Wir danken Dr. Wesley Wang für die Grundlagen für dieses Protokoll und seine wertvolle Mentorenschaft. Diese Arbeit wurde teilweise von den National Institutes of Health (Grants R01GM127575 und R01GM121584) und der Welch Foundation (Grant A-1715) unterstützt.

1. Plasmidkonstruktion
<ol><li>Beginnen Sie mit der Entscheidung, welches Histonprotein acetyliert wird und an welcher Lysin-Stelle. Mutieren Sie die Seite zum Bernstein-Stop-Codon (TAG) mit Website gerichtet Etagenese. HINWEIS: Es gibt vier zuvor entwickelte Plasmide, die für die Expression von Histonproteinen verwendet werden. Alle vier Histonproteine wurden mit einem N-terminalen Histidin-Tag in den pETDuet-1-Vektor geklont. Histone H4 enthält auch ein SUMO-Tag, den Ursprung der Replikation colE1 mit einer Kopiernummer von etwa 40, Ampicillin-resistent, und ein T7-Promoter.<ol>
<li>Entwerfen Sie Vorwärts- und Rückwärtsprimer, die eine TAG-Mutation an der gewünschten Stelle enthalten (ersetzen eines vorhandenen Lysin-Codons durch das Bernstein-Stop-Codon) in einem der vier Histonproteinplasmide.</li>
		<li>Verwenden Sie Vollplasmid-PCR, um das TAG-haltige Plasmid zu verstärken. Bestimmen Sie eine geeignete Glühtemperatur für die Primer. Im Allgemeinen reicht die Schmelztemperatur (Tm) der Primer minus 5 °C aus. Bei Schwierigkeiten bei der Herstellung eines PCR-Produkts kann ein Temperaturgradient um Tm - 5 °C verwendet werden, um die Glühtemperatur für die Amplifikation zu optimieren. HINWEIS: In diesem Experiment wurde eine hauseigene pFU-Polymerase für 30 Zyklen mit folgenden Bedingungen verwendet: 94 °C für 30 s (Denaturierung), Glühtemperatur für 30 s und 72 °C für 6 min (oder 1 min pro Kilobase-Paar). Weitere Informationen zu dieser Art von PCR-Methode finden Sie unter Liu und Naismith7.</li>
		<li>Bereinigen Sie das PCR-Produkt mit einem PCR-Bereinigungskit, indem Sie das Herstellerprotokoll befolgen. Analysieren Sie das PCR-Produkt durch Agarose-Gel-Elektrophorese und anschließende Ethidiumbromidfärbung.</li>
		<li>Ligate das Plasmid durch Inkubieren mit T4 Ligase über Nacht bei 16 °C.</li>
	</ol>
</li>
	<li>Verwandeln Sie zunächst das TAG-haltige Plasmid (AmpR) in chemisch kompetente Escherichia coli. Wählen Sie mindestens 4 Kolonien aus der Transformation und reinigen Sie das Plasmid. Machen Sie Zellbestände mit Glycerin nach Standardmethoden und lagern Sie bei -80 °C. Senden Sie zur Sequenzierung, um die gewünschte TAG-Mutation zu bestätigen.</li>
	<li>Sobald die Sequenz bestätigt ist, transformieren Sie das TAG-haltige Plasmid (AmpR) mit pEVOL-AckRS (ChlR) in chemisch kompetentes CobB (das einzige in E. coli.) bekannte Histonlysin-Deacetylase, das BL21-Zellen mit der Wärmeschockmethode löscht. pEVOL ist ein Plasmid mit einer Mittleren Kopierzahl bis zum Ursprung p15A mit niedriger Kopiernummer. HINWEIS: Die pEVOL-Reihe von Plasmiden wurde auf der Grundlage früherer Studien erstellt, die zeigten, dass eine erhöhte Expression des orthogonalen AaRS/tRNATyr-Paares wirksam bei der Verringerung der Proteinkürzung und bei der Erhöhung der Gesamtausbeute mutierter Proteine8war. Wenn CobB-Deletionszellen nicht zugänglich sind, fahren Sie mit chemisch kompetenten BL21-Zellen fort. CobB ist ein Sirtuin-ähnliches Histon-Lysin-Deacetylase und Nicotinamid kann in einer Endkonzentration von 5 mM während der Histonproteinexpression zugesetzt werden, um CobB als alternativen Ansatz zu hemmen9.</li>
	<li>Machen Sie einen Zellbestand und lagern Sie bei -80 °C.</li>
</ol>2. Acetylatierte Histonproteinexpression
<ol><li>Bereiten Sie 1 L autoklavierte 2YT-Medien (oder Volumen ihrer Wahl) in einem Kulturkolben vor.</li>
	<li>20 ml 2YT-Medien mit den entsprechenden Antibiotika mit dem kotransformierten Zellbestand, der das TAG-haltige Plasmid (AmpR) und pEVOL-AckRS (ChlR) enthält, impfen und bei 37 °C bis OD = 0,6 (4-6 h) wachsen.</li>
	<li>Fügen Sie die entsprechenden Antibiotika zu den 1 L autoklavierten 2YT-Medien hinzu und impfen Sie mit der 20 ml-Starterkultur. Wachsen bei 37 °C bis OD = 0,6-0,8 (2-3 h).</li>
	<li>Fügen Sie induzierende Mittel und Acetyllysin (AcK) zu den Endkonzentrationen von IPTG 1 mM, 0,2% Arabinose und AcK 5 mM hinzu.</li>
	<li>Wachsen Sie die Kultur bei 37 °C für 6-8 h.</li>
	<li>Pelletzellen bei 2.700 x g für 15 min.</li>
	<li>Lagern Sie das Zellpellet über Nacht bei -80 °C.</li>
	<li>Ab diesem Schritt halten Sie die Probe immer auf Eis. Lösen Sie das Zellpellet in 50 ml Histonlysepuffer pro 1 L Kultur.</li>
	<li>Beschallen nach dem folgenden Zyklus: 1 s an, 1 s aus, gesamtzeit: 3 min bei 60% Amplitude.</li>
	<li>Pellet-Einschlusskörper bei 41.600 x g für 45 min.</li>
	<li>Entsorgen Sie den Überstand und setzen Sie die Einschlusskörper in 30 ml Histonlysepuffer wieder aus. Pellet-Einschluss verheißt bei 41.600 x g für 30 min.</li>
	<li>Entsorgen Sie den Überstand und setzen Sie die Einschlusskörper in 30 ml Pelletwaschpuffer wieder aus. Pellet-Einschlusskörper bei 41.600 x g für 30 min.</li>
	<li>Entsorgen Sie den Überstand und lösen Sie die Einschlüsse in 25 ml von 6 M Guanidinhydrochlorid (GuHCl) Puffer auf. Mit Rührung bei 37 °C für 1 h inkubieren. HINWEIS: Bei Bedarf können Einschlusskörper über Nacht bei 4 °C mit Rührung inkubiert werden.</li>
	<li>Pellet-Einschluss verheißt 45 min. 41.600 x g. Inkubieren Sie den Überstand mit 1 ml Ni-NTA Harz, der mit 6 M GuHCl Puffer für 2 h ausgeglichen wird.</li>
	<li>Fahren Sie mit der Ni-NTA-Reinigung unter denaturierten Bedingungen fort. Waschen Sie die Spalte mit 3 Spaltenvolumen des Spaltenwaschpuffers. Elute acetylierte Stonprotein mit 10 ml Elutionspuffer. HINWEIS: Der Versuch, das Protein hier zu konzentrieren, ist eine Option, aber acetylierte Histone sind sehr unvorhersehbar und können leicht ausfallen. Es wird nicht empfohlen, sich über 2 ml gesamtvolumen zu konzentrieren.</li>
	<li>Extensiv dialysieren das acetylierte Histonprotein gegen 5% Essigsäurepuffer, um Salze zu entfernen. Dialyse für 3 h zu einer Zeit bei 4 °C, Austausch gegen frischen Puffer mindestens 6 mal. HINWEIS: Für eine verbesserte Proteinreinheit gibt es eine Option, gegen reines Wasser zu dialysieren. Dies führt jedoch zu einer erheblichen Niederschlagsmenge und Ertragsminderung, die bei ertragsarmen acetylierten Histonproteinen unerwünscht sein kann.</li>
	<li>Aliquot und Lyophilize Protein, und speichern sie unbegrenzt bei -80 °C. Wildtyp-Histonproteine ergeben in der Regel 10-50 mg/L, während acetylierte Histonproteine je nach spezifischer Lysin-Site weniger als 10 mg/L ergeben. H3K79Ac durchschnittlich 5 mg/L.</li>
</ol>3. Wildtyp-Histonproteinexpression
<ol><li>Um vollständige Nukleosomen zu montieren, drücken Sie alle 4 Histonproteine aus. Beim Ausdrücken und Reinigen von Wildtyphistonen ist das Protokoll mit den acetylierten Histonen identisch, mit Ausnahme der folgenden:<ol>
<li>Führen Sie keine Co-Transformation durch. Verwenden Sie pEVOL-AcKRS nicht für den Typ Histone-Ausdruck. Passen Sie Antibiotika entsprechend an.</li>
		<li>Verwenden Sie keine CobB-Deletionszelllinie oder fügen Sie Nicotinamid, AcK oder Arabinose während der Induktion der zellulären Expression hinzu.</li>
	</ol>
</li>
</ol>4. Herstellung von 601 DNA
HINWEIS: Eine zuvor entwickelte optimierte DNA-Sequenz zur direkten Nukleosompositionierung wird mit Histon-Okimatoren zusammengesetzt, um Mononukleosom mit hoher Effizienz zu produzieren. Diese Sequenz wird als 601 DNA oder die Widom-Sequenz bezeichnet. Diese Sequenz ist zur Standard-DNA-Sequenz für In-vitro-Studien von Nukleosomen von Chromatin-Remodeling-Assays bis hin zu Einzelmolekülmessungen10geworden.
<ol><li>Um signifikante Mengen von 601 DNA für die Nukleom-Montage vorzubereiten, transformieren Sie pGEM-3z/601 in Top 10 Zellen und wachsen 10 ml Kultur für die Plasmidverstärkung und Extraktion. Verwenden Sie ein Plasmid-Extraktionskit und folgen Sie der Empfehlung des Herstellers.</li>
	<li>Verwenden Sie für dieses Amplifikationsprotokoll eine im Eigenen Haus ausgedrückte PFU-Polymerase (effizienter). Einrichten einer PCR-Reaktion: Verwenden Sie für die 250-L-Reaktion 207,5 l autoklaviertes MQ H2O, 25 l 10x PFU-Puffer, 5 l Vorwärts-Primer: ctggagaatcccggtgccg, 5 l Reverse Primer: acaggatgtatatatctgacacg, 5 l dNTP-Mix, 2,5 l PFU-Enzym. Wir führen in der Regel 60 Reaktionen auf einmal aus, um genügend DNA zu erhalten, um sich zusammenzusetzen.</li>
	<li>Verwenden Sie eine Glühtemperatur von 52 °C für 30 s und eine Verlängerungszeit von 30 s bei Verwendung von PFU-Polymerase. Ansonsten folgen Sie den empfohlenen Bedingungen des Herstellers.</li>
	<li>Sobald PCR fertig ist, verwenden Sie ein PCR-Reinigungskit ihrer Wahl, um das PCR-Produkt zu reinigen.</li>
</ol>5. Montage des Histon-Oktobeers
<ol><li>Lösen Sie Aliquots der Histonproteinpellets H2A, H2B, H3 und H4 auf, so dass es einen separaten Vorrat an jedem Histonprotein in GuHCl Buffer mit einem Gesamtvolumen von 100 l gibt.</li>
	<li>Berechnen Sie die Konzentration jedes Histonproteins, indem Sie die A280-Absorption messen.</li>
	<li>Wenn die Absorption für jedes Protein größer als 1 ist, verdünnen Sie mit GuHCl-Puffer, um eine genauere Konzentration zu erhalten.</li>
	<li>Kombinieren Sie H2A- und H2B-Proteine in einem 1:1-Molarenverhältnis und verdünnen Sie sie auf eine Gesamtproteinkonzentration von 4 g/l. Wiederholen Sie dies für H3 und H4.</li>
	<li>Dialyse sequenziell bei 4 °C gegen 2 M TE Puffer über Nacht, 1 M TE Puffer für 2 h und 0,5 M TE Puffer für 5 h. HINWEIS: Der zweite und dritte Schritt der Dialyse bewirkt, dass instabile Konformationen des Proteins ausfallen. Es wird erwartet, dass es an diesen Stufen starke Niederschläge gibt.</li>
	<li>Ausscheide durch Zentrifugation bei 16.800 x g bei 4 °C entfernen.</li>
	<li>Berechnen Sie erneut die Konzentration von Histondimermen (H2A/H2B-Gemisch) und Tetrameren (H3/H4-Gemisch), die die A280-Absorption messen.</li>
	<li>Mischen Sie Dimere und Tetramere in einem 1:1-Molarenverhältnis und stellen Sie NaCl durch Zugabe von festem NaCl auf 2 M ein.</li>
	<li>Histon-Oktomater kann bei 4 °C gelagert werden und ist stabiler als Dimere und Tetramere. Niemals Histone-Okamer einfrieren, da dies zu Einer Demontage führen kann.</li>
	<li>Wenn Sie sich mit acetylierten Histonen zusammensetzen, ersetzen Sie einfach das Wildtyp-Protein durch das acetylierte Protein im Verfahren.</li>
</ol>6. Nukleosom-Montage
<ol><li>Verwenden Sie 100x TE-Puffer und soliden NaCl, um 601 DNA auf 2M TE-Puffer einzustellen. Fügen Sie die 601 DNA in 2M TE Puffer zu Histon-Okamer in einem Molaren-Verhältnis von 0,85:1 bis 0,90:1 hinzu. Ein niedrigeres Verhältnis von DNA kann hinzugefügt werden, wenn freie DNA in der Gelverschiebungsanalyse vorhanden ist.</li>
	<li>Das DNA-Histon-Gemisch einen Dialysebeutel übertragen und in ca. 200 ml 2M TE-Puffer (oder mehr bei der Montage mehrerer Proben) platzieren und bei 4 °C sehr sanft umrühren.</li>
	<li>Stellen Sie eine peristaltische Pumpe ein, um langsam in keinen SalzTE-Puffer zu tropfen. Wenn sich das Volumen ungefähr verdoppelt hat, gießen Sie die Hälfte des Volumens aus. Tun Sie dies mindestens 4 Mal insgesamt. Bei einer Pumpe kann dies je nach Startvolumen 4-8 h dauern. Nukleosomen bilden sich, wenn die Salzkonzentration auf 150 mM reduziert wird (gemessen am Salzgehaltsmesser).</li>
	<li>Nachdem die Salzkonzentration auf 150 mM reduziert wurde, dialysieren Sie gegen einen 20 mM TE Puffer über Nacht.</li>
	<li>Ausscheidungen durch Zentrifugation entfernen und die Konzentration der Nukleosomen miteinem Plattenleser messen.</li>
	<li>Fügen Sie His-TEV Protease (TEV: Nukleosome 1:30, w:w ) und inkubieren über Nacht bei 4 °C, um alle Histidin-Tags zu entfernen. Entfernen Sie die Histidin-Tag-Verunreinigungen aus der Nukleosomlösung durch Ni-NTA-Harz nach unten ziehen.</li>
	<li>Um das Nukleosom zu positionieren und die Probe zu homogenisieren, bei 60 °C für 1 h inkubieren. HINWEIS: Für acetylierte Standorte, die besonders instabil sind, ist dieser Schritt möglicherweise nicht ratsam.</li>
	<li>Nukleosomen kurzfristig (einige Wochen) bei 4 °C lagern.</li>
	<li>Zur Langzeitlagerung Nukleosomen gegen Speicherpuffer dialysieren und bei -80 °C lagern.</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

Es gibt keine konkurrierenden finanziellen Interessen, die von einem der Autoren zu erklären sind.

Es ist wichtig, dieses Protokoll während eines Experiments bis ins kleinste Detail zu befolgen. Nukleosomen sind nicht sehr stabil und viel Versuch und Irrtum ist in die Bestimmung dieses Protokolls gegangen. Es ist der Schlüssel, um Ausscheidungen bei jedem Schritt (oder wann immer beobachtet) zu entfernen, da Partikel leicht die Montageprozesse stören können. Halten Sie seine Tonproben immer auf Eis. Werden Nukleosomen zu lange bei 4 °C gelagert, können sie sich spontan zerlegen. Achten Sie darauf, alle Proben vo...

Wir haben PylRS und tRNAPyl verwendet, um rekonstituierte Mononukleosomen mit standortspezifischen acetylierten Histonen zu synthetisieren und zusammenzusetzen. PylRS hat sich als genetisches Codeerweiterungstool zur Herstellung von Proteinen mit posttranslationalen Modifikationen (PTMs) als unschätzbar erwiesen und wurde genetisch weiterentwickelt, um etwa 200 verschiedene ncAAs zu integrieren. PylRS enthält an einem Bernstein-Stop-Codon, wodurch die Konkurrenz von anderen Aminosäuren während der Übersetzung entfernt wird. PylRS wurde zuerst in methanogenen Archaeen entdeckt und wird seitdem in der chemischen Biologie verwendet, um neuartige reaktive chemische Gruppen in Proteine1,2zu integrieren.
MmAcKRS1 wurde aus Methanosarcina mazei PylRS entwickelt und häufig in unserem Labor für die Synthese von acetylierten Proteinen3,4,5,6verwendet. MmAcKRS1 liefert AcK an einer Bernsteinmutationsstelle in der mRNA der Wahl während der Übersetzung in Escherichia coli. Diese Technik wurde bisher verwendet, um AcK an K4, K9, K14, K18, K23, K27, K36, K56, K64 und K79 Histon H3 Lysin-Sites zu integrieren, um die Aktivität von Sirtuin 1, 2, 6 und 7 auf acetylierten Mononukleosomen4,5,6zu untersuchen. Hier beschreiben wir diese Methode, um acetylierte Histone auszudrücken und acetylierte Nukleosomen zu rekonstruieren.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.5 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>1 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>100x TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>2 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>20 mM TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>6 M GuHCl</td>
			<td></td>
			<td></td>
			<td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>Acetyllysine</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Column Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisherbrand&#160;Variable-Flow Chemical Transfer Pump</td>
			<td>Fischer Scientific</td>
			<td>15-077-67</td>
			<td></td>
		</tr>
		<tr>
			<td>His-TEV protease</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Histone Lysis Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td>
		</tr>
		<tr>
			<td>Ni-NTA Resin</td>
			<td></td>
			<td></td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td>
		</tr>
		<tr>
			<td>PCR Clean-Up Kit</td>
			<td>Epoch Life Sicences</td>
			<td>2360050</td>
			<td></td>
		</tr>
		<tr>
			<td>Pellet Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>petDUET-His-SUMO-TEV-H4</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2A</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2B</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pEVOL-AckRS</td>
			<td>Addgene</td>
			<td>137976</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-3z/601</td>
			<td>Addgene</td>
			<td>26656</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

Acetylatierte Histonproteine können leicht in Escherichia coli exprimiert werden, die eine Mutante, Nε-Acetyl-Lysin (AcK)-spezifische Methanosarcina mazi pyrrolysinttRNA-Synthetase (MmAcKRS1) und ihre kognade tRNA (tRNAPyl) zur Zusammenstellung rekonstituierter Mononukleosomen mit MmAcKRS1 und tRNAPyl liefern AcK an einer Bernsteinmutationsstelle in der mRNA der Wahl während der Translation in Escherichia coli. Diese Technik wurde ausgiebig verwendet, um AcK an H3-Lysin-Standorten zu integrieren. Pyrrolysyl-tRNA-Synthetase (PylRS) kann auch leicht entwickelt werden, um andere nichtkanonische Aminosäuren (ncAAs) für die standortspezifische Proteinmodifikation oder -funktionalisierung zu integrieren. Hier beschreiben wir eine Methode, AcK mit dem MmAcKRS1-System in Histon H3 zu integrieren und acetylierte H3-Proteine in rekonstituierte Mononukleosomen zu integrieren. Acetylierte rekonstituierte Mononukleosomen können in biochemischen und verbindlichen Assays, Strukturbestimmung und mehr verwendet werden. Die Beschaffung modifizierter Mononukleosomen ist entscheidend für die Entwicklung von Experimenten im Zusammenhang mit der Entdeckung neuer Wechselwirkungen und dem Verständnis der Epigenetik.

Dimere, Tetramere und Okmamer können mit einem 12% SDS PAGE Gel bewertet werden (Abbildung 1 und Abbildung 2). Hier können Sie sehen, dass einige der acetylierten Tetramere eine geringere Ausbeute haben als andere (Abbildung 1). In der Tat, je näher an der Kernregion, desto niedriger der Ertrag beobachtet. Dies ist höchstwahrscheinlich auf die Acetylierung zurückzuführen, die die Zusammenstellu...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Hier präsentieren wir eine Methode, um acetylierte Histonproteine mittels genetischer Codeerweiterung auszudrücken und rekonstituierte Nukleosomen in vitro zusammenzusetzen.

Ortsspezifische Lysin-Acetylierung von Histonen zur Nukleosomen-Rekonstitution mit genetischer Codeerweiterung bei Escherichia coli

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K Aufrufe.  Texas A&M University. Hier präsentieren wir eine Methode, um acetylierte Histonproteine mittels genetischer Codeerweiterung auszudrücken und rekonstituierte Nukleosomen in vitro zusammenzusetzen.

Serie: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique applications for OMV where traditional nanoparticles are proving too difficult to synthesize. To date, all Gram-negative bacteria have been shown to produce OMV demonstrating packaging of a variety of cargo that includes small molecules, peptides, proteins and genetic material. Based on their diverse cargo, OMV are implicated in many biological processes ranging from cell-cell communication to gene transfer and delivery of virulence factors depending upon which bacteria are producing the OMV. Only recently have bacterial OMV become accessible for use across a wide range of applications through the development of techniques to control and direct packaging of recombinant proteins into OMV. This protocol describes a method for the production, purification, and use of enzyme packaged OMV providing for improved overall production of recombinant enzyme, increased vesiculation, and enhanced enzyme stability. Successful utilization of this protocol will result in the creation of a bacterial strain that simultaneously produces a recombinant protein and directs it for OMV encapsulation through creating a synthetic linkage between the recombinant protein and an outer membrane anchor protein. This protocol also details methods for isolating OMV from bacterial cultures as well as proper handling techniques and things to consider when adapting this protocol for use for other unique applications such as: pharmaceutical drug delivery, medical diagnostics, and environmental remediation.

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

A protocol for the production, purification, and use of enzyme packaged outer membrane vesicles (OMV) providing for enhanced enzyme stability for implementation across diverse applications is presented.

Regie Protein Verpackung innerhalb der äußeren Membran von Vesikeln<em&gt; Escherichia coli</em&gt;: Entwurf, Herstellung und Reinigung

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique ...

Forschung

Biochemie

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many of these conditions cause protein unfolding in the cell and have detrimental impact on the survival of the organism. A group of unrelated, stress-specific molecular chaperones have been shown to play essential roles in the survival of these stress conditions. While fully folded and chaperone-inactive before stress, these proteins rapidly unfold and become chaperone-active under specific stress conditions. Once activated, these conditionally disordered chaperones bind to a large number of different aggregation-prone proteins, prevent their aggregation and either directly or indirectly facilitate protein refolding upon return to non-stress conditions. The primary approach for gaining a more detailed understanding about the mechanism of their activation and client recognition involves the purification and subsequent characterization of these proteins using in vitro chaperone assays. Follow-up in vivo stress assays are absolutely essential to independently confirm the obtained in vitro results.
This protocol describes in vitro and in vivo methods to characterize the chaperone activity of E. coli HdeB, an acid-activated chaperone. Light scattering measurements were used as a convenient read-out for HdeB&#39;s capacity to prevent acid-induced aggregation of an established model client protein, MDH, in vitro. Analytical ultracentrifugation experiments were applied to reveal complex formation between HdeB and its client protein LDH, to shed light into the fate of client proteins upon their return to non-stress conditions. Enzymatic activity assays of the client proteins were conducted to monitor the effects of HdeB on pH-induced client inactivation and reactivation. Finally, survival studies were used to monitor the influence of HdeB&#39;s chaperone function in vivo.

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

This study describes biophysical, biochemical and molecular techniques to characterize the chaperone activity of Escherichia coli HdeB under acidic pH conditions. These methods have been successfully applied for other acid-protective chaperones such as HdeA and can be modified to work for other chaperones and stress conditions.

Nachweis des pH-abhängige Aktivität von<em&gt; Escherichia coli</em&gt; Chaperone HdeB<em&gt; In Vitro</em&gt; und<em&gt; In Vivo</em

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many ...

Efficient and Site-specific Antibody Labeling by Strain-promoted Azide-alkyne Cycloaddition

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is protein conjugation by genetically introducing an unnatural amino acid containing a bioorthogonal functional group. This report describes a detailed protocol for site-specific antibody conjugation. The protocol includes experimental details for the genetic incorporation of an azide-containing amino acid, and the conjugation reaction by strain-promoted azide-alkyne cycloaddition (SPAAC). This strain-promoted reaction proceeds by simple mixing of the reacting molecules at physiological pH and temperature, and does not require additional reagents such as copper(I) ions and copper-chelating ligands. Therefore, this method would be useful for general protein conjugation and development of antibody drug conjugates (ADCs).

Here, we present a protocol to site-specifically introduce chemical probes into an antibody fragment by genetically incorporating an azide-containing amino acid, and subsequently coupling the azide with a chemical probe by strain-promoted azide-alkyne cycloaddition (SPAAC).

Effiziente und ortsspezifische Antikörpermarkierung von Dehnungs gefördert Azid-Alkin-Cyclo

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is ...

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

Rekonstitution von Nukleosomen mit differentiell isotopenmarkierten Schwester Histone

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. The relative levels of different tRNAs, and the ratio of aminoacylated tRNA to total tRNA, known as the charging level, are important factors in determining the accuracy and speed of translation. Therefore, the abundance and charging levels of tRNAs are important variables to measure when studying protein synthesis, for example under various stress conditions. Here, we describe a method for harvesting tRNA and directly measuring both the relative abundance and the absolute charging level of specific tRNA species in Escherichia coli. The tRNA is harvested in such a way that the labile bond between the tRNA and its amino acid is preserved. The RNA is then subjected to gel electrophoresis and Northern blotting, which results in separation of the charged and uncharged tRNAs. The levels of specific tRNAs in different samples can be compared due to the addition of spike-in cells for normalization. Prior to RNA purification, we add 5% of E. coli cells that overproduce the rare tRNAselC to each sample. The amount of the tRNA species of interest in a sample is then normalized to the amount of tRNAselC in the same sample. Addition of spike-in cells prior to RNA purification has the advantage over addition of purified spike-in RNAs that it also accounts for any differences in cell lysis efficiency between samples.

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Here we present a method for directly measuring transfer RNA charging levels from purified Escherichia coli RNA as well as a way to compare relative levels of transfer RNA, or any other short RNA, across different samples based on the addition of spike-in cells expressing a reference gene.

Quantifizierung von der Fülle und Ebenen des Transfer-RNAs in Escherichia coli aufladen

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. ...

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts of recombinant RNAs are limited. Here, we describe a protocol to produce large amounts of recombinant RNA in Escherichia coli based on co-expression of a chimeric molecule that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. Viroids are relatively small, non-coding, highly base-paired circular RNAs that are infectious to higher plants. The host plant tRNA ligase is an enzyme recruited by viroids that belong to the family Avsunviroidae, such as Eggplant latent viroid (ELVd), to mediate RNA circularization during viroid replication. Although ELVd does not replicate in E. coli, an ELVd precursor is efficiently transcribed by the E. coli RNA polymerase and processed by the embedded hammerhead ribozymes in bacterial cells, and the resulting monomers are circularized by the co-expressed tRNA ligase reaching a remarkable concentration. The insertion of an RNA of interest into the ELVd scaffold enables the production of tens of milligrams of the recombinant RNA per liter of bacterial culture in regular laboratory conditions. A main fraction of the RNA product is circular, a feature that facilitates the purification of the recombinant RNA to virtual homogeneity. In this protocol, a complementary DNA (cDNA) corresponding to the RNA of interest is inserted in a particular position of the ELVd cDNA in an expression plasmid that is used, along the plasmid to co-express eggplant tRNA ligase, to transform E. coli. Co-expression of both molecules under the control of strong constitutive promoters leads to production of large amounts of the recombinant RNA. The recombinant RNA can be extracted from the bacterial cells and separated from the bulk of bacterial RNAs taking advantage of its circularity.

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

Here, we present a protocol to produce large amounts of recombinant RNA in Escherichia coli by co-expressing a chimeric RNA that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. The main product is a circular molecule that facilitates purification to homogeneity.

Großtechnische Produktion von rekombinanten RNAs auf einem kreisförmigen Gerüst mit einem Viroid-abgeleitete System bei Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts ...

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic acid (sRNA) molecules and target messenger RNAs (mRNAs). In addition, site-directed mutagenesis is used to map specific protein binding sites to RNA. A 2-step and 3-step PCR based introduction of mutations is described. The approach is relevant to all protein-RNA and RNA-RNA interaction studies. In short, the technique relies on designing primers with the desired mutation(s), and through 2 or 3 steps of PCR synthesizing a PCR product with the mutation. The PCR product is then used for cloning. Here, we describe how to perform site-directed mutagenesis with both the 2- and 3-step approach to introduce mutations to the sRNA, McaS, and the mRNA, csgD, to investigate RNA-RNA and RNA-protein interactions. We apply this technique to investigate RNA interactions; however, the technique is applicable to all mutagenesis studies (e.g., DNA-protein interactions, amino-acid substitution/deletion/addition). It is possible to introduce any kind of mutation except for non-natural bases but the technique is only applicable if a PCR product can be used for downstream application (e.g., cloning and template for further PCR).

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in deoxyribonucleic acid (DNA). This protocol describes how to do site-directed mutagenesis with a 2-step and 3-step polymerase chain reaction (PCR) based approach, which is applicable to any DNA fragment of interest.

Site-verwiesene Mutagenese für In Vitro und In Vivo Experimente veranschaulicht mit RNA-Interaktionen in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic ...

In Vitro Ubiquitination and Deubiquitination Assays of Nucleosomal Histones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination of chromatin function and DNA-associated processes. This modification involves a sequential action of several enzymes including E1 ubiquitin-activating, E2 ubiquitin-conjugating and E3 ubiquitin-ligase and is reversed by deubiquitinases (DUBs). Ubiquitination induces degradation of proteins or alteration of protein function including modulation of enzymatic activity, protein-protein interaction and subcellular localization. A critical step in demonstrating protein ubiquitination or deubiquitination is to perform in vitro reactions with purified components. Effective ubiquitination and deubiquitination reactions could be greatly impacted by the different components used, enzyme co-factors, buffer conditions, and the nature of the substrate.&#160; Here, we provide step-by-step protocols for conducting ubiquitination and deubiquitination reactions. We illustrate these reactions using minimal components of the mouse Polycomb Repressive Complex 1 (PRC1), BMI1, and RING1B, an E3 ubiquitin ligase that monoubiquitinates histone H2A on lysine 119. Deubiquitination of nucleosomal H2A is performed using a minimal Polycomb Repressive Deubiquitinase (PR-DUB) complex formed by the human deubiquitinase BAP1 and the DEUBiquitinase ADaptor (DEUBAD) domain of its co-factor ASXL2. These ubiquitination/deubiquitination assays can be conducted in the context of either recombinant nucleosomes reconstituted with bacteria-purified proteins or native nucleosomes purified from mammalian cells. We highlight the intricacies that can have a significant impact on these reactions and we propose that the general principles of these protocols can be swiftly adapted to other E3 ubiquitin ligases and deubiquitinases.

Ubiquitination is a post-translational modification that plays important roles in cellular processes and is tightly coordinated by deubiquitination. Defects in both reactions underlie human pathologies. We provide protocols for conducting ubiquitination and deubiquitination reaction in vitro using purified components.

In Vitro Ubiquitination und Deubiquitination Assays von Nucleleosomalhistones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination ...

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein aggregation. The accumulation of protein aggregates in bacterial cells can lead to significant alterations in the cellular phenotypic behavior, including a reduction in growth rates, stress resistance, and virulence. Several experimental procedures exist for the examination of these stressor-mediated phenotypes. This paper describes an optimized assay for the extraction and visualization of aggregated and soluble proteins from different Escherichia coli strains after treatment with a silver-ruthenium-containing antimicrobial. This compound is known to generate reactive oxygen species and causes widespread protein aggregation. 
The method combines a centrifugation-based separation of protein aggregates and soluble proteins from treated and untreated cells with subsequent separation and visualization by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie staining. This approach is simple, fast, and allows a qualitative comparison of protein aggregate formation in different E. coli strains. The methodology has a wide range of applications, including the possibility to investigate the impact of other proteotoxic antimicrobials on in vivo protein aggregation in a wide range of bacteria. Moreover, the protocol can be used to identify genes that contribute to increased resistance to proteotoxic substances. Gel bands can be used for the subsequent identification of proteins that are particularly prone to aggregation.

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

This protocol describes the extraction and visualization of aggregated and soluble proteins from Escherichia coli after treatment with a proteotoxic antimicrobial. Following this procedure allows a qualitative comparison of protein aggregate formation in vivo in different bacterial strains and/or between treatments.

Extraktion und Visualisierung von Proteinaggregaten nach Behandlung von Escherichia coli mit einem proteotoxischen Stressor

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

Pulldown-Assay gekoppelt mit Co-Expression in Bakterienzellen als zeiteffizientes Werkzeug zum Testen anspruchsvoller Protein-Protein-Interaktionen

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...