Vorremmo ringraziare il Dr. Wesley Wang per aver posto le basi per questo protocollo e il suo prezioso mentoring. Questo lavoro è stato parzialmente supportato da National Institutes of Health (Grants R01GM127575 e R01GM121584) e Welch Foundation (Grant A-1715).

1. Costruzione plasmide
<ol><li>Inizia decidendo quale proteina istonina sarà acetilata e in quale sito di lisina. Mutare il sito nel codone di arresto ambrato (TAG) usando la mutagenesi diretta dal sito. NOTA: Ci sono quattro plasmidi precedentemente progettati utilizzati per l'espressione delle proteine istone. Tutte e quattro le proteine istonate sono state clonate nel vettore pETDuet-1 con un tag di istidina N-terminale. Histone H4 include anche un tag SUMO, l'origine della replicazione colE1 con un numero di copia di circa 40, resistente all'ampicillina e un promotore T7.<ol>
<li>Progettare primer in avanti e inversi che contengono una mutazione TAG nel sito desiderato (sostituendo un codone di lysine esistente con il codone di arresto ambrato) in uno dei quattro plasmidi proteici istoni.</li>
		<li>Utilizzare PCR intero plasmide per amplificare il TAG contenente plasmide. Determinare una temperatura di ricottura appropriata per i primer. In generale, la temperatura di fusione (Tm) dei primer meno 5 °C sarà sufficiente. In caso di difficoltà nell'ottenimento di un prodotto PCR, è possibile utilizzare un gradiente di temperatura intorno a Tm - 5 °C per ottimizzare la temperatura di ricottura per l'amplificazione. NOTA: In questo esperimento è stata utilizzata una PFU polimerasi espressa internamente per 30 cicli con le seguenti condizioni: 94 °C per 30 s (denaturazione), temperatura di ricottura per 30 s e 72 °C per 6 min (o 1 min per kilobase-pairs). Per ulteriori dettagli su questo tipo di metodo PCR, vedere Liu e Naismith7.</li>
		<li>Pulire il prodotto PCR con un kit di pulizia PCR seguendo il protocollo del produttore. Analizzare il prodotto PCR mediante elettroforesi del gel di agarosio e successiva colorazione del bromuro di etidio.</li>
		<li>Legare il plasmide incubando con T4 ligasi durante la notte a 16 °C.</li>
	</ol>
</li>
	<li>Prima trasformare il TAG contenente plasmide (AmpR)in Escherichia coli chimicamente competente. Scegli un minimo di 4 colonie dalla trasformazione e purifica il plasmide. Fare le scorte cellulari di ciascuno con glicerolo con metodi standard e conservare a -80 °C. Inviare per il sequenziamento per confermare la mutazione TAG desiderata.</li>
	<li>Una volta confermata la sequenza, co-trasformare il plasmide contenente TAG (AmpR)con pEVOL-AckRS (ChlR) in CobB chimicamente competente (l'unica deacetilasi istonina nota in E. coli.) soppressioni le cellule BL21 utilizzando il metodo dello shock termico. pEVOL è un plasmide con un numero di copia medio a basso numero di copia p15A. NOTA: La serie pEVOL di plasmidi è stata costruita sulla base di studi precedenti che hanno mostrato una maggiore espressione della coppia ortogonale aaRS/tRNATyr è stata efficace nel ridurre il troncamento proteico e nell'aumentare le rese complessive delle proteinemutanti 8. Se le cellule di cancellazione cobb non sono accessibili, procedere con cellule BL21 chimicamente competenti. La cobB è una deacetilasi istonina sirtuina simile a sirtuina e la nicotinammide può essere aggiunta a una concentrazione finale di 5 mM durante l'espressione della proteina istonina per inibire cobB come approccio alternativo9.</li>
	<li>Fare un magazzino cellulare e conservare a -80 °C.</li>
</ol>2. Espressione acetilata della proteina istotone
<ol><li>Preparare 1 L di supporti 2YT autoclavati (o volume di scelta) in un pallone da coltura.</li>
	<li>Inoculare 20 mL di mezzi 2YT contenenti gli antibiotici appropriati con il patrimonio cellulare co-trasformato che ha il plasmide contenente TAG (AmpR) e pEVOL-AckRS (ChlR)e crescere a 37 °C in OD = 0,6 (4-6 h).</li>
	<li>Aggiungere gli antibiotici appropriati all'1 L dei mezzi 2YT autoclavati e inoculare con la coltura iniziale di 20 mL. Crescere a 37 °C fino a OD = 0,6-0,8 (2-3 h).</li>
	<li>Aggiungere agenti induttori e acetillysina (AcK) alle concentrazioni finali di IPTG 1 mM, 0,2% arabinosi e AcK 5 mM.</li>
	<li>Far crescere la cultura a 37 °C per 6-8 ore.</li>
	<li>Celle a pellet a 2.700 x g per 15 min.</li>
	<li>Conservare il pellet di cella a -80 °C durante la notte.</li>
	<li>Da questo passo in poi mantenere il campione sul ghiaccio tutti i tempi. Sciogliere il pellet cellulare in 50 mL di tampone di lisi istonale per 1 L di coltura.</li>
	<li>Sonicare secondo il seguente ciclo: 1 s on, 1 s off, totale in tempo: 3 min al 60% di ampiezza.</li>
	<li>Corpi di inclusione del pellet a 41.600 x g per 45 min.</li>
	<li>Scartare i corpi di inclusione supernatanti e resopensi in 30 mL del tampone di lisi istonale. L'inclusione del pellet promette 41.600 x g per 30 min.</li>
	<li>Scartare i corpi di inclusione supernatanti e resuspend in 30 mL di tampone di lavaggio pellet. Corpi di inclusione del pellet a 41.600 x g per 30 min.</li>
	<li>Scartare i corpi supernatanti e sciogliere i corpi di inclusione in 25 mL di tampone di cloridrato di guanidina (GuHCl) da 6 M. Incubare con agitazione a 37 °C per 1 h. NOTA: Se necessario, i corpi di inclusione possono essere incubati con agitazione durante la notte a 4 °C.</li>
	<li>L'inclusione del pellet promette 41.600 x g per 45 min. Incubare il supernatante con 1 mL di resina Ni-NTA equilibrata con tampone GuHCl da 6 M per 2 h.</li>
	<li>Procedere con la purificazione Ni-NTA in condizioni denaturate. Lavare la colonna con 3 volumi di colonne di buffer di lavaggio delle colonne. Proteina istolata acetilata elute con 10 mL di tampone di eluizione. NOTA: Tentare di concentrare la proteina qui è un'opzione, ma gli istoni acetilati sono molto imprevedibili e possono facilmente precipitare. Non è consigliabile concentrarsi oltre i 2 mL in volume totale.</li>
	<li>Dializzare estensivamente la proteina acetilata dell'istono contro il 5% di tampone di acido acetico per rimuovere i sali. Dializzare per 3 ore alla volta a 4 °C, scambiando con tampone fresco un minimo di 6 volte. NOTA: Per una migliore purezza delle proteine, c'è un'opzione per dializzare contro l'acqua pura. Tuttavia, ciò causa precipitazioni significative e riduzione della resa che può essere indesiderabile per le proteine acetilate istono a basso rendimento.</li>
	<li>Aliquota e licofilia proteine, e conservare a tempo indeterminato a -80 °C. Le proteine istono di tipo selvatico producono generalmente 10-50 mg/L, mentre le proteine acetilate dell'istone producono meno di 10 mg/L a seconda del sito specifico di lisina. Ad esempio, H3K79Ac ha una media di 5 mg/L.</li>
</ol>3. Espressione di proteine istono di tipo selvatico
<ol><li>Per assemblare nucleosomi completi, esprimere tutte e 4 le proteine istono. Quando si esprimono e purificano gli istoni di tipo jolly, il protocollo è lo stesso degli istoni acetilati tranne quanto segue:<ol>
<li>Non eseguire la co-trasformazione. Non utilizzare pEVOL-AcKRS per l'espressione istono di tipo jolly. Regolare gli antibiotici di conseguenza.</li>
		<li>Non utilizzare una linea cellulare di cancellazione CobB o aggiungere Nicotinammide, AcK o arabinosi durante l'induzione dell'espressione cellulare.</li>
	</ol>
</li>
</ol>4. Preparazione del DNA 601
NOTA: Una sequenza di DNA ottimizzata precedentemente progettata per dirigere il posizionamento nucleosoma è assemblata con ottameri istoni per produrre mononucleosoma ad alta efficienza. Questa sequenza è indicata come DNA 601 o sequenza di Widom. Questa sequenza è diventata la sequenza standard del DNA per gli studi in vitro sui nucleosomi, dai test di rimodellamento della cromatina alle misurazioni a singola molecola10.
<ol><li>Per preparare quantità significative di 601 DNA per l'assemblaggio nucleosoma, trasforma pGEM-3z/601 in Top 10 cellule e coltiva 10 mL di coltura per l'amplificazione e l'estrazione plasmide. Utilizzare un kit di estrazione plasmide e seguire la raccomandazione del produttore.</li>
	<li>Utilizzare una PFU polimerasi espressa internamente (più efficiente) per questo protocollo di amplificazione. Impostare una reazione PCR: per una reazione di 250 μL, utilizzare 207,5 μL autoclavato MQ H2O, 25 μL 10x PFU Buffer, 5 μL Forward Primer: ctggagaatcccggtgccg, 5 μL Reverse Primer: acaggatgtatatatctgacacg, 5 μL dNTP mix, 2.5 μL PFU enzima. In genere eseguiamo 60 reazioni contemporaneamente per ottenere abbastanza DNA da assemblare.</li>
	<li>Utilizzare una temperatura di ricottura di 52 °C per 30 s e un tempo di estensione di 30 s se si utilizza la polimerasi PFU. Altrimenti seguire le condizioni consigliate dai produttori.</li>
	<li>Una volta effettuata la PCR, utilizzare un kit di pulizia PCR preferito per purificare il prodotto PCR.</li>
</ol>5. Assemblaggio dell'ottagono istone
<ol><li>Sciogliere le aliquote delle pellet di proteine istone H2A, H2B, H3 e H4 in modo che vi sia uno stock separato di ciascuna proteina istonica nel Tampone GuHCl con un volume totale di 100 μL.</li>
	<li>Calcolare la concentrazione di ogni proteina istona misurandol'assorbanza A 280.</li>
	<li>Se l'assorbanza è maggiore di 1 per qualsiasi proteina, diluire con il tampone GuHCl per ottenere una concentrazione più accurata.</li>
	<li>Unire le proteine H2A e H2B in un rapporto molare 1:1 e diluire a una concentrazione proteica totale di 4 μg/μL. Ripetere per H3 e H4.</li>
	<li>Dializzare in sequenza a 4 °C rispetto a 2 M TE buffer overnight, 1 M TE buffer per 2 h e 0,5 M TE buffer per 5 h. NOTA: Il secondo e il terzo passo della dialisi causano il precipitare delle conformazioni instabili delle proteine. Si prevede che vedrà forti precipitazioni in questi passaggi.</li>
	<li>Rimuovere i precipitati mediante centrifugazione a 16.800 x g a 4 °C.</li>
	<li>Anche in questo caso, calcolare la concentrazione di dimeri istono (miscela H2A/H2B) e tetrameri (miscela H3/H4) che misuranol'assorbanza A 280.</li>
	<li>Mescolare dimeri e tetrameri in un rapporto molare 1:1 e regolare NaCl a 2 M con l'aggiunta di NaCl solido.</li>
	<li>L'ottagono istono può essere conservato a 4 °C ed è più stabile dei dimeri e dei tetrameri. Non congelare mai l'ottagono istone in quanto ciò può causare lo smontaggio.</li>
	<li>Se si assembla con istoni acetilati, è sufficiente sostituire la proteina di tipo selvatico con la proteina acetilata nella procedura.</li>
</ol>6. Assemblaggio nucleosoma
<ol><li>Usa un buffer TE 100x e un NaCl solido per regolare il BUFFER da 601 DNA a 2M TE. Aggiungere il DNA 601 in tampone TE 2M all'ottamero istono in un rapporto molare da 0,85:1 a 0,90:1. Un rapporto inferiore di DNA può essere aggiunto se il DNA libero è presente nell'analisi dello spostamento del gel.</li>
	<li>Trasferire la miscela DNA-istone in un sacchetto di dialisi e mettere in circa 200 mL di tampone 2M TE (o più se si assemblano più campioni) e mescolare molto delicatamente a 4 °C.</li>
	<li>Impostare una pompa peristaltica da spurgo per gocciolare lentamente in nessun tampone TE sale. Quando il volume è approssimativamente raddoppiato, versare metà del volume. Fallo almeno 4 volte in totale. Con una pompa questo può richiedere 4-8 ore a seconda del volume iniziale. I nucleosomi si formano quando la concentrazione di sale è ridotta a 150 mM (misurata dal misuratore di salinità).</li>
	<li>Dopo che la concentrazione di sale è stata ridotta a 150 mM, dializzare contro un tampone TE da 20 mM durante la notte.</li>
	<li>Rimuovere i precipitati mediante centrifugazione e misurare la concentrazione dei nucleosomi mediante lettura A260 utilizzando un lettore di piastre.</li>
	<li>Aggiungere la proteasi His-TEV (TEV: nucleosoma 1:30, w:w ) e incubare durante la notte a 4 °C per rimuovere tutti i tag di istidina. Rimuovere le impurità dell'etichetta istidina dalla soluzione nucleosoma con la resina Ni-NTA tirare verso il basso.</li>
	<li>Per posizionare il nucleosoma e omogeneizzare il campione, incubare a 60 °C per 1 h. NOTA: Per i siti acetilati particolarmente instabili, questo passaggio potrebbe non essere consigliabile.</li>
	<li>Conservare i nucleosomi a breve termine (alcune settimane) a 4 °C.</li>
	<li>Per la conservazione a lungo termine, dializzare i nucleosomi contro il buffer di stoccaggio e conservare a -80 °C.</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

Nessuno degli autori può dichiarare interessi finanziari concorrenti.

È essenziale seguire questo protocollo in ogni dettaglio durante un esperimento. I nucleosomi non sono molto stabili e molti tentativi ed errori sono andati a determinare questo protocollo. È fondamentale rimuovere i precipitati ad ogni fase (o quando osservato) perché il particolato può facilmente interferire con i processi di assemblaggio. Tieni sempre i campioni di istone sul ghiaccio. Se i nucleosomi vengono conservati a 4 °C per troppo tempo, possono smontare spontaneamente. Assicurarsi di controllare eventuali...

Abbiamo utilizzato PylRS e tRNAPyl per sintetizzare e assemblare mononucleosomi ricostituiti con istoni acetilati specifici del sito. PylRS si è dimostrato prezioso come strumento di espansione del codice genetico per produrre proteine con modifiche post traslazionali (PTM) ed è stato geneticamente evoluto per incorporare circa 200 diverse bcAA. PylRS incorpora ad un codone di arresto ambrato, rimuovendo la concorrenza da altri amminoacidi durante la traduzione. Il PylRS è stato scoperto per la prima volta in archea metanogenica, e da allora è stato utilizzato in biologia chimica per incorporare nuovi gruppi chimici reattivi nelle proteine1,2.
MmAcKRS1 è stato evoluto da Methanosarcina mazei PylRS e frequentemente utilizzato nel nostro laboratorio per la sintesi di proteine acetilate3,4,5,6. MmAcKRS1 consegna AcK in un sito di mutazione ambrata nell'mRNA preferito durante la traduzione in Escherichia coli. Questa tecnica è stata precedentemente utilizzata per incorporare siti di lisina H3 di AcK, K9, K14, K18, K23, K27, K36, K56, K64 e K79 istono H3 per studiare l'attività di Sirtuin 1, 2, 6 e 7 sui mononucleosomi acetilati4,5,6. Qui dettagliamo questo metodo per esprimere istoni acetilati e nucleosomi acetilati ricostituiti.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.5 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>1 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>100x TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>2 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>20 mM TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>6 M GuHCl</td>
			<td></td>
			<td></td>
			<td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>Acetyllysine</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Column Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisherbrand&#160;Variable-Flow Chemical Transfer Pump</td>
			<td>Fischer Scientific</td>
			<td>15-077-67</td>
			<td></td>
		</tr>
		<tr>
			<td>His-TEV protease</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Histone Lysis Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td>
		</tr>
		<tr>
			<td>Ni-NTA Resin</td>
			<td></td>
			<td></td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td>
		</tr>
		<tr>
			<td>PCR Clean-Up Kit</td>
			<td>Epoch Life Sicences</td>
			<td>2360050</td>
			<td></td>
		</tr>
		<tr>
			<td>Pellet Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>petDUET-His-SUMO-TEV-H4</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2A</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2B</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pEVOL-AckRS</td>
			<td>Addgene</td>
			<td>137976</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-3z/601</td>
			<td>Addgene</td>
			<td>26656</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

Le proteine istono acetilate possono essere facilmente espresse in Escherichia coli che codifica per un mutante, Nε-acetil-lisina (AcK) specifico Methanosarcina mazi pyrrolysine tRNA-sintetasi (MmAcKRS1) e il suo tRNA imparentato (tRNAPyl)per assemblare mononucleosomi ricostituiti con istoni acetilati specifici del sito. MmAcKRS1 e tRNAPyl forniscono AcK in un sito di mutazione ambrata nell'mRNA preferito durante la traduzione in Escherichia coli. Questa tecnica è stata ampiamente utilizzata per incorporare AcK nei siti di llysina H3. La pirrolisil-tRNA sintetasi (PylRS) può anche essere facilmente evoluta per incorporare altri amminoacidi non canonici (bcAA) per la modifica o la funzionalizzazione delle proteine specifiche del sito. Qui dettagliamo un metodo per incorporare AcK usando il sistema MmAcKRS1 nell'istono H3 e integriamo proteine H3 acetilate in mononucleosomi ricostituiti. I mononucleosomi ricostituiti acetilati possono essere utilizzati in saggi biochimici e leganti, determinazione della struttura e altro ancora. Ottenere mononucleosomi modificati è fondamentale per progettare esperimenti relativi alla scoperta di nuove interazioni e alla comprensione dell'epigenetica.

Dimeri, tetrameri e ottameri possono essere valutati eseguendo un gel SDS PAGE del 12% (Figura 1 e Figura 2). Qui potete vedere che alcuni dei tetrameri acetilati hanno una resa inferiore rispetto ad altri (Figura 1). Infatti, più vicino alla regione centrale, minore è la resa osservata. Ciò è molto probabilmente dovuto all'acetilazione che interferisce con l'assemblaggio del tetramero più ci si...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Qui presentiamo un metodo per esprimere proteine istono acetilate usando l'espansione del codice genetico e assemblare nucleosomi ricostituiti in vitro.

Acetilazione lisina specifica del sito degli istoni per la ricostituzione nucleosoma usando l'espansione del codice genetico in Escherichia coli

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K Views.  Texas A&M University. Qui presentiamo un metodo per esprimere proteine istono acetilate usando l'espansione del codice genetico e assemblare nucleosomi ricostituiti in vitro.

Video: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique applications for OMV where traditional nanoparticles are proving too difficult to synthesize. To date, all Gram-negative bacteria have been shown to produce OMV demonstrating packaging of a variety of cargo that includes small molecules, peptides, proteins and genetic material. Based on their diverse cargo, OMV are implicated in many biological processes ranging from cell-cell communication to gene transfer and delivery of virulence factors depending upon which bacteria are producing the OMV. Only recently have bacterial OMV become accessible for use across a wide range of applications through the development of techniques to control and direct packaging of recombinant proteins into OMV. This protocol describes a method for the production, purification, and use of enzyme packaged OMV providing for improved overall production of recombinant enzyme, increased vesiculation, and enhanced enzyme stability. Successful utilization of this protocol will result in the creation of a bacterial strain that simultaneously produces a recombinant protein and directs it for OMV encapsulation through creating a synthetic linkage between the recombinant protein and an outer membrane anchor protein. This protocol also details methods for isolating OMV from bacterial cultures as well as proper handling techniques and things to consider when adapting this protocol for use for other unique applications such as: pharmaceutical drug delivery, medical diagnostics, and environmental remediation.

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

A protocol for the production, purification, and use of enzyme packaged outer membrane vesicles (OMV) providing for enhanced enzyme stability for implementation across diverse applications is presented.

Packaging proteine ​​diretto all&#39;interno della membrana esterna vescicole da<em&gt; Escherichia coli</em&gt;: Progettazione, produzione e purificazione

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique ...

Ricerca

Biochimica

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many of these conditions cause protein unfolding in the cell and have detrimental impact on the survival of the organism. A group of unrelated, stress-specific molecular chaperones have been shown to play essential roles in the survival of these stress conditions. While fully folded and chaperone-inactive before stress, these proteins rapidly unfold and become chaperone-active under specific stress conditions. Once activated, these conditionally disordered chaperones bind to a large number of different aggregation-prone proteins, prevent their aggregation and either directly or indirectly facilitate protein refolding upon return to non-stress conditions. The primary approach for gaining a more detailed understanding about the mechanism of their activation and client recognition involves the purification and subsequent characterization of these proteins using in vitro chaperone assays. Follow-up in vivo stress assays are absolutely essential to independently confirm the obtained in vitro results.
This protocol describes in vitro and in vivo methods to characterize the chaperone activity of E. coli HdeB, an acid-activated chaperone. Light scattering measurements were used as a convenient read-out for HdeB&#39;s capacity to prevent acid-induced aggregation of an established model client protein, MDH, in vitro. Analytical ultracentrifugation experiments were applied to reveal complex formation between HdeB and its client protein LDH, to shed light into the fate of client proteins upon their return to non-stress conditions. Enzymatic activity assays of the client proteins were conducted to monitor the effects of HdeB on pH-induced client inactivation and reactivation. Finally, survival studies were used to monitor the influence of HdeB&#39;s chaperone function in vivo.

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

This study describes biophysical, biochemical and molecular techniques to characterize the chaperone activity of Escherichia coli HdeB under acidic pH conditions. These methods have been successfully applied for other acid-protective chaperones such as HdeA and can be modified to work for other chaperones and stress conditions.

Rilevamento del pH-dipendente attività di<em&gt; Escherichia coli</em&gt; Chaperone HdeB<em&gt; In Vitro</em&gt; e<em&gt; In Vivo</em

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many ...

Efficient and Site-specific Antibody Labeling by Strain-promoted Azide-alkyne Cycloaddition

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is protein conjugation by genetically introducing an unnatural amino acid containing a bioorthogonal functional group. This report describes a detailed protocol for site-specific antibody conjugation. The protocol includes experimental details for the genetic incorporation of an azide-containing amino acid, and the conjugation reaction by strain-promoted azide-alkyne cycloaddition (SPAAC). This strain-promoted reaction proceeds by simple mixing of the reacting molecules at physiological pH and temperature, and does not require additional reagents such as copper(I) ions and copper-chelating ligands. Therefore, this method would be useful for general protein conjugation and development of antibody drug conjugates (ADCs).

Here, we present a protocol to site-specifically introduce chemical probes into an antibody fragment by genetically incorporating an azide-containing amino acid, and subsequently coupling the azide with a chemical probe by strain-promoted azide-alkyne cycloaddition (SPAAC).

Efficiente e anticorpi etichettatura per cicloaddizione azide-alchino Strain-promosso site-specific

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is ...

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

Ricostituzione dei nucleosomi con differenzialmente marcati con isotopi sorelle istoni

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. The relative levels of different tRNAs, and the ratio of aminoacylated tRNA to total tRNA, known as the charging level, are important factors in determining the accuracy and speed of translation. Therefore, the abundance and charging levels of tRNAs are important variables to measure when studying protein synthesis, for example under various stress conditions. Here, we describe a method for harvesting tRNA and directly measuring both the relative abundance and the absolute charging level of specific tRNA species in Escherichia coli. The tRNA is harvested in such a way that the labile bond between the tRNA and its amino acid is preserved. The RNA is then subjected to gel electrophoresis and Northern blotting, which results in separation of the charged and uncharged tRNAs. The levels of specific tRNAs in different samples can be compared due to the addition of spike-in cells for normalization. Prior to RNA purification, we add 5% of E. coli cells that overproduce the rare tRNAselC to each sample. The amount of the tRNA species of interest in a sample is then normalized to the amount of tRNAselC in the same sample. Addition of spike-in cells prior to RNA purification has the advantage over addition of purified spike-in RNAs that it also accounts for any differences in cell lysis efficiency between samples.

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Here we present a method for directly measuring transfer RNA charging levels from purified Escherichia coli RNA as well as a way to compare relative levels of transfer RNA, or any other short RNA, across different samples based on the addition of spike-in cells expressing a reference gene.

Quantificazione di abbondanza e ricarica i livelli di RNA di trasferimento in Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. ...

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts of recombinant RNAs are limited. Here, we describe a protocol to produce large amounts of recombinant RNA in Escherichia coli based on co-expression of a chimeric molecule that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. Viroids are relatively small, non-coding, highly base-paired circular RNAs that are infectious to higher plants. The host plant tRNA ligase is an enzyme recruited by viroids that belong to the family Avsunviroidae, such as Eggplant latent viroid (ELVd), to mediate RNA circularization during viroid replication. Although ELVd does not replicate in E. coli, an ELVd precursor is efficiently transcribed by the E. coli RNA polymerase and processed by the embedded hammerhead ribozymes in bacterial cells, and the resulting monomers are circularized by the co-expressed tRNA ligase reaching a remarkable concentration. The insertion of an RNA of interest into the ELVd scaffold enables the production of tens of milligrams of the recombinant RNA per liter of bacterial culture in regular laboratory conditions. A main fraction of the RNA product is circular, a feature that facilitates the purification of the recombinant RNA to virtual homogeneity. In this protocol, a complementary DNA (cDNA) corresponding to the RNA of interest is inserted in a particular position of the ELVd cDNA in an expression plasmid that is used, along the plasmid to co-express eggplant tRNA ligase, to transform E. coli. Co-expression of both molecules under the control of strong constitutive promoters leads to production of large amounts of the recombinant RNA. The recombinant RNA can be extracted from the bacterial cells and separated from the bulk of bacterial RNAs taking advantage of its circularity.

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

Here, we present a protocol to produce large amounts of recombinant RNA in Escherichia coli by co-expressing a chimeric RNA that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. The main product is a circular molecule that facilitates purification to homogeneity.

Produzione su larga scala di RNA ricombinante su un'impalcatura circolare utilizzando un sistema derivato Viroid in Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts ...

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic acid (sRNA) molecules and target messenger RNAs (mRNAs). In addition, site-directed mutagenesis is used to map specific protein binding sites to RNA. A 2-step and 3-step PCR based introduction of mutations is described. The approach is relevant to all protein-RNA and RNA-RNA interaction studies. In short, the technique relies on designing primers with the desired mutation(s), and through 2 or 3 steps of PCR synthesizing a PCR product with the mutation. The PCR product is then used for cloning. Here, we describe how to perform site-directed mutagenesis with both the 2- and 3-step approach to introduce mutations to the sRNA, McaS, and the mRNA, csgD, to investigate RNA-RNA and RNA-protein interactions. We apply this technique to investigate RNA interactions; however, the technique is applicable to all mutagenesis studies (e.g., DNA-protein interactions, amino-acid substitution/deletion/addition). It is possible to introduce any kind of mutation except for non-natural bases but the technique is only applicable if a PCR product can be used for downstream application (e.g., cloning and template for further PCR).

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in deoxyribonucleic acid (DNA). This protocol describes how to do site-directed mutagenesis with a 2-step and 3-step polymerase chain reaction (PCR) based approach, which is applicable to any DNA fragment of interest.

Mutagenesi sito-diretta per In Vitro e In Vivo esperimenti esemplificati con interazioni RNA in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic ...

In Vitro Ubiquitination and Deubiquitination Assays of Nucleosomal Histones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination of chromatin function and DNA-associated processes. This modification involves a sequential action of several enzymes including E1 ubiquitin-activating, E2 ubiquitin-conjugating and E3 ubiquitin-ligase and is reversed by deubiquitinases (DUBs). Ubiquitination induces degradation of proteins or alteration of protein function including modulation of enzymatic activity, protein-protein interaction and subcellular localization. A critical step in demonstrating protein ubiquitination or deubiquitination is to perform in vitro reactions with purified components. Effective ubiquitination and deubiquitination reactions could be greatly impacted by the different components used, enzyme co-factors, buffer conditions, and the nature of the substrate.&#160; Here, we provide step-by-step protocols for conducting ubiquitination and deubiquitination reactions. We illustrate these reactions using minimal components of the mouse Polycomb Repressive Complex 1 (PRC1), BMI1, and RING1B, an E3 ubiquitin ligase that monoubiquitinates histone H2A on lysine 119. Deubiquitination of nucleosomal H2A is performed using a minimal Polycomb Repressive Deubiquitinase (PR-DUB) complex formed by the human deubiquitinase BAP1 and the DEUBiquitinase ADaptor (DEUBAD) domain of its co-factor ASXL2. These ubiquitination/deubiquitination assays can be conducted in the context of either recombinant nucleosomes reconstituted with bacteria-purified proteins or native nucleosomes purified from mammalian cells. We highlight the intricacies that can have a significant impact on these reactions and we propose that the general principles of these protocols can be swiftly adapted to other E3 ubiquitin ligases and deubiquitinases.

Ubiquitination is a post-translational modification that plays important roles in cellular processes and is tightly coordinated by deubiquitination. Defects in both reactions underlie human pathologies. We provide protocols for conducting ubiquitination and deubiquitination reaction in vitro using purified components.

In Vitro Ubiquitination e Deubiquitination Saggi di Istoni Nucleosomici

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination ...

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein aggregation. The accumulation of protein aggregates in bacterial cells can lead to significant alterations in the cellular phenotypic behavior, including a reduction in growth rates, stress resistance, and virulence. Several experimental procedures exist for the examination of these stressor-mediated phenotypes. This paper describes an optimized assay for the extraction and visualization of aggregated and soluble proteins from different Escherichia coli strains after treatment with a silver-ruthenium-containing antimicrobial. This compound is known to generate reactive oxygen species and causes widespread protein aggregation. 
The method combines a centrifugation-based separation of protein aggregates and soluble proteins from treated and untreated cells with subsequent separation and visualization by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie staining. This approach is simple, fast, and allows a qualitative comparison of protein aggregate formation in different E. coli strains. The methodology has a wide range of applications, including the possibility to investigate the impact of other proteotoxic antimicrobials on in vivo protein aggregation in a wide range of bacteria. Moreover, the protocol can be used to identify genes that contribute to increased resistance to proteotoxic substances. Gel bands can be used for the subsequent identification of proteins that are particularly prone to aggregation.

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

This protocol describes the extraction and visualization of aggregated and soluble proteins from Escherichia coli after treatment with a proteotoxic antimicrobial. Following this procedure allows a qualitative comparison of protein aggregate formation in vivo in different bacterial strains and/or between treatments.

Estrazione e visualizzazione di aggregati proteici dopo il trattamento di Escherichia coli con un fattore di stress proteotossico

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

Saggio di pulldown accoppiato con co-espressione in cellule batteriche come strumento efficiente in termini di tempo per testare interazioni proteina-proteina impegnative

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...