (mRNAs). In addition, site-directed mutagenesis is used to map specific protein binding sites to RNA. A 2-step and 3-step PCR based introduction of mutations is described. The approach is relevant to all protein-RNA and RNA-RNA interaction studies. In short, the technique relies on designing primers with the desired mutation(s), and through 2 or 3 steps of PCR synthesizing a PCR product with the mutation. The PCR product is then used for cloning. Here, we describe how to perform site-directed mutagenesis with both the 2- and 3-step approach to introduce mutations to the sRNA, McaS, and the mRNA, csgD, to investigate RNA-RNA and RNA-protein interactions. We apply this technique to investigate RNA interactions; however, the technique is applicable to all mutagenesis studies (e.g., DNA-protein interactions, amino-acid substitution/deletion/addition). It is possible to introduce any kind of mutation except for non-natural bases but the technique is only applicable if a PCR product can be used for downstream application (e.g., cloning and template for further PCR).

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in deoxyribonucleic acid (DNA). This protocol describes how to do site-directed mutagenesis with a 2-step and 3-step polymerase chain reaction (PCR) based approach, which is applicable to any DNA fragment of interest.

מוטגנזה עבור במבחנה, בניסויים Vivo ביטוי עם אינטראקציות RNA ב- Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic ...

In Vitro Ubiquitination and Deubiquitination Assays of Nucleosomal Histones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination of chromatin function and DNA-associated processes. This modification involves a sequential action of several enzymes including E1 ubiquitin-activating, E2 ubiquitin-conjugating and E3 ubiquitin-ligase and is reversed by deubiquitinases (DUBs). Ubiquitination induces degradation of proteins or alteration of protein function including modulation of enzymatic activity, protein-protein interaction and subcellular localization. A critical step in demonstrating protein ubiquitination or deubiquitination is to perform in vitro reactions with purified components. Effective ubiquitination and deubiquitination reactions could be greatly impacted by the different components used, enzyme co-factors, buffer conditions, and the nature of the substrate.&#160; Here, we provide step-by-step protocols for conducting ubiquitination and deubiquitination reactions. We illustrate these reactions using minimal components of the mouse Polycomb Repressive Complex 1 (PRC1), BMI1, and RING1B, an E3 ubiquitin ligase that monoubiquitinates histone H2A on lysine 119. Deubiquitination of nucleosomal H2A is performed using a minimal Polycomb Repressive Deubiquitinase (PR-DUB) complex formed by the human deubiquitinase BAP1 and the DEUBiquitinase ADaptor (DEUBAD) domain of its co-factor ASXL2. These ubiquitination/deubiquitination assays can be conducted in the context of either recombinant nucleosomes reconstituted with bacteria-purified proteins or native nucleosomes purified from mammalian cells. We highlight the intricacies that can have a significant impact on these reactions and we propose that the general principles of these protocols can be swiftly adapted to other E3 ubiquitin ligases and deubiquitinases.

Ubiquitination is a post-translational modification that plays important roles in cellular processes and is tightly coordinated by deubiquitination. Defects in both reactions underlie human pathologies. We provide protocols for conducting ubiquitination and deubiquitination reaction in vitro using purified components.

בתחומי החוץ והאי של האבנים הנוזומטיות

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination ...

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein aggregation. The accumulation of protein aggregates in bacterial cells can lead to significant alterations in the cellular phenotypic behavior, including a reduction in growth rates, stress resistance, and virulence. Several experimental procedures exist for the examination of these stressor-mediated phenotypes. This paper describes an optimized assay for the extraction and visualization of aggregated and soluble proteins from different Escherichia coli strains after treatment with a silver-ruthenium-containing antimicrobial. This compound is known to generate reactive oxygen species and causes widespread protein aggregation. 
The method combines a centrifugation-based separation of protein aggregates and soluble proteins from treated and untreated cells with subsequent separation and visualization by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie staining. This approach is simple, fast, and allows a qualitative comparison of protein aggregate formation in different E. coli strains. The methodology has a wide range of applications, including the possibility to investigate the impact of other proteotoxic antimicrobials on in vivo protein aggregation in a wide range of bacteria. Moreover, the protocol can be used to identify genes that contribute to increased resistance to proteotoxic substances. Gel bands can be used for the subsequent identification of proteins that are particularly prone to aggregation.

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

This protocol describes the extraction and visualization of aggregated and soluble proteins from Escherichia coli after treatment with a proteotoxic antimicrobial. Following this procedure allows a qualitative comparison of protein aggregate formation in vivo in different bacterial strains and/or between treatments.