Dr. Wesley Wang'a bu protokole ve değerli akıl hocalığına zemin hazırlayıp verdiği için teşekkür ederiz. Bu çalışma Kısmen Ulusal Sağlık Enstitüleri (GrantS R01GM127575 ve R01GM121584) ve Welch Foundation (Grant A-1715) tarafından desteklendi.

1. Plazmid yapımı
<ol><li>Hangi histone proteinin asetilasyona ve hangi lizin bölgesine karar vererek başlayın. Siteye yönlendirilmiş mutagenezi kullanarak siteyi amber stop codon'a (TAG) yönlendirin. NOT: Histone proteinlerinin ekspresyonu için daha önce tasarlanmış dört plazmid vardır. Dört histone proteini de N-terminal histidin etiketiyle pETDuet-1 vektörüne klonlandı. Histone H4 ayrıca bir SUMO etiketi, yaklaşık 40 kopya numarasına sahip çoğaltma colE1'in kökeni, ampisiline dayanıklı ve bir T7 promotörü içerir.<ol>
<li>Dört histone protein plazmidinden birinde istenen yerde (mevcut bir lizin kodonunu kehribar durdurma kodonu ile değiştirerek) TAG mutasyonu içeren ileri ve ters astarlar tasarlayın.</li>
		<li>Plazmid içeren TAG'i yükseltmek için tam plazmid PCR kullanın. Astarlar için uygun bir tavlama sıcaklığı belirleyin. Genel olarak, astarların eksi 5 °C'nin erime sıcaklığı (Tm)yeterli olacaktır. Bir PCR ürünü elde etmekte zorluk yaşanırsa, tavlama sıcaklığını amplifikasyon için optimize etmek için Tm - 5 °C civarında bir sıcaklık gradyanı kullanılabilir. NOT: Bu deneyde, aşağıdaki koşullarla 30 döngü boyunca şirket içinde ifade edilen bir PFU polimeraz kullanılmıştır: 30 s (denatürasyon) için 94 °C, 30 s için tavlama sıcaklığı ve 6 dakika (veya kilobase çiftleri başına 1 dk) için 72 °C. Bu tür PCR yöntemi hakkında daha fazla bilgiiçin bkz.</li>
		<li>Üreticinin protokolüne uyarak PCR ürününü pcr temizleme kiti ile temizleyin. PCR ürününü agarose jel elektroforezi ve daha sonra ethidyum bromür lekeleme ile analiz edin.</li>
		<li>Plazmidi 16 °C'de bir gecede T4 ligaz ile inkübasyon yaparak lige edin.</li>
	</ol>
</li>
	<li>İlk plazmid (AmpR)içeren TAG'i kimyasal olarak yetkin Escherichia coli'yedönüştürün. Dönüşümden en az 4 koloni seçin ve plazmidi arındırın. Standart yöntemleri kullanarak gliserol ile her birinin hücre stoklarını yapın ve -80 °C'de saklayın. İstenen TAG mutasyonu onaylamak için sıralama için gönderin.</li>
	<li>Dizi onaylandıktan sonra, pEVOL-AckRS (ChlR)ile TAG içeren plazmid (AmpR)ile birlikte ısı şoku yöntemini kullanarak BL21 hücrelerinin silinmesini kimyasal olarak yetkin CobB'ye (E. coli.)bilinen tek histone lizin deacetylazı) dönüştürün. pEVOL, düşük kopya numarası p15A kökenli bir orta kopya numarasına sahip bir plazmiddir. NOT: pEVOL plazmid serisi, ortogonal aaRS/tRNATyr çiftinin protein kesilmesini azaltmada ve mutant proteinlerin genel verimini artırmada etkili olduğunu gösteren önceki çalışmalara dayanarak inşa edilmiştir8. CobB silme hücrelerine erişilemediyse, kimyasal olarak yetkin BL21 hücreleriyle devam edin. CobB sirtuin benzeri bir histone lizin deacetylazdır ve Nicotinamide alternatif bir yaklaşım olarak CobB'yi inhibe etmek için histone protein ekspresyonu sırasında 5 mM son konsantrasyonda eklenebilir9.</li>
	<li>Bir hücre stoğu yapın ve -80 °C'de saklayın.</li>
</ol>2. Asetillenmiş histone protein ekspresyonu
<ol><li>Bir kültür şişesinde 1 L otomatik kapatılmış 2YT ortamı (veya seçim hacmi) hazırlayın.</li>
	<li>TAG içeren plazmid (AmpR)ve pEVOL-AckRS (Chl R) içeren ve 37 °C ila OD = 0,6(4-6 h) arasında büyüyen ortak dönüştürülmüş hücre stoğu ile uygun antibiyotikleri içeren 2YT ortam 20 mL aşıla.</li>
	<li>1 L otoklavlı 2YT ortama uygun antibiyotikleri ekleyin ve 20 mL başlangıç kültürü ile aşıleyin. 37 °C'de OD = 0,6-0,8 (2-3 saat) arasında büyüyün.</li>
	<li>IPTG 1 mM, %0,2 arabinoz ve AcK 5 mM'nin son konsantrasyonlarına indükleme ajanları ve asetilsin (AcK) ekleyin.</li>
	<li>Kültürü 37 °C'de 6-8 saat büyütün.</li>
	<li>Pelet hücreleri 15 dakika boyunca 2.700 x g'da.</li>
	<li>Hücre peletini gece boyunca -80 °C'de saklayın.</li>
	<li>Bu adımdan itibaren numuneyi her zaman buzda tutun. Hücre peletini 1 L kültür başına 50 mL histone lizis tamponunda çözün.</li>
	<li>Aşağıdaki döngüye göre sonicate: 1 s açık, 1 s kapalı, toplam zamanında: 3 dk% 60 genlik.</li>
	<li>Pelet dahil vücutları 45 dakika boyunca 41.600 x g'da.</li>
	<li>30 mL histone liziz tamponunda süpernatant ve resuspend inklüzyon gövdelerini atın. Pelet içerme 30 dakika boyunca 41.600 x g'dadır. </li>
	<li>Süpernatant atın ve 30 mL pelet yıkama tamponunda dahil etme gövdelerini yeniden dirsindirin. Pelet dahil vücutları 30 dakika boyunca 41.600 x g'da.</li>
	<li>Süpernatant atın ve 6 M Guanidine Hidroklorür (GuHCl) tamponunun 25 mL'sinde dahil etme gövdelerini çözün. 1 saat boyunca 37 °C'de ajitasyon ile kuluçkaya yaslanın. NOT: Gerekirse, dahil etme organları 4 °C'de bir gecede ajitasyon ile inkübe edilebilir.</li>
	<li>Pelet içerme 45 dakika boyunca 41.600 x g'dadır. 2 saat boyunca 6 M GuHCl tamponu ile dengelenmiş 1 mL Ni-NTA reçinesi ile süpernatantı kuluçkaya yaslanın.</li>
	<li>Denatüre koşullar altında Ni-NTA saflaştırma ile devam edin. Sütunu 3 sütun hacminde sütun yıkama arabelleğiyle yıkayın. Elute asetillenmiş histone proteini 10 mL elüsyon tamponu ile. NOT: Proteini burada konsantre etmeye çalışmak bir seçenektir, ancak asetillenmiş histonlar çok öngörülemezdir ve kolayca çökelebilir. Toplam hacimde 2 mL'yi geçmeniz önerilmez.</li>
	<li>Tuzları çıkarmak için asetilasyonlu histone proteinini% 5 asetik asit tamponuna karşı kapsamlı bir şekilde dialyze edin. Dialyze 4 °C'de bir seferde 3 saat, en az 6 kez taze tampon alışverişi. NOT: Geliştirilmiş protein saflığı için saf suya karşı diyalze etme seçeneği vardır. Bununla birlikte, bu, düşük verimli asetillenmiş histone proteinleri için istenmeyen önemli yağış ve verim azalmasına neden olur.</li>
	<li>Aliquot ve lyophilize protein, ve süresiz olarak -80 °C depolayın. Yabani tip histone proteinleri genellikle 10-50 mg/L verim, asetilasyonlu histone proteinlerisse özgü lizin bölgesine bağlı olarak 10 mg/L'den az verim verir. Örneğin, H3K79Ac ortalama 5 mg/L' dir.</li>
</ol>3. Vahşi tip histon proteini ekspresyonu
<ol><li>Tam nükleozomları birleştirmek için, 4 histone proteinini de ifade edin. Vahşi tip histonları ifade ederken ve arındırırken protokol, aşağıdakiler dışında asetilen histonları ile aynıdır:<ol>
<li>Birlikte dönüştürme gerçekleştirmeyin. Vahşi tip histone ifadesi için pEVOL-AcKRS kullanmayın. Antibiyotikleri buna göre ayarlayın.</li>
		<li>Hücresel ifadenin indüksiyonu sırasında CobB silme hücresi hattı kullanmayın veya Nikotinamid, AcK veya arabinoz eklemeyin.</li>
	</ol>
</li>
</ol>4. 601 DNA'nın hazırlanması
NOT: Nükleozom konumlandırmasını yönlendirmek için önceden tasarlanmış optimize edilmiş bir DNA dizisi, yüksek verimli mononükleozom üretmek için histone oktamers ile birleştirilir. Bu dizi 601 DNA veya Widom dizisi olarak adlandırılır. Bu dizi, kromatin remodeling testlerinden tek molekül ölçümlerine kadar nükleozomların in vitro çalışmaları için standart DNA dizisi haline gelmiştir10.
<ol><li>Nükleozom montajı için önemli miktarlarda 601 DNA hazırlamak için pGEM-3z/601'i Top 10 hücrelerine dönüştürün ve plazmid amplifikasyon ve ekstraksiyon için 10 mL kültür yetiştirin. Plazmid çıkarma kiti kullanın ve üreticinin tavsiyesine uyun.</li>
	<li>Bu amplifikasyon protokolü için şirket içinde ifade edilmiş bir PFU polimeraz (daha verimli) kullanın. PCR reaksiyonsu ayarlama: 250 μL reaksiyon için, 207.5 μL otoklavlı MQ H2O, 25 μL 10x PFU Tampon, 5 μL İleri Astar: ctggagaatcccggtgccg, 5 μL Ters Astar: acaggatgtatatctgacacg, 5 μL dNTP karışımı, 2.5 μL PFU enzimi kullanın. Genellikle aynı anda 60 reaksiyon çalıştırarak bir araya yetecek kadar DNA elde ederiz.</li>
	<li>PFU polimeraz kullanıyorsanız, 30 s için 52 °C tavlama sıcaklığı ve 30 s uzatma süresi kullanın. Aksi takdirde üreticilerin önerdiği koşulları izleyin.</li>
	<li>PCR yapıldıktan sonra, PCR ürününü saflaştırmak için tercih edilen bir PCR temizleme kiti kullanın.</li>
</ol>5. Histone oktamer montajı
<ol><li>H2A, H2B, H3 ve H4 histone protein peletlerinin aliquotlarını çözün, böylece GuHCl Buffer'daki her histone proteininin ayrı bir stoğu vardır ve toplam hacmi 100 μL'dir.</li>
	<li>A280 emiciliği ölçerek her bir histon proteininin konsantrasyonunu hesaplayın.</li>
	<li>Emicilik herhangi bir protein için 1'den büyükse, daha doğru bir konsantrasyon elde etmek için GuHCl tamponu ile seyreltin.</li>
	<li>H2A ve H2B proteinlerini 1:1 molar oranında birleştirin ve toplam 4 μg/μL protein konsantrasyonuna seyreltin.</li>
	<li>Dialyze bir gecede 2 M TE arabelleğe karşı 4 °C'de sırayla, 2 h için 1 M TE arabellek ve 5 saat için 0,5 M TE arabellek. NOT: Diyalizin ikinci ve üçüncü adımları, çökeltmek için kararsız protein uyumlarına neden olur. Bu adımlarda yoğun yağış görülmesi bekleniyor.</li>
	<li>4 °C'de 16.800 x g'da santrifüjleme ile çökeltmeleri çıkarın.</li>
	<li>Yine, A280 emiciliğini ölçen histone dimer (H2A/H2B karışımı) ve tetramerlerin (H3/H4 karışımı) konsantrasyonunu hesaplayın.</li>
	<li>Dimerleri ve tetramerleri 1:1 molar oranında karıştırın ve katı NaCl ilavesi ile NaCl'i 2 M'ye ayarlayın.</li>
	<li>Histone oktamer 4 °C'de saklanabilir ve dimer ve tetramerlerden daha kararlıdır. Demonteye neden olabileceği için asla histone oktamerini dondurmayın.</li>
	<li>Asetillenmiş histonlarla bir araya getiriyorsanız, vahşi tip proteini prosedürdeki asetilasyonlu proteinle değiştirmenız yeterlidir.</li>
</ol>6. Nükleozom montajı
<ol><li>601 DNA'yı 2M TE arabelleğe ayarlamak için 100x TE arabellek ve katı NaCl kullanın. 2M TE tampondaki 601 DNA'yı 0.85:1 ila 0.90:1 molar oranında histone oktamerine ekleyin. Jel kayma analizinde serbest DNA varsa daha düşük bir DNA oranı eklenebilir.</li>
	<li>DNA-histon karışımını bir diyaliz torbasına aktarın ve yaklaşık 200 mL 2M TE tampona (veya birden fazla numuneyi monte ediyorsanız daha fazla) yerleştirin ve 4 °C'de çok hafifçe karıştırın.</li>
	<li>Tuz TE tamponunda yavaşça damlatmak için temizlemek için peristaltik bir pompa ayarlayın. Hacim kabaca iki katına çıktığında, hacmin yarısını dökün. Bunu toplamda en az 4 kez yapın. Bir pompa ile bu, başlangıç hacmine bağlı olarak 4-8 saat sürebilir. Tuz konsantrasyonu 150 mM'ye düşürüldüğünde nükleozomlar oluşur (tuzluluk ölçer ile ölçülür).</li>
	<li>Tuz konsantrasyonu 150 mM'ye düşürüldükten sonra, bir gecede 20 mM TE tampona karşı dialyze edin.</li>
	<li>Çökeltme ile çökeltmeleri çıkarın ve bir plaka okuyucu kullanarak nükleozomların konsantrasyonunu A260 okuma ile ölçün.</li>
	<li>His-TEV proteazını ekleyin (TEV: nükleozom 1:30, w:w) ve tüm histidin etiketlerini kaldırmak için 4 °C'de bir gecede kuluçkaya yatırın. Ni-NTA reçinesi aşağı çekerek nükleozom çözeltisinden histidin etiket safsızlıklarını çıkarın.</li>
	<li>Nükleozomları konumlandırmak ve numuneyi homojenize etmek için 1 saat boyunca 60 °C'de kuluçkaya yatırın. NOT: Özellikle kararsız olan asetillenmiş siteler için bu adım tavsiye edilmeyebilir.</li>
	<li>Nükleozomları 4 °C'de kısa süreli (birkaç hafta) saklayın.</li>
	<li>Uzun süreli depolama için, nükleozomları depolama tamponuna karşı dialyze edin ve -80 °C'de saklayın.</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

Yazarların hiçbiri tarafından beyan edilen rakip finansal çıkarlar yoktur.

Bir deney sırasında bu protokolü her ayrıntıya uymak önemlidir. Nükleozomlar çok kararlı değildir ve bu protokolün belirlenmesinde çok fazla deneme yanılma olmuştur. Partiküller montaj işlemlerine kolayca müdahale edebileceğinden, her adımda (veya gözlendiği zaman) çökeltileri kaldırmak anahtardır. Her zaman ton örneklerini buzda tut. Nükleozomlar 4 °C'de çok uzun süre saklanırsa, kendiliğinden sökülebilirsiniz. Herhangi bir denemede kullanılmadan önce 2 haftadan uzun bir süre 4 °C'd...

Biz sentezlemek ve siteye özgü asetillelenmiş histonlar ile yeniden inşa mononükleozomları birleştirmek içinPylRS ve tRNA Pyl kullandık. PylRS, post translational modifikasyonlara (PTM) sahip proteinler üretmek için genetik kod genişletme aracı olarak paha biçilmez olduğunu kanıtlamıştır ve genetik olarak yaklaşık 200 farklı nTA'yı içerecek şekilde evrimleştirilmiştir. PylRS, çeviri sırasında diğer amino asitlerden kaynaklanan rekabeti ortadan kaldırarak kehribar stop kodonuna dahil olur. PylRS ilk olarak metanojenik arkealarda keşfedilmiştir ve o zamandan beri kimyasal biyolojide yeni reaktif kimyasal grupları proteinlere dahil etmek için1,2.
MmAcKRS1, Methanosarcina mazei PylRS'den evrimleşmiştir ve laboratuvarımızda asetillenmiş proteinlerin sentezi için sıklıkla3, 4,5,6. MmAcKRS1, Escherichia coli'deçeviri sırasında tercih ettiği mRNA'daki bir kehribar mutasyon bölgesinde AcK sunar. Bu teknik daha önce K4, K9, K14, K18, K23, K27, K36, K56, K64 ve K79 histone H3 lizin sitelerinde Sirtuin 1, 2, 6 ve 7'nin asetilasyonlu mononükleozomlar4,5,6üzerindeki aktivitesini incelemek için kullanılmıştır. Burada asetillenmiş histonları ifade etmek ve asetillenmiş nükleozomları yeniden inşa etmek için bu yöntemi detaylandırıyoruz.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.5 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>1 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>100x TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>2 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>20 mM TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>6 M GuHCl</td>
			<td></td>
			<td></td>
			<td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>Acetyllysine</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Column Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisherbrand&#160;Variable-Flow Chemical Transfer Pump</td>
			<td>Fischer Scientific</td>
			<td>15-077-67</td>
			<td></td>
		</tr>
		<tr>
			<td>His-TEV protease</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Histone Lysis Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td>
		</tr>
		<tr>
			<td>Ni-NTA Resin</td>
			<td></td>
			<td></td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td>
		</tr>
		<tr>
			<td>PCR Clean-Up Kit</td>
			<td>Epoch Life Sicences</td>
			<td>2360050</td>
			<td></td>
		</tr>
		<tr>
			<td>Pellet Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>petDUET-His-SUMO-TEV-H4</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2A</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2B</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pEVOL-AckRS</td>
			<td>Addgene</td>
			<td>137976</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-3z/601</td>
			<td>Addgene</td>
			<td>26656</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

Asetillenmiş histone proteinleri, bir mutant kodlayan Escherichia coli'de kolayca ifade edilebilir, Nε-asetil-lizin (AcK)-spesifik Methanosarcina mazi pirrolysine tRNA-synthetase (MmAcKRS1) ve onun konyak tRNA (tRNAPyl)siteye özgü asetillenmiş histonları ile yeniden inşa mononükleozomları birleştirmek için. MmAcKRS1 ve tRNAPyl, Escherichia coli'deçeviri sırasında tercih ettiği mRNA'daki bir kehribar mutasyon bölgesinde AcK sağlar. Bu teknik, H3 lizin sahalarında ACK'yı dahil etmek için yaygın olarak kullanılmıştır. Pyrrolysyl-tRNA sentezi (PylRS) ayrıca bölgeye özgü protein modifikasyonu veya fonksiyonelleştirme için diğer nonkanonik amino asitleri (ncAA'lar) içerecek şekilde kolayca geliştirilebilir. Burada MmAcKRS1 sistemini kullanarak AcK'yı histone H3'e dahil etmek ve asetillenmiş H3 proteinlerini yeniden inşa edilmiş mononükleozomlara entegre etmek için bir yöntem detaylandırıyoruz. Asetillenmiş yeniden inşa edilmiş mononükleozomlar biyokimyasal ve bağlayıcı tahlillerde, yapı belirlemede ve daha fazlasında kullanılabilir. Modifiye mononükleozomların elde edilmesi, yeni etkileşimler keşfetmek ve epigenetiği anlamakla ilgili deneyler tasarlamak için çok önemlidir.

Dimerler, tetramerler ve oktavlar% 12 SDS PAGE jeli (Şekil 1 ve Şekil 2)çalıştırılarak değerlendirilebilir. Burada, bazı asetilasyonlu tetramerlerin diğerlerinden daha düşük verime sahip olduğunu görebilirsiniz (Şekil 1). Aslında, çekirdek bölgeye ne kadar yakınsa, verim o kadar düşük gözlenir. Bu büyük olasılıkla, tetramer montajına müdahale eden asetilasyondan kaynakla...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Burada, genetik kod genişlemesini kullanarak asetillenmiş histone proteinlerini ifade etmek ve yeniden inşa edilmiş nükleozomları in vitro olarak birleştirmek için bir yöntem sunuyoruz.

Escherichia coli'de Genetik Kod Genişlemesi Kullanılarak Nükleozom Rekonses için Histonların Siteye Özgü Lizin Asetilasyonu

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K Görüntüleme.  Texas A&M University. Burada, genetik kod genişlemesini kullanarak asetillenmiş histone proteinlerini ifade etmek ve yeniden inşa edilmiş nükleozomları in vitro olarak birleştirmek için bir yöntem sunuyoruz.

Video: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique applications for OMV where traditional nanoparticles are proving too difficult to synthesize. To date, all Gram-negative bacteria have been shown to produce OMV demonstrating packaging of a variety of cargo that includes small molecules, peptides, proteins and genetic material. Based on their diverse cargo, OMV are implicated in many biological processes ranging from cell-cell communication to gene transfer and delivery of virulence factors depending upon which bacteria are producing the OMV. Only recently have bacterial OMV become accessible for use across a wide range of applications through the development of techniques to control and direct packaging of recombinant proteins into OMV. This protocol describes a method for the production, purification, and use of enzyme packaged OMV providing for improved overall production of recombinant enzyme, increased vesiculation, and enhanced enzyme stability. Successful utilization of this protocol will result in the creation of a bacterial strain that simultaneously produces a recombinant protein and directs it for OMV encapsulation through creating a synthetic linkage between the recombinant protein and an outer membrane anchor protein. This protocol also details methods for isolating OMV from bacterial cultures as well as proper handling techniques and things to consider when adapting this protocol for use for other unique applications such as: pharmaceutical drug delivery, medical diagnostics, and environmental remediation.

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

A protocol for the production, purification, and use of enzyme packaged outer membrane vesicles (OMV) providing for enhanced enzyme stability for implementation across diverse applications is presented.

Outer zar vezikülleri içinde Yönetmen Protein Paketleme<em&gt; Escherichia coli</em&gt;: Tasarım, Üretim ve Arıtma

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique ...

Biyokimya

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many of these conditions cause protein unfolding in the cell and have detrimental impact on the survival of the organism. A group of unrelated, stress-specific molecular chaperones have been shown to play essential roles in the survival of these stress conditions. While fully folded and chaperone-inactive before stress, these proteins rapidly unfold and become chaperone-active under specific stress conditions. Once activated, these conditionally disordered chaperones bind to a large number of different aggregation-prone proteins, prevent their aggregation and either directly or indirectly facilitate protein refolding upon return to non-stress conditions. The primary approach for gaining a more detailed understanding about the mechanism of their activation and client recognition involves the purification and subsequent characterization of these proteins using in vitro chaperone assays. Follow-up in vivo stress assays are absolutely essential to independently confirm the obtained in vitro results.
This protocol describes in vitro and in vivo methods to characterize the chaperone activity of E. coli HdeB, an acid-activated chaperone. Light scattering measurements were used as a convenient read-out for HdeB&#39;s capacity to prevent acid-induced aggregation of an established model client protein, MDH, in vitro. Analytical ultracentrifugation experiments were applied to reveal complex formation between HdeB and its client protein LDH, to shed light into the fate of client proteins upon their return to non-stress conditions. Enzymatic activity assays of the client proteins were conducted to monitor the effects of HdeB on pH-induced client inactivation and reactivation. Finally, survival studies were used to monitor the influence of HdeB&#39;s chaperone function in vivo.

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

This study describes biophysical, biochemical and molecular techniques to characterize the chaperone activity of Escherichia coli HdeB under acidic pH conditions. These methods have been successfully applied for other acid-protective chaperones such as HdeA and can be modified to work for other chaperones and stress conditions.

pH bağımlı aktivitenin tespiti<em&gt; Escherichia coli</em&gt; Chaperone HdeB<em&gt; İn Vitro</em&gt; ve<em&gt; İn Vivo</em

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many ...

Efficient and Site-specific Antibody Labeling by Strain-promoted Azide-alkyne Cycloaddition

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is protein conjugation by genetically introducing an unnatural amino acid containing a bioorthogonal functional group. This report describes a detailed protocol for site-specific antibody conjugation. The protocol includes experimental details for the genetic incorporation of an azide-containing amino acid, and the conjugation reaction by strain-promoted azide-alkyne cycloaddition (SPAAC). This strain-promoted reaction proceeds by simple mixing of the reacting molecules at physiological pH and temperature, and does not require additional reagents such as copper(I) ions and copper-chelating ligands. Therefore, this method would be useful for general protein conjugation and development of antibody drug conjugates (ADCs).

Here, we present a protocol to site-specifically introduce chemical probes into an antibody fragment by genetically incorporating an azide-containing amino acid, and subsequently coupling the azide with a chemical probe by strain-promoted azide-alkyne cycloaddition (SPAAC).

Verimli ve Siteye özgü Gerilme-terfi Azid-alkin Siklokatılma tarafından Antikor Etiketleme

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is ...

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

Farklı Olarak izotopla işaretli Kardeş histonlarla nükleozomlann Sulandırma

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. The relative levels of different tRNAs, and the ratio of aminoacylated tRNA to total tRNA, known as the charging level, are important factors in determining the accuracy and speed of translation. Therefore, the abundance and charging levels of tRNAs are important variables to measure when studying protein synthesis, for example under various stress conditions. Here, we describe a method for harvesting tRNA and directly measuring both the relative abundance and the absolute charging level of specific tRNA species in Escherichia coli. The tRNA is harvested in such a way that the labile bond between the tRNA and its amino acid is preserved. The RNA is then subjected to gel electrophoresis and Northern blotting, which results in separation of the charged and uncharged tRNAs. The levels of specific tRNAs in different samples can be compared due to the addition of spike-in cells for normalization. Prior to RNA purification, we add 5% of E. coli cells that overproduce the rare tRNAselC to each sample. The amount of the tRNA species of interest in a sample is then normalized to the amount of tRNAselC in the same sample. Addition of spike-in cells prior to RNA purification has the advantage over addition of purified spike-in RNAs that it also accounts for any differences in cell lysis efficiency between samples.

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Here we present a method for directly measuring transfer RNA charging levels from purified Escherichia coli RNA as well as a way to compare relative levels of transfer RNA, or any other short RNA, across different samples based on the addition of spike-in cells expressing a reference gene.

Miktar bolluk ve Escherichia coli olarak Transfer RNA'ların düzeyde şarj

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. ...

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts of recombinant RNAs are limited. Here, we describe a protocol to produce large amounts of recombinant RNA in Escherichia coli based on co-expression of a chimeric molecule that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. Viroids are relatively small, non-coding, highly base-paired circular RNAs that are infectious to higher plants. The host plant tRNA ligase is an enzyme recruited by viroids that belong to the family Avsunviroidae, such as Eggplant latent viroid (ELVd), to mediate RNA circularization during viroid replication. Although ELVd does not replicate in E. coli, an ELVd precursor is efficiently transcribed by the E. coli RNA polymerase and processed by the embedded hammerhead ribozymes in bacterial cells, and the resulting monomers are circularized by the co-expressed tRNA ligase reaching a remarkable concentration. The insertion of an RNA of interest into the ELVd scaffold enables the production of tens of milligrams of the recombinant RNA per liter of bacterial culture in regular laboratory conditions. A main fraction of the RNA product is circular, a feature that facilitates the purification of the recombinant RNA to virtual homogeneity. In this protocol, a complementary DNA (cDNA) corresponding to the RNA of interest is inserted in a particular position of the ELVd cDNA in an expression plasmid that is used, along the plasmid to co-express eggplant tRNA ligase, to transform E. coli. Co-expression of both molecules under the control of strong constitutive promoters leads to production of large amounts of the recombinant RNA. The recombinant RNA can be extracted from the bacterial cells and separated from the bulk of bacterial RNAs taking advantage of its circularity.

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

Here, we present a protocol to produce large amounts of recombinant RNA in Escherichia coli by co-expressing a chimeric RNA that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. The main product is a circular molecule that facilitates purification to homogeneity.

Escherichia coli içinde Viroid kaynaklı bir sistemi kullanarak dairesel bir iskele üzerinde rekombinant RNA'ların büyük ölçekli üretim

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts ...

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic acid (sRNA) molecules and target messenger RNAs (mRNAs). In addition, site-directed mutagenesis is used to map specific protein binding sites to RNA. A 2-step and 3-step PCR based introduction of mutations is described. The approach is relevant to all protein-RNA and RNA-RNA interaction studies. In short, the technique relies on designing primers with the desired mutation(s), and through 2 or 3 steps of PCR synthesizing a PCR product with the mutation. The PCR product is then used for cloning. Here, we describe how to perform site-directed mutagenesis with both the 2- and 3-step approach to introduce mutations to the sRNA, McaS, and the mRNA, csgD, to investigate RNA-RNA and RNA-protein interactions. We apply this technique to investigate RNA interactions; however, the technique is applicable to all mutagenesis studies (e.g., DNA-protein interactions, amino-acid substitution/deletion/addition). It is possible to introduce any kind of mutation except for non-natural bases but the technique is only applicable if a PCR product can be used for downstream application (e.g., cloning and template for further PCR).

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in deoxyribonucleic acid (DNA). This protocol describes how to do site-directed mutagenesis with a 2-step and 3-step polymerase chain reaction (PCR) based approach, which is applicable to any DNA fragment of interest.

Site yönettiği Mutagenesis in Vitro ve Escherichia Coli etkileşimlerde RNA ile örneği Vivo deneyler için

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic ...

In Vitro Ubiquitination and Deubiquitination Assays of Nucleosomal Histones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination of chromatin function and DNA-associated processes. This modification involves a sequential action of several enzymes including E1 ubiquitin-activating, E2 ubiquitin-conjugating and E3 ubiquitin-ligase and is reversed by deubiquitinases (DUBs). Ubiquitination induces degradation of proteins or alteration of protein function including modulation of enzymatic activity, protein-protein interaction and subcellular localization. A critical step in demonstrating protein ubiquitination or deubiquitination is to perform in vitro reactions with purified components. Effective ubiquitination and deubiquitination reactions could be greatly impacted by the different components used, enzyme co-factors, buffer conditions, and the nature of the substrate.&#160; Here, we provide step-by-step protocols for conducting ubiquitination and deubiquitination reactions. We illustrate these reactions using minimal components of the mouse Polycomb Repressive Complex 1 (PRC1), BMI1, and RING1B, an E3 ubiquitin ligase that monoubiquitinates histone H2A on lysine 119. Deubiquitination of nucleosomal H2A is performed using a minimal Polycomb Repressive Deubiquitinase (PR-DUB) complex formed by the human deubiquitinase BAP1 and the DEUBiquitinase ADaptor (DEUBAD) domain of its co-factor ASXL2. These ubiquitination/deubiquitination assays can be conducted in the context of either recombinant nucleosomes reconstituted with bacteria-purified proteins or native nucleosomes purified from mammalian cells. We highlight the intricacies that can have a significant impact on these reactions and we propose that the general principles of these protocols can be swiftly adapted to other E3 ubiquitin ligases and deubiquitinases.

Ubiquitination is a post-translational modification that plays important roles in cellular processes and is tightly coordinated by deubiquitination. Defects in both reactions underlie human pathologies. We provide protocols for conducting ubiquitination and deubiquitination reaction in vitro using purified components.

Nükliosomal Histones in vitro Ubiquitination ve Deubiquitination bulguları

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination ...

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein aggregation. The accumulation of protein aggregates in bacterial cells can lead to significant alterations in the cellular phenotypic behavior, including a reduction in growth rates, stress resistance, and virulence. Several experimental procedures exist for the examination of these stressor-mediated phenotypes. This paper describes an optimized assay for the extraction and visualization of aggregated and soluble proteins from different Escherichia coli strains after treatment with a silver-ruthenium-containing antimicrobial. This compound is known to generate reactive oxygen species and causes widespread protein aggregation. 
The method combines a centrifugation-based separation of protein aggregates and soluble proteins from treated and untreated cells with subsequent separation and visualization by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie staining. This approach is simple, fast, and allows a qualitative comparison of protein aggregate formation in different E. coli strains. The methodology has a wide range of applications, including the possibility to investigate the impact of other proteotoxic antimicrobials on in vivo protein aggregation in a wide range of bacteria. Moreover, the protocol can be used to identify genes that contribute to increased resistance to proteotoxic substances. Gel bands can be used for the subsequent identification of proteins that are particularly prone to aggregation.

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

This protocol describes the extraction and visualization of aggregated and soluble proteins from Escherichia coli after treatment with a proteotoxic antimicrobial. Following this procedure allows a qualitative comparison of protein aggregate formation in vivo in different bacterial strains and/or between treatments.

Proteotoksik Stresör ile Escherichia coli Tedavisinden Sonra Protein Agregalarının Ekstraksiyonu ve Görselleştirilmesi

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

Pulldown Testi, Zorlu Protein-Protein Etkileşimlerini Test Etmek İçin Zaman Verimli Bir Araç Olarak Bakteri Hücrelerinde Ko-Ekspresyon ile Birleştiğinde

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...