We would like to thank Dr. Wesley Wang for laying the groundwork for this protocol and his valuable mentorship.&#160;This work was partially supported by National Institutes of Health (Grants R01GM127575 and R01GM121584) and Welch Foundation (Grant A-1715).

1.&#160;Plasmid construction
<ol>
	<li>Begin by deciding which histone protein will be acetylated and at which lysine site. Mutate the site to the amber stop codon (TAG) using site directed mutagenesis. 
	&#8203;NOTE: There are four previously designed plasmids utilized for expression of histone proteins. All four histone proteins were cloned into the pETDuet-1 vector with an N-terminal histidine tag. Histone H4 also includes a SUMO tag, the origin of replication colE1 with a copy number of approximately 40, ampicillin resistant, and a T7 promoter.
	<ol>
		<li>Design forward and reverse primers that contain a TAG mutation at the desired site (replacing an existing lysine codon with the amber stop codon) in one of the four histone protein plasmids.</li>
		<li>Use whole-plasmid PCR to amplify the TAG containing plasmid. Determine an appropriate annealing temperature for the primers. In general, the melting temperature (Tm) of the primers minus 5 &#176;C will be sufficient. If difficulty is experienced obtaining a PCR product, a temperature gradient around Tm - 5 &#176;C can be used to optimize the annealing temperature for amplification. 
		NOTE: In this experiment an in-house expressed PFU polymerase was used for 30 cycles with the following conditions: 94 &#176;C for 30 s (denaturation), annealing temperature for 30 s, and 72 &#176;C for 6 min (or 1 min per kilobase-pairs). For more details on this type of PCR method see Liu and Naismith7.</li>
		<li>Clean up the PCR product with a PCR clean up kit by following the manufacturer&#39;s protocol. Analyze the PCR product by agarose gel electrophoresis and subsequent ethidium bromide staining.</li>
		<li>Ligate the plasmid by incubating with T4 ligase overnight at 16 &#176;C.</li>
	</ol>
	</li>
	<li>First transform the TAG containing plasmid (AmpR) into chemically competent Escherichia coli. Pick a minimum of 4 colonies from the transformation and purify the plasmid. Make cell stocks of each with glycerol using standard methods and store at -80 &#176;C. Send for sequencing to confirm the desired TAG mutation.</li>
	<li>Once the sequence is confirmed, co-transform the TAG-containing plasmid (AmpR) with pEVOL-AckRS (ChlR) into chemically competent CobB (the only histone lysine deacetylase known in E. coli.) deletion BL21 cells using the heat shock method. pEVOL is a plasmid with a mid-copy-number to low-copy-number p15A origin. 
	NOTE: The pEVOL series of plasmids were constructed based on previous studies that showed an increased expression of the orthogonal aaRS/tRNATyr pair was effective in decreasing protein truncation and in increasing overall yields of mutant proteins8. If CobB deletion cells are not accessible, proceed with chemically competent BL21 cells. CobB is a Sirtuin-like histone lysine deacetylase and Nicotinamide can be added at a 5 mM final concentration during histone protein expression to inhibit CobB as an alternative approach9.</li>
	<li>Make a cell stock and store at -80 &#176;C.</li>
</ol>
2. Acetylated histone protein expression
<ol>
	<li>Prepare 1 L of autoclaved 2YT media (or volume of choice) in a culture flask.</li>
	<li>Inoculate 20 mL of 2YT media containing the appropriate antibiotics with the co-transformed cell stock that has the TAG-containing plasmid (AmpR) and pEVOL-AckRS (ChlR) and grow at 37 &#176;C to OD = 0.6 (4-6 h).</li>
	<li>Add the appropriate antibiotics to the 1 L of autoclaved 2YT media and inoculate with the 20 mL starter culture. Grow at 37 &#176;C to OD = 0.6-0.8 (2-3 h).</li>
	<li>Add inducing agents and acetyllysine (AcK) to the final concentrations of IPTG 1 mM, 0.2% arabinose, and AcK 5 mM.</li>
	<li>Grow the culture at 37 &#176;C for 6-8 h.</li>
	<li>Pellet cells at 2,700 x g for 15 min.</li>
	<li>Store the cell pellet at -80 &#176;C overnight.</li>
	<li>From this step onwards keep the sample on ice all times. Dissolve the cell pellet in 50 mL of histone lysis buffer per 1 L of culture.</li>
	<li>Sonicate according to the following cycle: 1 s on, 1 s off, total on time: 3 min at 60% amplitude.</li>
	<li>Pellet inclusion bodies at 41,600 x g for 45 min.</li>
	<li>Discard the supernatant and resuspend inclusion bodies in 30 mL of histone lysis buffer. Pellet inclusion bodes at 41,600 x g for 30 min.</li>
	<li>Discard the supernatant and resuspend inclusion bodies in 30 mL of pellet wash buffer. Pellet inclusion bodies at 41,600 x g for 30 min.</li>
	<li>Discard the supernatant and dissolve inclusion bodies in 25 mL of 6 M Guanidine Hydrochloride (GuHCl) buffer. Incubate with agitation at 37 &#176;C for 1 h. 
	NOTE: If needed, inclusion bodies can be incubated with agitation overnight at 4 &#176;C.</li>
	<li>Pellet inclusion bodes at 41,600 x g for 45 min. Incubate the supernatant with 1 mL of Ni-NTA resin equilibrated with 6 M GuHCl buffer for 2 h.</li>
	<li>Proceed with Ni-NTA purification under denatured conditions. Wash the column with 3 column volumes of column wash buffer. Elute acetylated histone protein with 10 mL of elution buffer. 
	NOTE: Attempting to concentrate the protein here is an option but acetylated histones are very unpredictable and can easily precipitate. It is not recommended to concentrate past 2 mL in total volume.</li>
	<li>Extensively dialyze the acetylated histone protein against 5% acetic acid buffer to remove salts. Dialyze for 3 h at a time at&#160;4 &#176;C, exchanging for fresh buffer a minimum of 6 times. 
	NOTE: For improved protein purity, there is an option to dialyze against pure water. However, this causes significant precipitation and reduction in yield which may be undesirable for low-yielding acetylated histone proteins.</li>
	<li>Aliquot and lyophilize protein, and store indefinitely at -80 &#176;C. Wild type histone proteins generally yield 10-50 mg/L whereas acetylated histone proteins yield less than 10 mg/L depending on the specific lysine site. For example, H3K79Ac averages 5 mg/L.</li>
</ol>
3. Wild-type histone protein expression
<ol>
	<li>To assemble full nucleosomes, express all 4 histone proteins. When expressing and purifying wild type histones the protocol is the same as the acetylated histones except the following:
	<ol>
		<li>Do not perform co-transformation. Do not use pEVOL-AcKRS for wild type histone expression. Adjust antibiotics accordingly.</li>
		<li>Do not use a CobB deletion cell line or add Nicotinamide, AcK, or arabinose during induction of cellular expression.</li>
	</ol>
	</li>
</ol>
4. Preparation of 601 DNA
NOTE: A previously designed optimized DNA sequence to direct nucleosome positioning is assembled with histone octamers to produce mononucleosome with high efficiency. This sequence is referred to as 601 DNA or the Widom sequence. This sequence has become the standard DNA sequence for in vitro studies of nucleosomes from chromatin remodeling assays to single molecule measurements10.
<ol>
	<li>To prepare significant quantities of 601 DNA for nucleosome assembly, transform pGEM-3z/601 into Top 10 cells and grow 10 mL of culture for plasmid amplification and extraction. Use a plasmid extraction kit and follow manufacturer&#39;s recommendation.</li>
	<li>Use an in-house expressed PFU polymerase (more efficient) for this amplification protocol. Set up a PCR reaction: For 250 &#181;L reaction, use 207.5 &#181;L autoclaved MQ H2O, 25 &#181;L 10x PFU Buffer, 5 &#181;L Forward Primer: ctggagaatcccggtgccg, 5 &#181;L Reverse Primer: acaggatgtatatatctgacacg, 5 &#181;L dNTP mix, 2.5 &#181;L PFU enzyme.&#160;We typically run 60 reactions at once to get enough DNA to assemble.</li>
	<li>Use an annealing temperature of 52 &#176;C for 30 s and an extension time of 30 s if using PFU polymerase. Otherwise follow the manufacturers recommended conditions.</li>
	<li>Once PCR is done, use a PCR clean up kit of choice to purify the PCR product.</li>
</ol>
5. Assembly of histone octamer
<ol>
	<li>Dissolve aliquots of histone protein pellets H2A, H2B, H3, and H4 so that there is a separate stock of each histone protein in GuHCl Buffer with a total volume of 100 &#181;L.</li>
	<li>Calculate the concentration of each histone protein by measuring the A280 absorbance.</li>
	<li>If absorbance is greater than 1 for any protein, dilute with GuHCl buffer to get a more accurate concentration.</li>
	<li>Combine H2A and H2B proteins in a 1:1 molar ratio and dilute to a total protein concentration of 4 &#181;g/&#181;L. Repeat for H3 and H4.</li>
	<li>Dialyze sequentially at 4 &#176;C against 2 M TE buffer overnight, 1 M TE buffer for 2 h and 0.5 M TE buffer for 5 h. 
	NOTE: The second and third steps of dialysis causes unstable conformations of protein to precipitate out. It is expected to see heavy precipitation at these steps.</li>
	<li>Remove precipitates by centrifugation at 16,800 x g at 4 &#176;C.</li>
	<li>Again, calculate the concentration of histone dimers (H2A/H2B mixture) and tetramers (H3/H4 mixture) measuring the A280 absorbance.</li>
	<li>Mix dimers and tetramers in a 1:1 molar ratio and adjust NaCl to 2 M by the addition of solid NaCl.</li>
	<li>Histone octamer can be stored at 4 &#176;C and is more stable than dimers and tetramers. Never freeze histone octamer as this can cause disassembly.</li>
	<li>If assembling with acetylated histones, simply replace the wild type protein with the acetylated protein in the procedure.</li>
</ol>
6. Nucleosome assembly
<ol>
	<li>Use 100x TE buffer and solid NaCl to adjust 601 DNA to 2M TE buffer. Add the 601 DNA in 2M TE buffer to histone octamer in a molar ratio of 0.85:1 to 0.90:1. A lower ratio of DNA may be added if free DNA is present in the gel shift analysis.</li>
	<li>Transfer the DNA-histone mixture a dialysis bag and place in about 200 mL of 2M TE buffer (or more if assembling multiple samples) and very gently stir at 4 &#176;C.</li>
	<li>Set a peristaltic pump to purge to slowly drip in no salt TE buffer. When the volume has roughly doubled, pour out half the volume. Do this at least 4 times in total. With a pump this can take 4-8 h depending on the starting volume. Nucleosomes form when the salt concentration is reduced to 150 mM (measured by salinity meter).</li>
	<li>After the salt concentration is reduced to 150 mM, dialyze against a 20 mM TE buffer overnight.</li>
	<li>Remove precipitates by centrifugation and measure the concentration of the nucleosomes by A260 reading using a plate reader.</li>
	<li>Add His-TEV protease (TEV: nucleosome 1:30, w:w ) and incubate&#160;overnight at 4 &#176;C to remove all histidine tags. Remove the histidine tag impurities from the nucleosome solution by Ni-NTA resin pull down.</li>
	<li>To position the nucleosome and homogenize the sample, incubate at 60 &#176;C for 1 h. 
	NOTE: For acetylated sites that are particularly unstable, this step may not be advisable.</li>
	<li>Store nucleosomes for short term (a few weeks) at 4 &#176;C.</li>
	<li>For long-term storage, dialyze nucleosomes against storage buffer and store at -80 &#176;C.</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

There are no competing financial interests to declare by any of the authors.

It is essential to follow this protocol in every detail during an experiment. Nucleosomes are not very stable and much trial and error has gone into determining this protocol. It is key to remove precipitates at every step (or whenever observed) because particulates can easily interfere with the assembling processes. Always keep histone samples on ice. If nucleosomes are stored at 4 &#176;C for too long, they can spontaneously disassemble. Be sure to check any samples by Native PAGE if stored at 4 &#176;C for more than 2...

We have utilized PylRS and tRNAPyl to synthesize and assemble reconstituted mononucleosomes with site specific acetylated histones. PylRS has proven invaluable as a genetic code expansion tool to produce proteins with post translational modifications (PTMs) and has been genetically evolved to incorporate about 200 different ncAAs. PylRS incorporates at an amber stop codon, removing competition from other amino acids during translation. PylRS was first discovered in methanogenic archaea, and has since been utilized in chemical biology to incorporate novel reactive chemical groups into proteins1,2.
MmAcKRS1 was evolved from Methanosarcina mazei PylRS and frequently used in our laboratory for the synthesis of acetylated proteins3,4,5,6. MmAcKRS1 delivers AcK at an amber mutation site in the mRNA of choice during translation in Escherichia coli. This technique has been previously used to incorporate AcK at K4, K9, K14, K18, K23, K27, K36, K56, K64, and K79 histone H3 lysine sites to study the activity of Sirtuin 1, 2, 6, and 7 on acetylated mononucleosomes4,5,6. Here we detail this method to express acetylated histones and reconstitute acetylated nucleosomes.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.5 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>1 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>100x TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>2 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>20 mM TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>6 M GuHCl</td>
			<td></td>
			<td></td>
			<td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>Acetyllysine</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Column Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisherbrand&#160;Variable-Flow Chemical Transfer Pump</td>
			<td>Fischer Scientific</td>
			<td>15-077-67</td>
			<td></td>
		</tr>
		<tr>
			<td>His-TEV protease</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Histone Lysis Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td>
		</tr>
		<tr>
			<td>Ni-NTA Resin</td>
			<td></td>
			<td></td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td>
		</tr>
		<tr>
			<td>PCR Clean-Up Kit</td>
			<td>Epoch Life Sicences</td>
			<td>2360050</td>
			<td></td>
		</tr>
		<tr>
			<td>Pellet Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>petDUET-His-SUMO-TEV-H4</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2A</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2B</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pEVOL-AckRS</td>
			<td>Addgene</td>
			<td>137976</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-3z/601</td>
			<td>Addgene</td>
			<td>26656</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi pyrrolysine tRNA-synthetase (MmAcKRS1) and its cognate tRNA (tRNAPyl) to assemble reconstituted mononucleosomes with site specific acetylated histones. MmAcKRS1 and tRNAPyl deliver AcK at an amber mutation site in the mRNA of choice during translation in Escherichia coli. This technique has been used extensively to incorporate AcK at H3 lysine sites. Pyrrolysyl-tRNA synthetase (PylRS) can also be easily evolved to incorporate other noncanonical amino acids (ncAAs) for site specific protein modification or functionalization. Here we detail a method to incorporate AcK using the MmAcKRS1 system into histone H3 and integrate acetylated H3 proteins into reconstituted mononucleosomes. Acetylated reconstituted mononucleosomes can be used in biochemical and binding assays, structure determination, and more. Obtaining modified mononucleosomes is crucial for designing experiments related to discovering new interactions and understanding epigenetics.

Dimers, tetramers, and octamers can be assessed by running a 12% SDS PAGE gel (Figure 1 and Figure 2). Here you can see that some of the acetylated tetramers have a lower yield than others (Figure 1). In fact, the closer to the core region, the lower the yield observed. This is most likely due to the acetylation interfering with the assembling of the tetramer the closer you get to the core regions. A...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Here we present a method to express acetylated histone proteins using genetic code expansion and assemble reconstituted nucleosomes in vitro.

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K Views.  Texas A&M University. Here we present a method to express acetylated histone proteins using genetic code expansion and assemble reconstituted nucleosomes in vitro.

Video: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique applications for OMV where traditional nanoparticles are proving too difficult to synthesize. To date, all Gram-negative bacteria have been shown to produce OMV demonstrating packaging of a variety of cargo that includes small molecules, peptides, proteins and genetic material. Based on their diverse cargo, OMV are implicated in many biological processes ranging from cell-cell communication to gene transfer and delivery of virulence factors depending upon which bacteria are producing the OMV. Only recently have bacterial OMV become accessible for use across a wide range of applications through the development of techniques to control and direct packaging of recombinant proteins into OMV. This protocol describes a method for the production, purification, and use of enzyme packaged OMV providing for improved overall production of recombinant enzyme, increased vesiculation, and enhanced enzyme stability. Successful utilization of this protocol will result in the creation of a bacterial strain that simultaneously produces a recombinant protein and directs it for OMV encapsulation through creating a synthetic linkage between the recombinant protein and an outer membrane anchor protein. This protocol also details methods for isolating OMV from bacterial cultures as well as proper handling techniques and things to consider when adapting this protocol for use for other unique applications such as: pharmaceutical drug delivery, medical diagnostics, and environmental remediation.

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

A protocol for the production, purification, and use of enzyme packaged outer membrane vesicles (OMV) providing for enhanced enzyme stability for implementation across diverse applications is presented.

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique ...

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many of these conditions cause protein unfolding in the cell and have detrimental impact on the survival of the organism. A group of unrelated, stress-specific molecular chaperones have been shown to play essential roles in the survival of these stress conditions. While fully folded and chaperone-inactive before stress, these proteins rapidly unfold and become chaperone-active under specific stress conditions. Once activated, these conditionally disordered chaperones bind to a large number of different aggregation-prone proteins, prevent their aggregation and either directly or indirectly facilitate protein refolding upon return to non-stress conditions. The primary approach for gaining a more detailed understanding about the mechanism of their activation and client recognition involves the purification and subsequent characterization of these proteins using in vitro chaperone assays. Follow-up in vivo stress assays are absolutely essential to independently confirm the obtained in vitro results.
This protocol describes in vitro and in vivo methods to characterize the chaperone activity of E. coli HdeB, an acid-activated chaperone. Light scattering measurements were used as a convenient read-out for HdeB&#39;s capacity to prevent acid-induced aggregation of an established model client protein, MDH, in vitro. Analytical ultracentrifugation experiments were applied to reveal complex formation between HdeB and its client protein LDH, to shed light into the fate of client proteins upon their return to non-stress conditions. Enzymatic activity assays of the client proteins were conducted to monitor the effects of HdeB on pH-induced client inactivation and reactivation. Finally, survival studies were used to monitor the influence of HdeB&#39;s chaperone function in vivo.

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

This study describes biophysical, biochemical and molecular techniques to characterize the chaperone activity of Escherichia coli HdeB under acidic pH conditions. These methods have been successfully applied for other acid-protective chaperones such as HdeA and can be modified to work for other chaperones and stress conditions.

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many ...

Efficient and Site-specific Antibody Labeling by Strain-promoted Azide-alkyne Cycloaddition

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is protein conjugation by genetically introducing an unnatural amino acid containing a bioorthogonal functional group. This report describes a detailed protocol for site-specific antibody conjugation. The protocol includes experimental details for the genetic incorporation of an azide-containing amino acid, and the conjugation reaction by strain-promoted azide-alkyne cycloaddition (SPAAC). This strain-promoted reaction proceeds by simple mixing of the reacting molecules at physiological pH and temperature, and does not require additional reagents such as copper(I) ions and copper-chelating ligands. Therefore, this method would be useful for general protein conjugation and development of antibody drug conjugates (ADCs).

Here, we present a protocol to site-specifically introduce chemical probes into an antibody fragment by genetically incorporating an azide-containing amino acid, and subsequently coupling the azide with a chemical probe by strain-promoted azide-alkyne cycloaddition (SPAAC).

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is ...

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. The relative levels of different tRNAs, and the ratio of aminoacylated tRNA to total tRNA, known as the charging level, are important factors in determining the accuracy and speed of translation. Therefore, the abundance and charging levels of tRNAs are important variables to measure when studying protein synthesis, for example under various stress conditions. Here, we describe a method for harvesting tRNA and directly measuring both the relative abundance and the absolute charging level of specific tRNA species in Escherichia coli. The tRNA is harvested in such a way that the labile bond between the tRNA and its amino acid is preserved. The RNA is then subjected to gel electrophoresis and Northern blotting, which results in separation of the charged and uncharged tRNAs. The levels of specific tRNAs in different samples can be compared due to the addition of spike-in cells for normalization. Prior to RNA purification, we add 5% of E. coli cells that overproduce the rare tRNAselC to each sample. The amount of the tRNA species of interest in a sample is then normalized to the amount of tRNAselC in the same sample. Addition of spike-in cells prior to RNA purification has the advantage over addition of purified spike-in RNAs that it also accounts for any differences in cell lysis efficiency between samples.

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Here we present a method for directly measuring transfer RNA charging levels from purified Escherichia coli RNA as well as a way to compare relative levels of transfer RNA, or any other short RNA, across different samples based on the addition of spike-in cells expressing a reference gene.

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. ...

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts of recombinant RNAs are limited. Here, we describe a protocol to produce large amounts of recombinant RNA in Escherichia coli based on co-expression of a chimeric molecule that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. Viroids are relatively small, non-coding, highly base-paired circular RNAs that are infectious to higher plants. The host plant tRNA ligase is an enzyme recruited by viroids that belong to the family Avsunviroidae, such as Eggplant latent viroid (ELVd), to mediate RNA circularization during viroid replication. Although ELVd does not replicate in E. coli, an ELVd precursor is efficiently transcribed by the E. coli RNA polymerase and processed by the embedded hammerhead ribozymes in bacterial cells, and the resulting monomers are circularized by the co-expressed tRNA ligase reaching a remarkable concentration. The insertion of an RNA of interest into the ELVd scaffold enables the production of tens of milligrams of the recombinant RNA per liter of bacterial culture in regular laboratory conditions. A main fraction of the RNA product is circular, a feature that facilitates the purification of the recombinant RNA to virtual homogeneity. In this protocol, a complementary DNA (cDNA) corresponding to the RNA of interest is inserted in a particular position of the ELVd cDNA in an expression plasmid that is used, along the plasmid to co-express eggplant tRNA ligase, to transform E. coli. Co-expression of both molecules under the control of strong constitutive promoters leads to production of large amounts of the recombinant RNA. The recombinant RNA can be extracted from the bacterial cells and separated from the bulk of bacterial RNAs taking advantage of its circularity.

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

Here, we present a protocol to produce large amounts of recombinant RNA in Escherichia coli by co-expressing a chimeric RNA that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. The main product is a circular molecule that facilitates purification to homogeneity.

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts ...

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic acid (sRNA) molecules and target messenger RNAs (mRNAs). In addition, site-directed mutagenesis is used to map specific protein binding sites to RNA. A 2-step and 3-step PCR based introduction of mutations is described. The approach is relevant to all protein-RNA and RNA-RNA interaction studies. In short, the technique relies on designing primers with the desired mutation(s), and through 2 or 3 steps of PCR synthesizing a PCR product with the mutation. The PCR product is then used for cloning. Here, we describe how to perform site-directed mutagenesis with both the 2- and 3-step approach to introduce mutations to the sRNA, McaS, and the mRNA, csgD, to investigate RNA-RNA and RNA-protein interactions. We apply this technique to investigate RNA interactions; however, the technique is applicable to all mutagenesis studies (e.g., DNA-protein interactions, amino-acid substitution/deletion/addition). It is possible to introduce any kind of mutation except for non-natural bases but the technique is only applicable if a PCR product can be used for downstream application (e.g., cloning and template for further PCR).

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in deoxyribonucleic acid (DNA). This protocol describes how to do site-directed mutagenesis with a 2-step and 3-step polymerase chain reaction (PCR) based approach, which is applicable to any DNA fragment of interest.

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic ...

In Vitro Ubiquitination and Deubiquitination Assays of Nucleosomal Histones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination of chromatin function and DNA-associated processes. This modification involves a sequential action of several enzymes including E1 ubiquitin-activating, E2 ubiquitin-conjugating and E3 ubiquitin-ligase and is reversed by deubiquitinases (DUBs). Ubiquitination induces degradation of proteins or alteration of protein function including modulation of enzymatic activity, protein-protein interaction and subcellular localization. A critical step in demonstrating protein ubiquitination or deubiquitination is to perform in vitro reactions with purified components. Effective ubiquitination and deubiquitination reactions could be greatly impacted by the different components used, enzyme co-factors, buffer conditions, and the nature of the substrate.&#160; Here, we provide step-by-step protocols for conducting ubiquitination and deubiquitination reactions. We illustrate these reactions using minimal components of the mouse Polycomb Repressive Complex 1 (PRC1), BMI1, and RING1B, an E3 ubiquitin ligase that monoubiquitinates histone H2A on lysine 119. Deubiquitination of nucleosomal H2A is performed using a minimal Polycomb Repressive Deubiquitinase (PR-DUB) complex formed by the human deubiquitinase BAP1 and the DEUBiquitinase ADaptor (DEUBAD) domain of its co-factor ASXL2. These ubiquitination/deubiquitination assays can be conducted in the context of either recombinant nucleosomes reconstituted with bacteria-purified proteins or native nucleosomes purified from mammalian cells. We highlight the intricacies that can have a significant impact on these reactions and we propose that the general principles of these protocols can be swiftly adapted to other E3 ubiquitin ligases and deubiquitinases.

Ubiquitination is a post-translational modification that plays important roles in cellular processes and is tightly coordinated by deubiquitination. Defects in both reactions underlie human pathologies. We provide protocols for conducting ubiquitination and deubiquitination reaction in vitro using purified components.

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination ...

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein aggregation. The accumulation of protein aggregates in bacterial cells can lead to significant alterations in the cellular phenotypic behavior, including a reduction in growth rates, stress resistance, and virulence. Several experimental procedures exist for the examination of these stressor-mediated phenotypes. This paper describes an optimized assay for the extraction and visualization of aggregated and soluble proteins from different Escherichia coli strains after treatment with a silver-ruthenium-containing antimicrobial. This compound is known to generate reactive oxygen species and causes widespread protein aggregation. 
The method combines a centrifugation-based separation of protein aggregates and soluble proteins from treated and untreated cells with subsequent separation and visualization by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie staining. This approach is simple, fast, and allows a qualitative comparison of protein aggregate formation in different E. coli strains. The methodology has a wide range of applications, including the possibility to investigate the impact of other proteotoxic antimicrobials on in vivo protein aggregation in a wide range of bacteria. Moreover, the protocol can be used to identify genes that contribute to increased resistance to proteotoxic substances. Gel bands can be used for the subsequent identification of proteins that are particularly prone to aggregation.

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

This protocol describes the extraction and visualization of aggregated and soluble proteins from Escherichia coli after treatment with a proteotoxic antimicrobial. Following this procedure allows a qualitative comparison of protein aggregate formation in vivo in different bacterial strains and/or between treatments.

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...

Methods Article

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli