Gostaríamos de agradecer ao Dr. Wesley Wang por estabelecer as bases para este protocolo e sua valiosa mentoria. Este trabalho foi parcialmente apoiado pelos Institutos Nacionais de Saúde (Grants R01GM127575 e R01GM121584) e pela Welch Foundation (Grant A-1715).

1. Construção plasmid
<ol><li>Comece decidindo qual proteína de histona será acetilada e em qual sítio de lise. Mutação do site para o codon de parada âmbar (TAG) usando mutagênese direcionada ao site. NOTA: Existem quatro plasmídeos previamente projetados utilizados para a expressão de proteínas histonas. Todas as quatro proteínas histonas foram clonadas no vetor pETDuet-1 com uma etiqueta de histidina n-terminal. Histone H4 também inclui uma tag SUMO, a origem do colE1 de replicação com um número de cópia de aproximadamente 40, resistente à ampicilina, e um promotor T7.<ol>
<li>Projete primers para frente e reverso que contenham uma mutação TAG no local desejado (substituindo um codon de lysina existente pelo codon de parada âmbar) em um dos quatro plasmídeos de proteína histona.</li>
		<li>Use PCR de plasmídeo inteiro para amplificar o TAG contendo plasmídeo. Determine uma temperatura de ressarcial apropriada para os primers. Em geral, a temperatura de fusão (Tm)dos primers menos 5 °C será suficiente. Se houver dificuldade para obter um produto PCR, um gradiente de temperatura em torno de Tm - 5 °C pode ser usado para otimizar a temperatura de ressarcimento para amplificação. NOTA: Neste experimento foi utilizada uma polimerase pfu expressa internamente para 30 ciclos com as seguintes condições: 94 °C para 30 s (desinaturação), temperatura de ressarcial para 30 s e 72 °C para 6 min (ou 1 min por quilobase-pares). Para obter mais detalhes sobre este tipo de método PCR, consulte Liu e Naismith7.</li>
		<li>Limpe o produto PCR com um kit de limpeza PCR seguindo o protocolo do fabricante. Analise o produto PCR por eletroforese de gel agarose e posterior coloração de brometo de ethidium.</li>
		<li>Liga o plasmídeo incubando com liga ligase T4 durante a noite a 16 °C.</li>
	</ol>
</li>
	<li>Primeiro transforme a TAG contendo plasmídeo (AmpR)em Escherichia coliquimicamente competente . Escolha um mínimo de 4 colônias da transformação e purifique o plasmídeo. Faça estoques de células de cada um com glicerol usando métodos padrão e armazene a -80 °C. Envie para sequenciamento para confirmar a mutação TAG desejada.</li>
	<li>Uma vez confirmada a sequência, co-transforme o plasmídeo contendo TAG (AmpR) com pEVOL-AckRS (ChlR) em CobB quimicamente competente (a única deacetylase histone lysine conhecida em células BL21 de E. coli.) usando o método de choque térmico. pEVOL é um plasmid com um número de cópia média para baixo número de cópia p15A de origem. NOTA: A série pEVOL de plasmídeos foi construída com base em estudos anteriores que mostraram uma expressão aumentada do par ortogonal aaRS/tRNATyr foi eficaz na diminuição da truncação proteica e no aumento do rendimento global das proteínas mutantes8. Se as células de exclusão de CobB não estiverem acessíveis, proceda com células BL21 quimicamente competentes. CobB é uma deacetilase de histonina de histonina e nicotinamida semelhante a histuina sirtuina e nicotinamida pode ser adicionada a uma concentração final de 5 mM durante a expressão da proteína histona para inibir o CobB como uma abordagem alternativa9.</li>
	<li>Faça um estoque de celular e armazene a -80 °C.</li>
</ol>2. Expressão de proteína histona acetilada
<ol><li>Prepare 1 L de mídia 2YT autoclaved (ou volume de escolha) em um frasco de cultura.</li>
	<li>Inocular 20 mL de mídia 2YT contendo os antibióticos apropriados com o estoque de células co-transformadas que tem o plasmídeo contendo TAG (AmpR) e pEVOL-AckRS (ChlR) e crescer a 37 °C a OD = 0,6 (4-6 h).</li>
	<li>Adicione os antibióticos apropriados ao 1 L de mídia 2YT autoclaved e inoculada com a cultura inicial de 20 mL. Cresça a 37 °C a OD = 0,6-0,8 (2-3 h).</li>
	<li>Adicione agentes indutores e acetilizesina (AcK) às concentrações finais de IPTG 1 mM, 0,2% arabinose e AcK 5 mM.</li>
	<li>Cresça a cultura a 37 °C para 6-8 h.</li>
	<li>Células de pelota a 2.700 x g por 15 min.</li>
	<li>Armazene a pelota da célula a -80 °C durante a noite.</li>
	<li>A partir deste passo em diante mantenha a amostra no gelo o tempo todo. Dissolva a pelota celular em 50 mL de tampão de histona por 1 L de cultura.</li>
	<li>Sonicate de acordo com o seguinte ciclo: 1 s on, 1 s off, total at time: 3 min a 60% de amplitude.</li>
	<li>Corpos de inclusão de pelotas a 41.600 x g por 45 min.</li>
	<li>Descarte os corpos de inclusão de supernasciente e resuspend em 30 mL de tampão de histona. A inclusão de pelotas é de 41.600 x g por 30 min.</li>
	<li>Descarte os corpos de inclusão supernasce e resuspend em 30 mL de tampão de lavagem de pelotas. Corpos de inclusão de pelotas a 41.600 x g por 30 min.</li>
	<li>Descarte os corpos de inclusão supernasce e dissolvido em 25 mL de 6 M Guanidine Hydrochloride (GuHCl). Incubar com agitação a 37 °C por 1h. NOTA: Se necessário, os corpos de inclusão podem ser incubados com agitação durante a noite a 4 °C.</li>
	<li>A inclusão de pelotas é de 41.600 x g por 45 min. Incubar o supernaente com 1 mL de resina Ni-NTA equilibrada com tampão guhcl de 6 M por 2 h.</li>
	<li>Prossiga com a purificação ni-NTA em condições desnaturadas. Lave a coluna com 3 volumes de coluna de tampão de lavagem de coluna. Elute acetilou proteína histona com 10 mL de tampão de eluição. NOTA: Tentar concentrar a proteína aqui é uma opção, mas histones acetilados são muito imprevisíveis e podem facilmente precipitar. Não é recomendável concentrar-se além de 2 mL em volume total.</li>
	<li>Digele extensivamente a proteína histona acetilada contra 5% de tampão de ácido acético para remover sais. Dialisar por 3h de cada vez a 4 °C, trocando por tampão fresco mínima de 6 vezes. NOTA: Para uma melhor pureza proteica, há a opção de diálise contra água pura. No entanto, isso causa precipitação significativa e redução no rendimento que pode ser indesejável para proteínas histonas acetiladas de baixo rendimento.</li>
	<li>Aliquot e proteína liofilizada, e armazenar indefinidamente a -80 °C. As proteínas histonas do tipo selvagem geralmente produzem 10-50 mg/L, enquanto as proteínas de histona acetiladas produzem menos de 10 mg/L, dependendo do local específico da lise. Por exemplo, H3K79Ac tem uma média de 5 mg/L.</li>
</ol>3. Expressão de proteína histona tipo selvagem
<ol><li>Para montar nucleossomos completos, expresse todas as 4 proteínas histonas. Ao expressar e purificar histones do tipo selvagem, o protocolo é o mesmo que as histonas acetiladas, exceto as seguintes:<ol>
<li>Não realize a co-transformação. Não use pEVOL-AcKRS para expressão histona tipo selvagem. Ajuste os antibióticos de acordo.</li>
		<li>Não use uma linha celular de exclusão de CobB ou adicione nicotinamida, AcK ou arabinose durante a indução da expressão celular.</li>
	</ol>
</li>
</ol>4. Preparação de 601 DNA
NOTA: Uma sequência de DNA otimizada previamente projetada para o posicionamento nucleossomo direto é montada com octamers de histona para produzir mononucleossomo com alta eficiência. Esta sequência é referida como 601 DNA ou a sequência de Widom. Esta sequência tornou-se a sequência padrão de DNA para estudos in vitro de nucleososos desde ensaios de remodelação de cromatina até medições de molécula única10.
<ol><li>Para preparar quantidades significativas de DNA 601 para montagem nucleosômica, transforme pGEM-3z/601 em células Top 10 e cresça 10 mL de cultura para amplificação e extração plasmóides. Use um kit de extração de plasmídeos e siga a recomendação do fabricante.</li>
	<li>Use uma polimerase PFU expressa internamente (mais eficiente) para este protocolo de amplificação. Configure uma reação pcr: Para uma reação de 250 μL, use 207,5 μL autoclaved MQ H2O, 25 μL 10x PFU Buffer, 5 μL Forward Primer: ctggagaatcccggtgccgg, 5 μL Reverse Primer: acaggatgtatatctgacacg, 5 μL dNTP mix, 2.5 μL PFU enzima. Normalmente corremos 60 reações de uma vez para obter DNA suficiente para montar.</li>
	<li>Use uma temperatura de ressarção de 52 °C para 30 s e um tempo de extensão de 30 s se usar polimerase PFU. Caso contrário, siga as condições recomendadas pelos fabricantes.</li>
	<li>Uma vez feito o PCR, use um kit de limpeza PCR para purificar o produto PCR.</li>
</ol>5. Montagem de histone octamer
<ol><li>Dissolva alíquotas de pelotas de proteína histona H2A, H2B, H3 e H4 para que haja um estoque separado de cada proteína histona em Tampão guhcl com um volume total de 100 μL.</li>
	<li>Calcule a concentração de cada proteína histona medindo a absorvância A280.</li>
	<li>Se a absorvância for maior que 1 para qualquer proteína, dilui com o tampão guhcl para obter uma concentração mais precisa.</li>
	<li>Combine proteínas H2A e H2B em uma razão molar de 1:1 e dilua para uma concentração proteica total de 4 μg/μL. Repita para H3 e H4.</li>
	<li>Dialyze sequencialmente a 4 °C contra 2 M TE tampão durante a noite, 1 M TE tampão por 2 h e 0,5 M TE tampão por 5 h. NOTA: O segundo e terceiro passos da diálise faz com que as conformações instáveis de proteínas precipitam. Espera-se que haja precipitação pesada nestas etapas.</li>
	<li>Remova precipitados por centrifugação a 16.800 x g a 4 °C.</li>
	<li>Novamente, calcule a concentração de dimers de histona (mistura H2A/H2B) e tetramers (mistura H3/H4) medindo a absorvância A280.</li>
	<li>Misture dimers e tetramers em uma relação molar de 1:1 e ajuste NaCl para 2 M pela adição de NaCl sólido.</li>
	<li>O octamer histona pode ser armazenado a 4 °C e é mais estável do que os dimers e tetramers. Nunca congele a octamer de histona, pois isso pode causar desmontagem.</li>
	<li>Se montar com histones acetilados, basta substituir a proteína do tipo selvagem pela proteína acetilada no procedimento.</li>
</ol>6. Montagem nucleossomo
<ol><li>Use tampão 100x TE e NaCl sólido para ajustar 601 DNA ao buffer te de 2M. Adicione o DNA 601 em tampão 2M TE ao octamer histona em uma razão molar de 0,85:1 a 0,90:1. Uma menor proporção de DNA pode ser adicionada se o DNA livre estiver presente na análise de mudança de gel.</li>
	<li>Transfira a mistura DNA-histona de um saco de diálise e coloque em cerca de 200 mL de tampão de 2M TE (ou mais se montar várias amostras) e mexa suavemente a 4 °C.</li>
	<li>Ajuste uma bomba peristáltica para limpar para gotejar lentamente sem tampão de TE de sal. Quando o volume tiver aproximadamente dobrado, despeje metade do volume. Faça isso pelo menos 4 vezes no total. Com uma bomba, pode levar de 4 a 8 h, dependendo do volume inicial. Os nucleosmos formam-se quando a concentração de sal é reduzida para 150 mM (medida pelo medidor de salinidade).</li>
	<li>Após a concentração de sal ser reduzida para 150 mM, dilíque contra um buffer TE de 20 mM durante a noite.</li>
	<li>Remova precipitados por centrifugação e meça a concentração dos nucleosmos por uma leitura260 usando um leitor de placas.</li>
	<li>Adicione protease His-TEV (TEV: nucleossomo 1:30, w:w ) e incubar durante a noite a 4 °C para remover todas as tags de histidina. Remova as impurezas da tag histidina da solução nucleossom pela resina Ni-NTA puxada para baixo.</li>
	<li>Para posicionar o nucleossomo e homogeneizar a amostra, incubar a 60 °C por 1h. NOTA: Para locais acetilados que são particularmente instáveis, esta etapa pode não ser aconselhável.</li>
	<li>Armazene nucleososomos por curto prazo (algumas semanas) a 4 °C.</li>
	<li>Para armazenamento a longo prazo, dilyze nucleossomos contra buffer de armazenamento e armazene a -80 °C.</li>
</ol>

<ol>
	<li>Srinivasan, G., James, C. M., Krzycki, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysine+encoded+by+UAG+in+Archaea:+Charging+of+a+UAG-Decoding+specialized+tRNA.">Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-Decoding specialized tRNA.</a> Science. 296 (5572), 1459-1462 (2002).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochimica Et Biophysica Acta. 1844 (6), 1059-1070 (2014).</li><li>Umehara, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-Acetyl+lysyl-tRNA+synthetases+evolved+by+a+CcdB-based+selection+possess+N-acetyl+lysine+specificity+in+vitro+and+in+vivo.">N-Acetyl lysyl-tRNA synthetases evolved by a CcdB-based selection possess N-acetyl lysine specificity in vitro and in vivo.</a> FEBS Letters. 586 (6), 729-733 (2012).</li><li>Hsu, W. W., Wu, B., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sirtuins+1+and+2+are+universal+histone+deacetylases.">Sirtuins 1 and 2 are universal histone deacetylases.</a> ACS Chemical Biology. 11 (3), 792-799 (2016).</li><li>Wang, W. W., Zeng, Y., Wu, B., Deiters, A., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chemical+biology+approach+to+reveal+Sirt6-targeted+histone+H3+sites+in+nucleosomes.">A chemical biology approach to reveal Sirt6-targeted histone H3 sites in nucleosomes.</a> ACS Chemical Biology. 11 (7), 1973-1981 (2016).</li><li>Wang, W. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+click+chemistry+approach+reveals+the+chromatin-dependent+histone+H3K36+deacylase+nature+of+SIRT7.">A click chemistry approach reveals the chromatin-dependent histone H3K36 deacylase nature of SIRT7.</a> Journal of the American Chemical Society. 141 (6), 2462-2473 (2019).</li><li>Liu, H., Naismith, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+one-step+site-directed+deletion,+insertion,+single+and+multiple-site+plasmid+mutagenesis+protocol.">An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol.</a> BMC Biotechnology. 8 (1), 91 (2008).</li><li>Young, T. S., Ahmad, I., Yin, J. A., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+enhanced+system+for+unnatural+amino+acid+mutagenesis+in+E.+coli.">An enhanced system for unnatural amino acid mutagenesis in E. coli.</a> Journal of Molecular Biology. 395 (2), 361-374 (2010).</li><li>Gallego-Jara, J., &#201;cija Conesa, A., de Diego Puente, T., Lozano Terol, G., C&#225;novas D&#237;az, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+CobB+kinetics+and+inhibition+by+nicotinamide.">Characterization of CobB kinetics and inhibition by nicotinamide.</a> PLoS One. 12 (12), 0189689 (2017).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> Journal of Molecular Biology. 276 (1), 19-42 (1998).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+tight+nuclear+tethering+and+inactivation+of+cGAS.">The molecular basis of tight nuclear tethering and inactivation of cGAS.</a> Nature. 587 (7835), 673-677 (2020).</li><li>Burdette, D. L., Vance, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING+and+the+innate+immune+response+to+nucleic+acids+in+the+cytosol.">STING and the innate immune response to nucleic acids in the cytosol.</a> Nature Immunology. 14 (1), 19-26 (2013).</li><li>Barber, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+DNA+sensing+pathways:+STING,+AIMII+and+the+regulation+of+interferon+production+and+inflammatory+responses.">Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses.</a> Current Opinion in Immunology. 23 (1), 10-20 (2011).</li><li>Ablasser, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cGAS+produces+a+2'-5'-linked+cyclic+dinucleotide+second+messenger+that+activates+STING.">cGAS produces a 2'-5'-linked cyclic dinucleotide second messenger that activates STING.</a> Nature. 498 (7454), 380-384 (2013).</li><li>Gao, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+[G(2',5')pA(3',5')p]+is+the+metazoan+second+messenger+produced+by+DNA-activated+cyclic+GMP-AMP+synthase.">Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.</a> Cell. 153 (5), 1094-1107 (2013).</li><li>Zhao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conserved+PLPLRT/SD+motif+of+STING+mediates+the+recruitment+and+activation+of+TBK1.">A conserved PLPLRT/SD motif of STING mediates the recruitment and activation of TBK1.</a> Nature. 569 (7758), 718-722 (2019).</li></ol>

Não há interesses financeiros concorrentes para declarar por nenhum dos autores.

É essencial seguir este protocolo em cada detalhe durante um experimento. Os nucleosmos não são muito estáveis e muita tentativa e erro foi para determinar este protocolo. É fundamental remover precipitados a cada passo (ou sempre observado) porque as partículas podem interferir facilmente nos processos de montagem. Sempre mantenha amostras de histona no gelo. Se os nucleosómos são armazenados a 4 °C por muito tempo, eles podem desmontar espontaneamente. Certifique-se de verificar quaisquer amostras por Native P...

Utilizamos PylRS e tRNAPyl para sintetizar e montar mononucleosmos reconstituídos com histones acetilados específicos do local. A PylRS provou ser inestimável como uma ferramenta de expansão de código genético para produzir proteínas com modificações pós-translacionais (PTMs) e foi geneticamente evoluída para incorporar cerca de 200 ncAAs diferentes. PylRS incorpora em um códon de parada âmbar, removendo a concorrência de outros aminoácidos durante a tradução. PylRS foi descoberto pela primeira vez na arquiaia metogênica, e desde então tem sido utilizado em biologia química para incorporar novos grupos químicos reativos em proteínas1,2.
O MMAcKRS1 foi evoluído de Metanoosarcina mazei PylRS e frequentemente utilizado em nosso laboratório para a síntese de proteínas acetiladas3,4,5,6. MmAcKRS1 fornece AcK em um local de mutação âmbar no mRNA de escolha durante a tradução em Escherichia coli. Esta técnica foi usada anteriormente para incorporar ack em k4, K9, K14, K18, K23, K27, K36, K56, K64, e K79 histone H3 lysine sites para estudar a atividade de Sirtuin 1, 2, 6, e 7 em mononucleosmos acetilados4,5,6. Aqui detalhamos este método para expressar histones acetilados e nucleosómos acetilados reconstituídos.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>0.5 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>0.5 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>1 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>1 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>100x TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>2 M TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>2 M NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>20 mM TE Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 1 mM EDTA, pH 7.8</td>
		</tr>
		<tr>
			<td>6 M GuHCl</td>
			<td></td>
			<td></td>
			<td>6M guanidinium chloride, 20 mM Tris, 500 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>Acetyllysine</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Column Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 20 mM imidazole pH 7.8</td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisherbrand&#160;Variable-Flow Chemical Transfer Pump</td>
			<td>Fischer Scientific</td>
			<td>15-077-67</td>
			<td></td>
		</tr>
		<tr>
			<td>His-TEV protease</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Histone Lysis Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, 0.5% Triton-X100 (v/v), 1 mM PMSF pH 8.0</td>
		</tr>
		<tr>
			<td>Ni-NTA Resin</td>
			<td></td>
			<td></td>
			<td>6 M urea, 500 mM NaCl, 20 mM Tris, 250 mM imidazole, pH 7.8</td>
		</tr>
		<tr>
			<td>PCR Clean-Up Kit</td>
			<td>Epoch Life Sicences</td>
			<td>2360050</td>
			<td></td>
		</tr>
		<tr>
			<td>Pellet Wash Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>60 mM Tris, 100 mM NaCl, pH 8.0</td>
		</tr>
		<tr>
			<td>petDUET-His-SUMO-TEV-H4</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2A</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H2B</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>petDUET-His-TEV-H3</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pEVOL-AckRS</td>
			<td>Addgene</td>
			<td>137976</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-3z/601</td>
			<td>Addgene</td>
			<td>26656</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>20 mM NaCl, 20 mM Tris, 20 mM NaCl, 1 mM EDTA, 20% glycerol, pH 7.8</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

site specific lysine acetylation of histones for nucleosome reconstitution using genetic code expansion in escherichia coli

Proteínas histonas acetiladas podem ser facilmente expressas em Escherichia coli codificando um mutante, Nε-acetil-lysine (AcK)-específica Methanosarcina mazi pyrrolysine tRNA-synthetase (MmAcKRS1) e seu tRNA cognato (tRNAPyl) para reunir mononucleosmos estabelecidos com histones acetiladas específicas. MmAcKRS1 e tRNAPyl entregam AcK em um local de mutação âmbar no mRNA de escolha durante a tradução em Escherichia coli. Esta técnica tem sido usada extensivamente para incorporar AcK em locais de lise H3. A sithetase pirrolysíl-tRNA (PylRS) também pode ser facilmente evoluída para incorporar outros aminoácidos não-orônicos (ncAAs) para modificação ou funcionalização de proteínas específicas do local. Aqui detalhamos um método para incorporar o AcK usando o sistema MmAcKRS1 no histona H3 e integrar proteínas H3 acetiladas em mononucleosmos reconstituídos. Mononucleososes reconstituídos acetilados podem ser usados em ensaios bioquímicos e de ligação, determinação da estrutura e muito mais. A obtenção de mononucleosmos modificados é crucial para projetar experimentos relacionados à descoberta de novas interações e compreensão da epigenética.

Dimers, tetramers e octamers podem ser avaliados executando um gel de PÁGINA SDS de 12%(Figura 1 e Figura 2). Aqui você pode ver que alguns dos tetramers acetilados têm um rendimento menor do que outros(Figura 1). De fato, quanto mais perto da região central, menor o rendimento observado. Isso é mais provável devido à acetilação interferindo na montagem do tetramer quanto mais perto você ch...

Watch this Scientific Journal Video about Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli at JoVE.com

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Aqui apresentamos um método para expressar proteínas histonas acetiladas usando expansão de código genético e montar nucleososomos reconstituídos in vitro.

Site Lysine Acetilation specific de Histones para Reconstituição Nucleososome usando Expansão do Código Genético em Escherichia coli

Acetylated histone proteins can be easily expressed in Escherichia coli encoding a mutant, N&#949;-acetyl-lysine (AcK)-specific Methanosarcina mazi ...

site-specific-lysine-acetylation-histones-for-nucleosome

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Unit 1

Structure and Organization of DNA

SCIENTISTS IN ACTION

3.9K visualizações.  Texas A&M University. Aqui apresentamos um método para expressar proteínas histonas acetiladas usando expansão de código genético e montar nucleososomos reconstituídos in vitro.

Vídeo: Site Specific Lysine Acetylation of Histones for Nucleosome Reconstitution using Genetic Code Expansion in Escherichia coli

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique applications for OMV where traditional nanoparticles are proving too difficult to synthesize. To date, all Gram-negative bacteria have been shown to produce OMV demonstrating packaging of a variety of cargo that includes small molecules, peptides, proteins and genetic material. Based on their diverse cargo, OMV are implicated in many biological processes ranging from cell-cell communication to gene transfer and delivery of virulence factors depending upon which bacteria are producing the OMV. Only recently have bacterial OMV become accessible for use across a wide range of applications through the development of techniques to control and direct packaging of recombinant proteins into OMV. This protocol describes a method for the production, purification, and use of enzyme packaged OMV providing for improved overall production of recombinant enzyme, increased vesiculation, and enhanced enzyme stability. Successful utilization of this protocol will result in the creation of a bacterial strain that simultaneously produces a recombinant protein and directs it for OMV encapsulation through creating a synthetic linkage between the recombinant protein and an outer membrane anchor protein. This protocol also details methods for isolating OMV from bacterial cultures as well as proper handling techniques and things to consider when adapting this protocol for use for other unique applications such as: pharmaceutical drug delivery, medical diagnostics, and environmental remediation.

Directed Protein Packaging within Outer Membrane Vesicles from Escherichia coli: Design, Production and Purification

A protocol for the production, purification, and use of enzyme packaged outer membrane vesicles (OMV) providing for enhanced enzyme stability for implementation across diverse applications is presented.

Dirigido Embalagem Proteína da Membrana Externa no interior de vesículas<em&gt; Escherichia coli</em&gt;: Concepção, produção e purificação

An increasing interest in applying synthetic biology techniques to program outer membrane vesicles (OMV) are leading to some very interesting and unique ...

Bioquímica

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many of these conditions cause protein unfolding in the cell and have detrimental impact on the survival of the organism. A group of unrelated, stress-specific molecular chaperones have been shown to play essential roles in the survival of these stress conditions. While fully folded and chaperone-inactive before stress, these proteins rapidly unfold and become chaperone-active under specific stress conditions. Once activated, these conditionally disordered chaperones bind to a large number of different aggregation-prone proteins, prevent their aggregation and either directly or indirectly facilitate protein refolding upon return to non-stress conditions. The primary approach for gaining a more detailed understanding about the mechanism of their activation and client recognition involves the purification and subsequent characterization of these proteins using in vitro chaperone assays. Follow-up in vivo stress assays are absolutely essential to independently confirm the obtained in vitro results.
This protocol describes in vitro and in vivo methods to characterize the chaperone activity of E. coli HdeB, an acid-activated chaperone. Light scattering measurements were used as a convenient read-out for HdeB&#39;s capacity to prevent acid-induced aggregation of an established model client protein, MDH, in vitro. Analytical ultracentrifugation experiments were applied to reveal complex formation between HdeB and its client protein LDH, to shed light into the fate of client proteins upon their return to non-stress conditions. Enzymatic activity assays of the client proteins were conducted to monitor the effects of HdeB on pH-induced client inactivation and reactivation. Finally, survival studies were used to monitor the influence of HdeB&#39;s chaperone function in vivo.

Detection of the pH-dependent Activity of Escherichia coli Chaperone HdeB In Vitro and In Vivo

This study describes biophysical, biochemical and molecular techniques to characterize the chaperone activity of Escherichia coli HdeB under acidic pH conditions. These methods have been successfully applied for other acid-protective chaperones such as HdeA and can be modified to work for other chaperones and stress conditions.

Detecção da actividade de dependente do pH<em&gt; Escherichia coli</em&gt; Chaperone HdeB<em&gt; In Vitro</em&gt; e<em&gt; In Vivo</em

Bacteria are frequently exposed to environmental changes, such as alterations in pH, temperature, redox status, light exposure or mechanical force. Many ...

Efficient and Site-specific Antibody Labeling by Strain-promoted Azide-alkyne Cycloaddition

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is protein conjugation by genetically introducing an unnatural amino acid containing a bioorthogonal functional group. This report describes a detailed protocol for site-specific antibody conjugation. The protocol includes experimental details for the genetic incorporation of an azide-containing amino acid, and the conjugation reaction by strain-promoted azide-alkyne cycloaddition (SPAAC). This strain-promoted reaction proceeds by simple mixing of the reacting molecules at physiological pH and temperature, and does not require additional reagents such as copper(I) ions and copper-chelating ligands. Therefore, this method would be useful for general protein conjugation and development of antibody drug conjugates (ADCs).

Here, we present a protocol to site-specifically introduce chemical probes into an antibody fragment by genetically incorporating an azide-containing amino acid, and subsequently coupling the azide with a chemical probe by strain-promoted azide-alkyne cycloaddition (SPAAC).

Eficiente e Rotulagem de anticorpos por cicloadição Azide-alcino promoveu-Strain Site-specific

There are currently many chemical tools available to introduce chemical probes into proteins to study their structure and function. A useful method is ...

Reconstitution of Nucleosomes with Differentially Isotope-labeled Sister Histones

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications (PTMs). They are newly identified species with unknown means of establishment and functional implications. Current analytical methods are inadequate to detect the copy-specific occurrence of PTMs on the nucleosomal sister histones. This protocol presents a biochemical method for the in vitro reconstitution of nucleosomes containing differentially isotope-labeled sister histones. The generated complex can be also asymmetrically modified, after including a premodified histone pool during refolding of histone subcomplexes. These asymmetric nucleosome preparations can be readily reacted with histone-modifying enzymes to study modification cross-talk mechanisms imposed by the asymmetrically pre-incorporated PTM using nuclear magnetic resonance (NMR) spectroscopy. Particularly, the modification reactions in real-time can be mapped independently on the two sister histones by performing different types of NMR correlation experiments, tailored for the respective isotope type. This methodology provides the means to study crosstalk mechanisms that contribute to the formation and propagation of asymmetric PTM patterns on nucleosomal complexes.

This protocol describes the reconstitution of nucleosomes containing differentially isotope-labeled sister histones. At the same time, asymmetrically post-translationally modified nucleosomes can be generated after using a premodified histone copy. These preparations can be readily used to study modification crosstalk mechanisms, simultaneously on both sister histones, by using high-resolution NMR spectroscopy.

Reconstituição de Nucleosomes com Histones irmã diferencialmente Isotope-rotulados

Asymmetrically modified nucleosomes contain the two copies of a histone (sister histones) decorated with distinct sets of Post-translational Modifications ...

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. The relative levels of different tRNAs, and the ratio of aminoacylated tRNA to total tRNA, known as the charging level, are important factors in determining the accuracy and speed of translation. Therefore, the abundance and charging levels of tRNAs are important variables to measure when studying protein synthesis, for example under various stress conditions. Here, we describe a method for harvesting tRNA and directly measuring both the relative abundance and the absolute charging level of specific tRNA species in Escherichia coli. The tRNA is harvested in such a way that the labile bond between the tRNA and its amino acid is preserved. The RNA is then subjected to gel electrophoresis and Northern blotting, which results in separation of the charged and uncharged tRNAs. The levels of specific tRNAs in different samples can be compared due to the addition of spike-in cells for normalization. Prior to RNA purification, we add 5% of E. coli cells that overproduce the rare tRNAselC to each sample. The amount of the tRNA species of interest in a sample is then normalized to the amount of tRNAselC in the same sample. Addition of spike-in cells prior to RNA purification has the advantage over addition of purified spike-in RNAs that it also accounts for any differences in cell lysis efficiency between samples.

Quantification of the Abundance and Charging Levels of Transfer RNAs in Escherichia coli

Here we present a method for directly measuring transfer RNA charging levels from purified Escherichia coli RNA as well as a way to compare relative levels of transfer RNA, or any other short RNA, across different samples based on the addition of spike-in cells expressing a reference gene.

Quantificação de abundância e carregamento níveis de RNAs de transferência em Escherichia coli

Transfer RNA (tRNA) is an essential part of the translational machinery in any organism. tRNAs bind and transfer amino acids to the translating ribosome. ...

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts of recombinant RNAs are limited. Here, we describe a protocol to produce large amounts of recombinant RNA in Escherichia coli based on co-expression of a chimeric molecule that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. Viroids are relatively small, non-coding, highly base-paired circular RNAs that are infectious to higher plants. The host plant tRNA ligase is an enzyme recruited by viroids that belong to the family Avsunviroidae, such as Eggplant latent viroid (ELVd), to mediate RNA circularization during viroid replication. Although ELVd does not replicate in E. coli, an ELVd precursor is efficiently transcribed by the E. coli RNA polymerase and processed by the embedded hammerhead ribozymes in bacterial cells, and the resulting monomers are circularized by the co-expressed tRNA ligase reaching a remarkable concentration. The insertion of an RNA of interest into the ELVd scaffold enables the production of tens of milligrams of the recombinant RNA per liter of bacterial culture in regular laboratory conditions. A main fraction of the RNA product is circular, a feature that facilitates the purification of the recombinant RNA to virtual homogeneity. In this protocol, a complementary DNA (cDNA) corresponding to the RNA of interest is inserted in a particular position of the ELVd cDNA in an expression plasmid that is used, along the plasmid to co-express eggplant tRNA ligase, to transform E. coli. Co-expression of both molecules under the control of strong constitutive promoters leads to production of large amounts of the recombinant RNA. The recombinant RNA can be extracted from the bacterial cells and separated from the bulk of bacterial RNAs taking advantage of its circularity.

Large-scale Production of Recombinant RNAs on a Circular Scaffold Using a Viroid-derived System in Escherichia coli

Here, we present a protocol to produce large amounts of recombinant RNA in Escherichia coli by co-expressing a chimeric RNA that contains the RNA of interest in a viroid scaffold and a plant tRNA ligase. The main product is a circular molecule that facilitates purification to homogeneity.

Produção em grande escala de RNAs recombinantes em um andaime Circular usando um sistema derivado de Viroid em Escherichia coli

With increasing interest in RNA biology and the use of RNA molecules in sophisticated biotechnological applications, the methods to produce large amounts ...

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic acid (sRNA) molecules and target messenger RNAs (mRNAs). In addition, site-directed mutagenesis is used to map specific protein binding sites to RNA. A 2-step and 3-step PCR based introduction of mutations is described. The approach is relevant to all protein-RNA and RNA-RNA interaction studies. In short, the technique relies on designing primers with the desired mutation(s), and through 2 or 3 steps of PCR synthesizing a PCR product with the mutation. The PCR product is then used for cloning. Here, we describe how to perform site-directed mutagenesis with both the 2- and 3-step approach to introduce mutations to the sRNA, McaS, and the mRNA, csgD, to investigate RNA-RNA and RNA-protein interactions. We apply this technique to investigate RNA interactions; however, the technique is applicable to all mutagenesis studies (e.g., DNA-protein interactions, amino-acid substitution/deletion/addition). It is possible to introduce any kind of mutation except for non-natural bases but the technique is only applicable if a PCR product can be used for downstream application (e.g., cloning and template for further PCR).

Site-Directed Mutagenesis for In Vitro and In Vivo Experiments Exemplified with RNA Interactions in Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in deoxyribonucleic acid (DNA). This protocol describes how to do site-directed mutagenesis with a 2-step and 3-step polymerase chain reaction (PCR) based approach, which is applicable to any DNA fragment of interest.

Mutagenesis local-dirigido para In Vitro e In Vivo experimentos exemplificados com interações de RNA em Escherichia Coli

Site-directed mutagenesis is a technique used to introduce specific mutations in DNA to investigate the interaction between small non-coding ribonucleic ...

In Vitro Ubiquitination and Deubiquitination Assays of Nucleosomal Histones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination of chromatin function and DNA-associated processes. This modification involves a sequential action of several enzymes including E1 ubiquitin-activating, E2 ubiquitin-conjugating and E3 ubiquitin-ligase and is reversed by deubiquitinases (DUBs). Ubiquitination induces degradation of proteins or alteration of protein function including modulation of enzymatic activity, protein-protein interaction and subcellular localization. A critical step in demonstrating protein ubiquitination or deubiquitination is to perform in vitro reactions with purified components. Effective ubiquitination and deubiquitination reactions could be greatly impacted by the different components used, enzyme co-factors, buffer conditions, and the nature of the substrate.&#160; Here, we provide step-by-step protocols for conducting ubiquitination and deubiquitination reactions. We illustrate these reactions using minimal components of the mouse Polycomb Repressive Complex 1 (PRC1), BMI1, and RING1B, an E3 ubiquitin ligase that monoubiquitinates histone H2A on lysine 119. Deubiquitination of nucleosomal H2A is performed using a minimal Polycomb Repressive Deubiquitinase (PR-DUB) complex formed by the human deubiquitinase BAP1 and the DEUBiquitinase ADaptor (DEUBAD) domain of its co-factor ASXL2. These ubiquitination/deubiquitination assays can be conducted in the context of either recombinant nucleosomes reconstituted with bacteria-purified proteins or native nucleosomes purified from mammalian cells. We highlight the intricacies that can have a significant impact on these reactions and we propose that the general principles of these protocols can be swiftly adapted to other E3 ubiquitin ligases and deubiquitinases.

Ubiquitination is a post-translational modification that plays important roles in cellular processes and is tightly coordinated by deubiquitination. Defects in both reactions underlie human pathologies. We provide protocols for conducting ubiquitination and deubiquitination reaction in vitro using purified components.

Ensaios de Ubiquitinação e Deubiquitinação in vitro de histonas Nucleossomal

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination ...

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein aggregation. The accumulation of protein aggregates in bacterial cells can lead to significant alterations in the cellular phenotypic behavior, including a reduction in growth rates, stress resistance, and virulence. Several experimental procedures exist for the examination of these stressor-mediated phenotypes. This paper describes an optimized assay for the extraction and visualization of aggregated and soluble proteins from different Escherichia coli strains after treatment with a silver-ruthenium-containing antimicrobial. This compound is known to generate reactive oxygen species and causes widespread protein aggregation. 
The method combines a centrifugation-based separation of protein aggregates and soluble proteins from treated and untreated cells with subsequent separation and visualization by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Coomassie staining. This approach is simple, fast, and allows a qualitative comparison of protein aggregate formation in different E. coli strains. The methodology has a wide range of applications, including the possibility to investigate the impact of other proteotoxic antimicrobials on in vivo protein aggregation in a wide range of bacteria. Moreover, the protocol can be used to identify genes that contribute to increased resistance to proteotoxic substances. Gel bands can be used for the subsequent identification of proteins that are particularly prone to aggregation.

Extraction and Visualization of Protein Aggregates after Treatment of Escherichia coli with a Proteotoxic Stressor

This protocol describes the extraction and visualization of aggregated and soluble proteins from Escherichia coli after treatment with a proteotoxic antimicrobial. Following this procedure allows a qualitative comparison of protein aggregate formation in vivo in different bacterial strains and/or between treatments.

Extração e Visualização de Agregados proteicos após tratamento de Escherichia coli com um Estressor Proteotóxico

The exposure of living organisms to environmental and cellular stresses often causes disruptions in protein homeostasis and can result in protein ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

Ensaio Pulldown Juntamente com Co-Expressão em Células de Bactérias como uma Ferramenta Eficiente em Tempo para Testar Interações Desafiadoras Proteína-Proteína

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...