Name: determining the thermodynamic and kinetic association of a dna aptamer and tetracycline using isothermal titration calorimetry
Uploaded: 2022-08-23T13:45:00
Description: Watch this Scientific Journal Video about Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry at JoVE.com

This research was supported by the Research and Development Funding from Aptagen LLC.

NOTE: Figure 2 shows the main steps of the ITC experiment for determining the thermodynamic and kinetic association of a DNA aptamer and tetracycline.
1. Preparation of samples
NOTE: Samples for ITC need to be prepared in the same buffer for both the aptamer and ligand to avoid heat release caused by mixing different buffers from the sample cell and syringe. This is typically achieved through dialysis of all materials int...

<ol>
	<li>Ellington, A. D., Szostak, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+RNA+molecules+that+bind+specific+ligands.">In vitro selection of RNA molecules that bind specific ligands.</a> Nature. 346 (6287), 818-822 (1990).</li><li>Tuerk, C., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evolution+of+ligands+by+exponential+enrichment:+RNA+ligands+to+bacteriophage+T4+DNA+polymerase.">Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase.</a> Science. 249 (4968), 505-510 (1990).</li><li>Kim, S. H., Thoa, T. T. T., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptasensors+for+environmental+monitoring+of+contaminants+in+water+and+soil.">Aptasensors for environmental monitoring of contaminants in water and soil.</a> Current Opinion in Environmental Science &amp; Health. 10, 9-21 (2019).</li><li>Dunn, M. R., Jimenez, R. M., Chaput, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+discovery+and+technology.">Analysis of aptamer discovery and technology.</a> Nature Reviews Chemistry. 1, 0076 (2017).</li><li>Stoltenburg, R., Reinemann, C., Strehlitz, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SELEX--A+(r)evolutionary+method+to+generate+high-affinity+nucleic+acid+ligands.">SELEX--A (r)evolutionary method to generate high-affinity nucleic acid ligands.</a> Biomolecular Engineering. 24 (4), 381-403 (2007).</li><li>Wang, Y., Wang, G., Moitessier, N., Mittermaier, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzyme+kinetics+by+isothermal+titration+calorimetry:+Allostery,+inhibition,+and+dynamics.">Enzyme kinetics by isothermal titration calorimetry: Allostery, inhibition, and dynamics.</a> Frontiers in Molecular Biosciences. 7, 583826 (2020).</li><li>Velazquez-Campoy, A., Freire, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+titration+calorimetry+to+determine+association+constants+for+high-affinity+ligands.">Isothermal titration calorimetry to determine association constants for high-affinity ligands.</a> Nature Protocols. 1 (1), 186-191 (2006).</li><li>Niazi, J. H., Lee, S. J., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-stranded+DNA+aptamers+specific+for+antibiotics+tetracyclines.">Single-stranded DNA aptamers specific for antibiotics tetracyclines.</a> Bioorganic and Medicinal Chemistry. 16 (15), 7245-7253 (2008).</li><li>Kim, Y. J., Kim, Y. S., Niazi, J. H., Gu, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrochemical+aptasensor+for+tetracycline+detection.">Electrochemical aptasensor for tetracycline detection.</a> Bioprocess and Biosystems Engineering. 33 (1), 31-37 (2010).</li><li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+indirect+competitive+assay-based+aptasensor+for+highly+sensitive+detection+of+tetracycline+residue+in+honey.">Development of an indirect competitive assay-based aptasensor for highly sensitive detection of tetracycline residue in honey.</a> Biosensors &amp; Bioelectronics. 57, 192-198 (2014).</li><li>Kim, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+colorimetric+aptasensor+using+gold+nanoparticle+for+a+highly+sensitive+and+specific+detection+of+oxytetracycline.">A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline.</a> Biosensors &amp; Bioelectronics. 26 (4), 1644-1649 (2010).</li><li>Thoa, T. T., Minagawa, N., Aigaki, T., Ito, Y., Uzawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+photosensitisation+processes+by+an+RNA+aptamer.">Regulation of photosensitisation processes by an RNA aptamer.</a> Scientific Reports. 7, 43272 (2017).</li><li>Horowitz, E. D., Lilavivat, S., Holladay, B. W., Germann, M. W., Hud, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+structure+and+thermodynamics+of+2',5'+RNA+intercalation.">Solution structure and thermodynamics of 2',5' RNA intercalation.</a> Journal of the American Chemical Society. 131 (16), 5831-5838 (2009).</li><li>Sigurskjold, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exact+analysis+of+competition+ligand+binding+by+displacement+isothermal+titration+calorimetry.">Exact analysis of competition ligand binding by displacement isothermal titration calorimetry.</a> Analytical Biochemistry. 277 (2), 260-266 (2000).</li><li>Neves, M. A. D., Slavkovic, S., Churcher, Z. R., Johnson, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salt-mediated+two-site+ligand+binding+by+the+cocaine-binding+aptamer.">Salt-mediated two-site ligand binding by the cocaine-binding aptamer.</a> Nucleic Acids Research. 45 (3), 1041-1048 (2017).</li><li>Turnbull, W. B., Daranas, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+value+of+c:+Can+low+affinity+systems+be+studied+by+isothermal+titration+calorimetry.">On the value of c: Can low affinity systems be studied by isothermal titration calorimetry.</a> Journal of the American Chemical Society. 125 (48), 14859-14866 (2003).</li><li>Van Ness, J., Van Ness, L. K., Galas, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isothermal+reactions+for+the+amplification+of+oligonucleotides.">Isothermal reactions for the amplification of oligonucleotides.</a> Proceedings of the National Academy of Sciences of the United States of America. 100 (8), 4504-4509 (2003).</li></ol>

The method presented here was modified according to instruction from TA Instruments and is sufficient to determine the binding affinity and thermodynamics of many selected aptamers and targets at our center. Crucial steps from this procedure include exchanging the buffer to have a target matching the ligand, running samples with proper parameters, and finding the appropriate binding fitting model to analyze the data. Continuous recording of heat release requires eliminating all noise heat, such as from mismatch of the bu...

Aptamers are ssDNA or RNA fragments selected through an evolution process with high binding affinity and specificity to the desired targets1,2, which can work as advanced recognition elements or chemical antibodies3,4,5. Thus, the binding affinity and specificity of aptamers to their targets play a crucial role in the selection and application of an aptamer, and Isothermal Titration Calorimetry (ITC) has been widely used for these characterization purposes. Many approaches have been used to determine the affinity of aptamers, including ITC, surface plasmon resonance (SPR), colorimetric titration, microscale thermophoresis (MST), and Bio-Layer Interferometry (BLI). Among them, ITC is one of the latest techniques to determine the thermodynamic and kinetic association of two molecules in the solution phase. This approach conducts continuous titration using label-free molecules and records released heat over time upon the binding events produced by each titration6,7. Unlike other methods, ITC can offer binding affinity, several binding sites, and thermodynamic and kinetic association&#160;(Figure 1A). From these initial parameters, the Gibbs free energy changes and entropy changes are determined using the following relationship:
&#916;G = &#916;H-T&#916;S
That means that ITC offers a complete thermodynamic profile of the molecular interaction to elucidate the binding mechanisms (Figure 1B). Determining the binding affinity for small molecules with an aptamer is difficult due to the drastically different sizes between aptamer and target. Meanwhile, ITC can provide sensitive measurement without labeling and immobilizing molecules, which provides a means of keeping the natural structure of the aptamer and target during measurement. With the mentioned attributes, ITC can be used as the standard method for the characterization of binding between an aptamer and small targets.
After selection by the Gu group, this aptamer was integrated with different platforms, including electrochemical aptamer-based biosensors, a competitive enzyme-linked aptamer assay, and a microtiter plate, which can achieve high-throughput detection of tetracycline8,9,10. However, its binding characteristics have not been elucidated well enough to choose the proper platform8; it is worth characterizing the binding of the aptamer to the tetracycline using ITC.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5&#39;-CGTACGGAATTCG CTAGCCCCCCGGCAGGCCACGG 
			C TTGGGTTGGTCCCACTGCGCG 
			TGGATCCGAGCTCCAC GTG-3&#39;</td>
			<td>Integrated DNA Technologies, Inc</td>
			<td></td>
			<td>The sequence is adopted from Gu&#39;s research, which has not identified Kd using ITC (refer references 8 and 9)</td>
		</tr>
		<tr>
			<td>Affinity ITC Auto Low Volume (190 &#181;L) System Complete&#8211;Gold Cells</td>
			<td>TA Instruments</td>
			<td>61000.901</td>
			<td>Isothermal titration calorimetry system</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>Avantor (VWR)</td>
			<td>E506-100ML</td>
			<td>Calcium chloride 1 M in aqueous solution, Biotechnology Grade, sterile</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5417R</td>
			<td>The Eppendorf 5417R is unsurpassed in safety, reliability and ease-of-use. Very easy to maintain with a brushless motor that spins up to 16,400 RPM with maximum RCF up to 25,000 x g.</td>
		</tr>
		<tr>
			<td>Complete Degassing Station (110/230V)</td>
			<td>TA Instruments</td>
			<td>6326</td>
			<td>This degasser provides a self-contained stirring platform, vacuum chamber, vacuum port, temperature control and electronic timer for proper sample preparation.</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>TekNova</td>
			<td>E0375</td>
			<td>EDTA 500 mM, pH 7.5</td>
		</tr>
		<tr>
			<td>NanoDrop One Microvolume UV-Vis Spectrophotometer</td>
			<td>ThermoFisher</td>
			<td>ND-ONE-W</td>
			<td>UV-Vis Spectrophotometer</td>
		</tr>
		<tr>
			<td>Nanosep, Nanosep MF and NAB Centrifugal Devices</td>
			<td>Pall Laboratory</td>
			<td>OD030C34</td>
			<td>3 kDa molecular weight cutoff concentrator</td>
		</tr>
		<tr>
			<td>PBS pH 7.4</td>
			<td>IBI Scientific</td>
			<td>IB70165</td>
			<td>Buffer containing Sodium phosphate, Sodium chloride, Potassium phosphate, and Potassium chloride Ultra-Pure Grade Sterile filtered using 0.2 &#181;m filter. Autoclaved at 121 &#176;C for greater than 20 min.</td>
		</tr>
		<tr>
			<td>Posi-Click 1.7 mL Large Cap Microcentrifuge Tubes</td>
			<td>labForce (a Thomas Scientific Brand)</td>
			<td>1149K01</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline, Hydrochoride</td>
			<td>EMD Millipore Corperation</td>
			<td>CAS64-75-5</td>
			<td></td>
		</tr>
	</tbody>
</table>

determining the thermodynamic and kinetic association of a dna aptamer and tetracycline using isothermal titration calorimetry

The determination of binding affinity and behavior between an aptamer and its target is the most crucial step in selecting and using an aptamer for application. Due to the drastic differences between the aptamer and small molecules, scientists need to put much effort into characterizing their binding properties. Isothermal Titration Calorimetry (ITC) is a powerful approach for this purpose. ITC goes beyond determining disassociation constants (Kd) and can provide the enthalpy changes and binding stoichiometry of the interaction between two molecules in the solution phase. This approach conducts continuous titration using label-free molecules and records released heat over time upon the binding events produced by each titration, so the process can sensitively measure the binding between macromolecules and their small targets. Herein, the article introduces a step-by-step procedure of the ITC measurement of a selected aptamer with a small target, tetracycline. This example proves the versatility of the technique and its potential for other applications.

ITC provides an accurate disassociation constant (Kd), the binding stoichiometry, and the thermodynamic parameters of two-molecule interactions6. In this example, the aptamer selected by Kim et al.9,11 binds to tetracycline with binding affinities of Kd 1 = 13 &#181;M, Kd 2 = 53 nM. Interestingly, this binding was determined using the equilibrium filtration method and a reported K...

Watch this Scientific Journal Video about Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry at JoVE.com

Determining the Thermodynamic and Kinetic Association of a DNA Aptamer and Tetracycline Using Isothermal Titration Calorimetry

The present protocol describes the use of Isothermal Titration Calorimetry (ITC) to analyze the association and dissociation kinetics of the binding between a DNA aptamer and tetracycline, including sample preparation, running standards and samples, and interpreting the resulting data.

The determination of binding affinity and behavior between an aptamer and its target is the most crucial step in selecting and using an aptamer for ...

This protocol allows researchers to determine the binding affinities of aptamers against targets free in solution, while providing insight into the mechanism of binding. Because ITC measures changes in heat due to binding, neither aptamer nor ligand needs to be labeled or functionalized, as would be the case for techniques such as SPR. New users should pay close attention to matching buffers across all binding components.Additionally, be aware that the technique has high sample requirements that may be difficult to meet for larger ligands such as proteins. To begin, activate the membrane of the dialysis column, fill with PBS buffer, equilibrate for 10 minutes at room temperature, and centrifuge at 5, 000 times G for 15 minutes. Remove the buffer and load 500 microliters of aptamer samples into the column.Centrifuge at 5, 000 times G and repeat it four times to exchange the original buffer for PBS. Collect the dialyzed DNA aptamer using a pipette and transfer it to the new 1.5-milliliter tube. Collect the last flow-through buffer to dissolve tetracycline.Ensure that the buffer for the experiment in the syringe matches the buffer in the reference cell. Determine the aptamer concentration again using a UV-visible spectrometer. Use the last exchange buffer to adjust the concentration to 40-micromolar tetracycline and two-micromolar aptamer.Fold the DNA aptamer by heating at 90 degrees Celsius for 10 minutes, cooling at four degrees Celsius for 10 minutes, and then returning to room temperature for 20 minutes. Degas the folded aptamer and dialyzed tetracycline using a degassing station or vacuum pump for 25 minutes to eliminate dissolved gases. After cleaning up and confirming the cleanliness of the machine, test the accuracy of the machine with a standard kit that includes EDTA and calcium chloride using the default program and following the instructions from the manufacturer.Set up the running parameters. Check the required volumes using a running program calculator. With this running parameter, perform ITC measurement with 230 microliters of 40-micromolar tetracycline in the ITC syringe and 485 microliters of two-micromolar aptamer in the ITC sample cell using the ITC.Load the dialyzed tetracycline syringe plates and the folded aptamer into the sample cell, avoiding bubbles, using a pipette. Start running the ITC instrument by clicking on the Start button on the software. Open the data analysis software by double clicking to start analyzing the data.Open the path of the saved raw data to know the tendency of binding. Open the Modeling tab and use different binding models to find the best fit for the data curve. Then, the software automatically calculates the ITC thermogram and various thermodynamic parameters, including enthalpy, entropy, free energy, equilibrium binding constant, and stoichiometry.Collect the thermodynamic parameters determined from the data and fitting model information. Create a report including pictures of the ITC thermogram and various thermodynamic parameters. The aptamer selected by Kim, et al binds to tetracycline with binding affinities of disassociation constant one equals 13 micromolar and disassociation constant two equals 53 nanomolar.The fitting model and stoichiometry from ITC reflect that the aptamer binds to tetracycline through a 2:1 binding ratio with the sequential binding model. The thermodynamic parameters determined by ITC measurement for site two indicated that enthalpy overcoming relatively significant entropic loss drives the strong binding. The enthalpy-driven binding with entropy loss relates to nucleic acid conformational changes, which have been reported as binding behaviors between RNA and a small molecule.The aptamer and ligand must be in the same buffer. The aptamer should be refolded if developed with refolding, and samples must be degassed. Addressing these considerations will ensure that only aptamer-ligand interactions contribute to the measured signal.Due to the size of the aptamer target, an appropriate follow-up method could be microscale thermophoresis to confirm the measured binding affinity free in solution.

Research

JoVE Journal

Biochemistry

Mapping the Binding Site of an Aptamer on ATP Using MicroScale Thermophoresis

Characterization of molecular interactions in terms of basic binding parameters such as binding affinity, stoichiometry, and thermodynamics is an ...

Differential Scanning Calorimetry &#8212; A Method for Assessing the Thermal Stability and Conformation of Protein Antigen

Differential scanning calorimetry (DSC) is an analytical technique that measures the molar heat capacity of samples as a function of temperature. In the ...

Detection and Visualization of DNA Damage-induced Protein Complexes in Suspension Cell Cultures Using the Proximity Ligation Assay

The DNA damage response orchestrates the repair of DNA lesions that occur spontaneously, are caused by genotoxic stress, or appear in the context of ...

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different ...

Determining if DNA Stained with a Cyanine Dye Can Be Digested with Restriction Enzymes

Visualization of DNA for fluorescence microscopy utilizes a variety of dyes such as cyanine dyes. These dyes are utilized due to their high affinity and ...

Titration ELISA as a Method to Determine the Dissociation Constant of Receptor Ligand Interaction

The dissociation constant describes the interaction between two partners in the binding equilibrium and is a measure of their affinity. It is a crucial ...

Proofreading and DNA Repair Assay Using Single Nucleotide Extension and MALDI-TOF Mass Spectrometry Analysis

The maintenance of the genome and its faithful replication is paramount for conserving genetic information. To assess high fidelity replication, we have ...

Anaerobic Protein Purification and Kinetic Analysis via Oxygen Electrode for Studying DesB Dioxygenase Activity and Inhibition

Oxygen-sensitive proteins, including those enzymes which utilize oxygen as a substrate, can have reduced stability when purified using traditional aerobic ...

High Sensitivity Measurement of Transcription Factor-DNA Binding Affinities by Competitive Titration Using Fluorescence Microscopy

Accurate quantification of transcription factor (TF)-DNA interactions is essential for understanding the regulation of gene expression. Since existing ...