Souris, de type sauvage (Mavs + / +) et knock-out (Mavs - / -) de type sauvage (Mavs + / +) et knock-out (Mavs - - /) FAE ont été aimablement fournies par le Dr J. Zhijian Chen (Université de Texas Southwestern Medical Center) 13. Cette publication est basée sur les travaux financés par des subventions du NIH (R01 CA134241 et R01 DE021445) et l&#39;American Cancer Society (RSG-11-162-01-MPC).

Déclaration éthique: Tous les travaux de l&#39;animal a été réalisé sous stricte conformité avec les recommandations du Guide pour le soin et l&#39;utilisation des animaux de laboratoire des National Institutes of Health. Le protocole a été approuvé par le soin et l&#39;utilisation des animaux Commission institutionnelle (IACUC) de l&#39;Université de Californie du Sud. Une. Cytokine expression génique par quantitative PCR en temps réel et la sécrétion par ELISA chez des souris infectées par γHV68 <ol><li> Anesthésier, 6-8 semaines d&#39;âge C57BL / 6 (B6) littermates genre identifié (8-12 souris / groupe) par injection intrapéritonéale de 1,5 mg de ketamine/0.12 mg de xylazine, et inoculer par voie intranasale avec 40 PFU de γHV68 dans 40 pi (infection détaillé dans Dong Feng et 11). A différents moments après l&#39;infection, euthanasier les souris en utilisant inhalation de CO 2 suivie par dislocation cervicale. </li><li> Ouvrez le coffre avec une coupe latérale gauche le long de la sternum et couper à travers les côtes avec des ciseaux pointus. Recueillir les tissus pulmonaires. </li><li> Recueillir la moitié du tissu pulmonaire (lobe gauche) dans 1,5 ml tubes à bouchon à vis stériles contenant 500 ul de 1,0 mm perles zircon / de silice. Ajouter 1 ml de DMEM sans sérum froid dans le tube et homogénéiser les tissus pulmonaires de bourrelet battement pendant 30 sec. Refroidir les tubes sur de la glace pendant 2 min et répéter ce processus une fois. </li><li> Centrifuger les tubes (15 000 x g pendant 10 min) à 4 ° C, recueillir le surnageant et à mesurer la production de cytokine tels que décrits ci-dessous. </li><li> Mesurer cytokines aide disponibles dans le commerce cytokines kits ELISA selon les instructions du fabricant. </li><li> Recueillir l&#39;autre moitié du tissu pulmonaire (lobe droit) dans un autre tube contenant de perles et ajouter 1 ml TRIzol. Homogénéiser et recueillir le surnageant, comme décrit dans l&#39;étape 1.3 et de l&#39;ARN extrait selon les instructions du fabricant. Déterminer la concentration d&#39;ARN par des lectures de l&#39;absorbance à 260 et 280 nm. </li&gt; <li> Préparer l&#39;ADNc avec 1 ug d&#39;ARN total et la transcriptase inverse selon les instructions de la fabrication (le volume final était de 20 pl au total). Diluer ADNc 50 fois à la DNAse et de l&#39;eau sans RNAse et effectuer la PCR quantitative en temps réel. </li><li> Effectuer le programme sur une machine quantitative PCR en temps réel. Chaque réaction contient 0,5 ul d&#39;une paire d&#39;amorces spécifiques d&#39;un gène ou d&#39;amorces de contrôle de GAPDH (la concentration de travail des amorces étaient de 10 uM, CE 500 nM de chaque amorce), 5 pi de mélange maître SYBR et 4 pl de la dilution ADNc. Calculer ΔΔCt pour déterminer la quantité relative de transcrits d&#39;ARNm de cytokines antivirales. </li></ol> 2. MEF infection cellulaire et des cytokines quantification par ELISA et qRT-PCR <ol><li> Cultivez Mavs + / + et Mavs - / - cellules MEF à sous-confluence (environ 80%) densité avant l&#39;étalement des cellules. </li><li> Diviser les cellules MEF en 12 nousoutes les plaques à 100 000 cellules / puits (la densité cellulaire sera d&#39;environ 70% le deuxième jour). Effectuer infection γHV68 en triple, avec une multiplicité d&#39;infection (MOI) de 5 à 10 pour synchroniser et optimiser l&#39;induction de cytokines. </li><li> Préparer γHV68 suspension dans du milieu complet DMEM contenant la quantité appropriée de virus (1 ml pour chaque puits). </li><li> Retirer moyen et ajouter γHV68 suspension contenant les cellules MEF. </li><li> Placer la plaque dans le tissu incubateur de culture, le rock toutes les 30 minutes, et permettre à un total de 2 heures d&#39;incubation. </li><li> Retirez milieu contenant γHV68, laver une fois avec du PBS, et les remplacer par du DMEM complet frais. </li><li> À divers moments après l&#39;infection, le milieu de la récolte dans 1,5 ml tubes Eppendorf. Laver les cellules avec du PBS froid et de recueillir les cellules infectées par digestion à la trypsine. </li><li> Mesurer cytokines antivirales dans un milieu tel que décrit dans l&#39;étape 1.5. </li><li> Extraire l&#39;ARN, l&#39;ADNc de préparer et d&#39;effectuer qRT-PCR pour déterminer l&#39;expression des gènes de cytokines antiviralescomme décrit dans les étapes 1.5 à 1.7. </li></ol> 3. La production de lentivirus, infection, et la génération de lignées cellulaires stables <ol><li> Division des cellules 293T Un jour avant la transfection et permettent aux cellules d&#39;atteindre environ 40% de confluence au moment de la transfection. </li><li> Transfecter de 10 cm de cellules 293T avec les plasmides d&#39;emballage (1,2 ug de pVSV-G et 6 pg de pDR8.9) et 7,2 ug de PCDH-drapeau-MAVS ou contrôle PCDH par précipitation au phosphate de calcium. </li><li> Remplacer moyenne de 6 à 8 heures après la transfection avec du DMEM complet frais. </li><li> A 72 heures après la transfection, un milieu contenant du lentivirus collecter, centrifuger à 4000 g pendant 15 min, et le filtre à membrane de 0,22 um. Pour augmenter le titre lentivirus, nous centrifuger le milieu contenant le virus à 110 000 g pendant 2,5 heures à 4 ° C. Remettre en suspension avec précaution le culot viral dans un petit volume de milieu d&#39;intérêt. </li><li> Mavs de semences - / - cellules MEF ou d&#39;autres cellules knock-out MEF un jour Before infection dans des plaques à 6 puits à ~ 30-40% de confluence. </li><li> Infecter les cellules avec 1 ml MEF lentivirus et 2 ml de DMEM complet frais, additionné de polybrène à une concentration finale de 10 pg / ml. </li><li> Centrifuger la plaque à 500 x g à 30 ° C pendant 30 min et à transférer la plaque à un incubateur de culture tissulaire. </li><li> Remplacer moyenne à 6 heures après l&#39;infection avec du DMEM complet frais. </li><li> Fractionner les cellules MEF à 24 heures après l&#39;infection et ajouter puromycine à une concentration finale de 1 pg / ml à 48 heures après l&#39;infection pour sélectionner les cellules exprimant de façon stable MAVS. </li><li> Maintenir les cellules MEF dans un milieu contenant la puromycine et vérifier l&#39;expression des protéines par immunoblot avec des anticorps correspondants. </li><li> Les cellules peuvent être utilisées pour l&#39;infection virale, l&#39;expression des gènes des cytokines et des expériences de sécrétion tel que décrit dans le protocole 2. </li></ol>

<ol>
	<li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Kato, H., Takahasi, K., Fujita, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-like+receptors:+cytoplasmic+sensors+for+non-self+RNA.">RIG-I-like receptors: cytoplasmic sensors for non-self RNA.</a> Immunol. Rev. 243, 91-98 (2011).</li><li>Kawai, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPS-1,+an+adaptor+triggering+RIG-I-+and+Mda5-mediated+type+I+interferon+induction.">IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction.</a> Nat. Immunol. 6, 981-988 (2005).</li><li>Seth, R. B., Sun, L., Ea, C. K., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+MAVS,+a+mitochondrial+antiviral+signaling+protein+that+activates+NF-kappaB+and+IRF+3.">Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3.</a> Cell. 122, 669-682 (2005).</li><li>Xu, L. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VISA+is+an+adapter+protein+required+for+virus-triggered+IFN-beta+signaling.">VISA is an adapter protein required for virus-triggered IFN-beta signaling.</a> Mol. Cell. 19, 727-740 (2005).</li><li>Meylan, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardif+is+an+adaptor+protein+in+the+RIG-I+antiviral+pathway+and+is+targeted+by+hepatitis+C+virus.">Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus.</a> Nature. 437, 1167-1172 (2005).</li><li>Speck, S. H., Virgin, H. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+and+viral+genetics+of+chronic+infection:+a+mouse+model+of+gamma-herpesvirus+pathogenesis.">Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis.</a> Curr. Opin. Microbiol. 2, 403-409 (1999).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma-herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+initiate+lytic+replication.">Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication.</a> PLoS Pathog. , (2010).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gamma+herpesvirus+68+hijacks+MAVS+and+IKKbeta+to+abrogate+NFkappaB+activation+and+antiviral+cytokine+production.">Murine gamma herpesvirus 68 hijacks MAVS and IKKbeta to abrogate NFkappaB activation and antiviral cytokine production.</a> PLoS Pathog. 7, (2011).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+gammaherpesvirus+68+evades+host+cytokine+production+via+replication+transactivator-induced+RelA+degradation.">Murine gammaherpesvirus 68 evades host cytokine production via replication transactivator-induced RelA degradation.</a> J. Virol. 86, 1930-1941 (2012).</li><li>Dong, X., Feng, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+Host-virus+Interaction+in+Lytic+Replication+of+a+Model+Herpesvirus.">Dissecting Host-virus Interaction in Lytic Replication of a Model Herpesvirus.</a> J. Vis. Exp. , (2011).</li><li>He, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor+interacting+protein+kinase-3+determines+cellular+necrotic+response+to+TNF-alpha.">Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha.</a> Cell. 137, 1100-1111 (2009).</li><li>Sun, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+specific+and+essential+role+of+MAVS+in+antiviral+innate+immune+responses.">The specific and essential role of MAVS in antiviral innate immune responses.</a> Immunity. 24, 633-642 (2006).</li></ol>

Les auteurs déclarent aucun conflit d&#39;intérêt.

Évasion immunitaire virale est l&#39;une des interactions les plus dynamiques et les plus fascinants d&#39;interface infraction virale et défense de l&#39;hôte 9. Les composants de l&#39;immunité innée de l&#39;hôte sont structurés de telle sorte que la transduction du signal est effectivement lancé et fidèlement transmis. La délimitation de la hiérarchie et de la réglementation des cascades de signalisation est un sujet prééminent de l&#39;immunité innée. Ici, nous introduisons un protocole p...

Des études récentes ont souligné les cascades de signalisation dans l&#39;ensemble de montage réponses immunitaires innées de l&#39;hôte. Résidant dans des compartiments distincts, les récepteurs de reconnaissance des formes (PRR) de détecter des modèles moléculaires associés à des pathogènes (PAMP) d&#39;origines diverses pour déclencher immunitaire inné de signalisation 1. Le gène induite par l&#39;acide rétinoïque I (RIG-I) et de l&#39;antigène de différenciation des mélanomes (5 protéines de MDA5) sont des capteurs qui reconnaissent cytosoliques espèces d&#39;ARN avec des caractéristiques structurales spécifiques 2. Lors de l&#39;activation, RIG-I interagit avec son MAVS aval (également connu sous le IPS-1, VISA, et CARDIF) adaptateur qui, à son tour, active la IKK (IKKαβγ) et kinase liée IKK (TBK1 et IKKε, également connu sous le IKKi ) complexes 3-6. Kinases activées phosphorylent immunitaires innées des régulateurs clés de l&#39;expression de gènes, y compris les facteurs de transcription et leurs inhibiteurs, et permettent l&#39;activation transcriptionnelle de gènes antiviraux de l&#39;hôte (par exemple IL6, TNF &amp; #945;, CCL5, et IFNß). Ces cascades de signalisation constituent les réponses innées intrinsèques puissants immunitaires qui établissent un état anti-microbienne de limiter la propagation de l&#39;agent pathogène au cours des premiers stades de l&#39;infection. Murine γHV68 est étroitement liée à KSHV oncogène humain et EBV. Ainsi, l&#39;infection de souris γHV68 fournit un petit modèle animal traitable à examiner la réponse immunitaire de l&#39;hôte à l&#39;infection par le virus de l&#39;herpès gamma in vivo 7. Utilisation γHV68, notre laboratoire a découvert une stratégie complexe dans lequel γHV68 détourne accueillir signalisation immunitaire innée à permettre à l&#39;infection virale. D&#39;une part, γHV68 active la voie MAVS-IKKß, de promouvoir l&#39;activation de la transcription virale via diriger IKKß activé pour phosphoryler la réplication transactivateur (RTA), la clé virale du facteur de transcription pour la réplication γHV68 8. D&#39;autre part, la phosphorylation médiée par amorce IKKß RelA pour la dégradation et la duréeInates activation de NFkB 9. En tant que tel, l&#39;infection γHV68 évite efficacement la production de cytokines antiviral. Fait intéressant, un dépistage utilisant une bibliothèque d&#39;expression de γHV68 identifié RTA comme une ligase E3 pour induire la dégradation des RelA et abroger activation de NFkB 10. Ces résultats dévoilent une stratégie d&#39;évasion immunitaire complexe dans lequel les événements de signalisation en amont immunitaires sont mobilisées par γHV68 à nier l&#39;ultime production de cytokines antiviral. Ici, nous décrivons un protocole pour mesurer la production de cytokine antivirale chez des souris infectées avec γHV68 la fois in vivo et ex viv o. Dans le protocole, nous explorons encore la &quot;reconstitué&quot; expression des composants de l&#39;immunité innée dans les fibroblastes embryonnaires knock-out par transduction lentivirus, qui met en évidence la fonction des molécules immunitaires innées spécifiques dans la régulation de la production de cytokines antiviral. Ce protocole peut être facilement adaptée à d&#39;autres virusession et les voies de signalisation.

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">Mouse CCL5 ELISA kit</td>
			<td style="width:211px;">R&#38;D systems</td>
			<td style="width:223px;"><a href="http://www.rndsystems.com/Products/DY478">DY478</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">1.0 mm Zirconia/Silica beads</td>
			<td style="width:211px;">BioSpec Products</td>
			<td style="width:223px;">11079110z</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:251px;">TRIzol</td>
			<td style="width:211px;">Invitrogen</td>
			<td style="width:223px;"><a href="http://products.invitrogen.com/ivgn/en/US/adirect/invitrogen?cmd=catProductDetail&amp;productID=15596018">15596-018</a></td>
		</tr>
		<tr height="79">
			<td height="98" rowspan="2" style="height:98px;width:251px;">SuperScript II Reverse Transcriptase</td>
			<td rowspan="2" style="width:211px;">Invitrogen</td>
			<td rowspan="2" style="width:223px;">18064-014</td>
		</tr>
		<tr height="19">
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">CCL5 quantitative real-time PCR primers</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">CCTGCTGCTTTGCCTACCTCTC</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">ACACACTTGGCGGTTCCTTCGA</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

dissecting innate immune signaling in viral evasion of cytokine production

En réponse à une infection virale, l&#39;hôte une réponse immunitaire innée est activé pour réguler à la hausse l&#39;expression des gènes et la production de cytokines antivirales. Inversement, les virus ont développé des stratégies complexes pour échapper à exploiter et signalisation immunitaire de l&#39;hôte pour la survie et la propagation. Évasion immunitaire virale, entraînant défense de l&#39;hôte et l&#39;évasion virale, fournit l&#39;une des interfaces les plus fascinants et les plus dynamiques de discerner l&#39;interaction hôte-virus. Ces études progresser notre compréhension de la régulation immunitaire innée et ouvrent notre façon de développer de nouveaux traitements antiviraux. Murin γHV68 est un agent pathogène naturel des rongeurs murins. γHV68 infection de souris fournit un modèle animal docile pour examiner la réponse antivirale de KSHV humaine et EBV qui perturbation des interactions in vivo dans virus-hôte n&#39;est pas applicable. Ici, nous décrivons un protocole pour déterminer la production de cytokines antiviral. Ce protocole peut être adapté à d&#39;autres virutilise et les voies de signalisation. Récemment, nous avons découvert que γHV68 détourne MAVS et IKKß, innés principaux composants de signalisation en aval de l&#39;immunitaires cytosolique RIG-I et MDA5, d&#39;abroger l&#39;activation de NFkB et la production de cytokines antivirales. Plus précisément, l&#39;infection active γHV68 IKKß et que IKKß activée phosphoryle RelA à accélérer la dégradation de RelA. En tant que tel, γ HV68 découple efficacement l&#39;activation de NFkB de son amont IKKß activé, la négation de l&#39;expression antiviral de gène de cytokine. Cette étude met en lumière une stratégie complexe de sorte que l&#39;activation immunitaire innée en amont est interceptée par un agent pathogène viral d&#39;annuler l&#39;activation de la transcription en aval immédiat et soustraire la production de cytokines antivirales.

Trois figures représentatives sont présentés ici, y compris la production de cytokines dans le poumon de Mavs γHV68 infectés + / + et Mavs-/ - souris, la sécrétion de cytokines et l&#39;expression des gènes niveau de Mavs + / + et Mavs γHV68 infectés - / - MEF, et les niveaux d&#39;ARNm de cytokines Mavs γHV68 infectés - / - FAE &quot;reconstitués&quot; avec MAVS. Ces expériences représentatives utilisent d...

Watch this Scientific Journal Video about Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production at JoVE.com

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Nous décrivons un protocole pour mesurer la production de cytokine antivirale chez les souris infectées par un virus de l&#39;herpès modèle murin gamma herpèsvirus 68 (γ HV68) qui est étroitement liée à associé au sarcome de virus de l&#39;herpès de Kaposi humain (KSHV) et le virus d&#39;Epstein-Barr (EBV). L&#39;utilisation de souches de souris génétiquement modifiées et les fibroblastes embryonnaires de souris (MEF), nous avons évalué la production de cytokines antivirales la fois in vivo et ex vivo. &quot;Reconstitution&quot; de l&#39;expression des composants immunitaires innées à élimination directe des fibroblastes embryonnaires de transduction lentiviral, nous Pinpoint en outre des molécules immunitaires innées spécifiques et disséquer les événements de signalisation clés qui régulent différemment la production de cytokines antiviral.

Dissection Innate Immune signalisation Evasion virale de la production de cytokines

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

dissecting-innate-immune-signaling-viral-evasion-cytokine

Research

JoVE Journal

Immunology and Infection

10.4K vues.  Keck School of Medicine, University of Southern California.  Nous décrivons un protocole pour mesurer la production de cytokine antivirale chez les souris infectées par un virus de l'herpès modèle murin gamma herpèsvirus 68 (γ HV68) qui est étroitement liée à associé au sarcome de virus de l'herpès de Kaposi humain (KSHV) et le virus d'Epstein-Barr (EBV). L'utilisation de souches de souris génétiquement modifiées et...

Vidéo: Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

Production et titrage des adéno-associé recombinant vecteurs viraux

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Recherche

Immunologie et infection

Quantification of the Respiratory Burst Response as an Indicator of Innate Immune Health in Zebrafish

The phagocyte respiratory burst is part of the innate immune response to pathogen infection and involves the production of reactive oxygen species (ROS). ROS are toxic and function to kill phagocytized microorganisms. In vivo quantification of phagocyte-derived ROS provides information regarding an organism's ability to mount a robust innate immune response. Here we describe a protocol to quantify and compare ROS in whole zebrafish embryos upon chemical induction of the phagocyte respiratory burst. This method makes use of a non-fluorescent compound that becomes fluorescent upon oxidation by ROS. Individual zebrafish embryos are pipetted into the wells of a microplate and incubated in this fluorogenic substrate with or without a chemical inducer of the respiratory burst. Fluorescence in each well is quantified at desired time points using a microplate reader. Fluorescence readings are adjusted to eliminate background fluorescence and then compared using an unpaired t-test. This method allows for comparison of the respiratory burst potential of zebrafish embryos at different developmental stages and in response to experimental manipulations such as protein knockdown, overexpression, or treatment with pharmacological agents. This method can also be used to monitor the respiratory burst response in whole dissected kidneys or cell preparations from kidneys of adult zebrafish and some other fish species. We believe that the relative simplicity and adaptability of this protocol will complement existing protocols and will be of interest to researchers who seek to better understand the innate immune response.

The innate immune response protects organisms against pathogen infection. A critical component of the innate immune response, the phagocyte respiratory burst, generates reactive oxygen species that kill invading microorganisms. We describe a respiratory burst assay that quantifies reactive oxygen species produced when the innate immune response is chemically induced.

Quantification de la réponse du Rafale respiratoire comme indicateur d&#39;Innate Immune Health chez le poisson zèbre

The phagocyte respiratory burst is part of the innate immune response to  pathogen infection and involves the production of reactive oxygen species (ROS). ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

En utilisant l&#39;ARN interférence pour étudier la réponse immunitaire innée dans les macrophages de souris

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of causing systemic disease in both fish and humans. A better understanding of S. iniae disease pathogenesis requires an appropriate model system. The genetic tractability and the optical transparency of the early developmental stages of zebrafish allow for the generation and non-invasive imaging of transgenic lines with fluorescently tagged immune cells. The adaptive immune system is not fully functional until several weeks post fertilization, but zebrafish larvae have a conserved vertebrate innate immune system with both neutrophils and macrophages. Thus, the generation of a larval infection model allows the study of the specific contribution of innate immunity in controlling S. iniae infection.
The site of microinjection will determine whether an infection is systemic or initially localized. Here, we present our protocols for otic vesicle injection of zebrafish aged 2-3 days post fertilization as well as our techniques for fluorescent confocal imaging of infection. A localized infection site allows observation of initial microbe invasion, recruitment of host cells and dissemination of infection. Our findings using the zebrafish larval model of S. iniae infection indicate that zebrafish can be used to examine the differing contributions of host neutrophils and macrophages in localized bacterial infections. In addition, we describe how photolabeling of immune cells can be used to track individual host cell fate during the course of infection.

Non-invasive Imaging of the Innate Immune Response in a Zebrafish Larval Model of Streptococcus iniae Infection

Here, we present a protocol for the generation and imaging of a localized bacterial infection in the zebrafish otic vesicle.

Imagerie non invasive de la réponse immunitaire innée dans un modèle de poisson zèbre larves de<em&gt; Streptococcus iniae</em&gt; Infection

The aquatic pathogen, Streptococcus iniae, is responsible for over 100 million dollars in annual losses for the aquaculture industry and is capable of ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

Dissection multi-signalisation Complexes protéiques par Purification d’affinité de complémentation bimoléculaire (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Single-cell Analysis of Immunophenotype and Cytokine Production in Peripheral Whole Blood via Mass Cytometry

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies in an attempt to understand the precise mechanisms that lead to the breakdown of self-tolerance and subsequent autoimmunity. Approaches thus far have been based on the study of one specific aspect of the immune system (a single or few cell types or cytokines), and do not offer a global assessment of complex autoimmune disease. While patient sera-based studies have afforded important insights into autoimmunity, they do not provide the specific cellular source of the dysregulated cytokines detected. A comprehensive single-cell approach to evaluate cytokine production in multiple immune cell subsets, within the context of &#34;intrinsic&#34; patient-specific plasma circulating factors, is described here. This approach enables monitoring of the patient-specific immune phenotype (surface markers) and function (cytokines), either in its native &#34;intrinsic pathogenic&#34; disease state, or in the presence of therapeutic agents (in vivo or ex vivo).

Here we describe a single-cell proteomic approach to evaluate immune phenotypic and functional (intracellular cytokine induction) alterations in peripheral whole blood samples, analyzed via mass cytometry.

Analyse unicellulaires lymphoblastiques et Production de cytokines dans le sang périphérique par cytométrie de flux massique

Cytokines play a pivotal role in the pathogenesis of autoimmune diseases. Hence, the measurement of cytokine levels has been the focus of multiple studies ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

Un modèle de souris pour évaluer réponse immunitaire innée à l’infection par Staphylococcus aureus

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal host-microbe interactions. It is well established that different commensals exhibit a different potential to stimulate the host intestinal immune system. Such investigations involve vertebrate animals, especially rodents. Since increasing ethical concerns are linked with experiments involving vertebrates, there is a high demand for invertebrate replacements models. 
Here, we provide a Galleria mellonella oral administration model using commensal non-pathogenic bacteria and the possible assessment of the immunogenic potential of commensals on the G. mellonella immune system. We demonstrate that G. mellonella is a useful alternative invertebrate replacement model that allows the analysis of commensals with different immunogenic potential such as Bacteroides vulgatus and Escherichia coli. Interestingly, the bacteria exhibited no killing effect on the larvae, which is similar to mammals. The immune responses of G. mellonella were comparable with vertebrate innate immune responses and involve recognition of the bacteria and production of antimicrobial molecules. We propose that G. mellonella was able to restore previous microbiota balance, which is well known from healthy mammalian individuals. Although providing comparable innate immune responses in both G. mellonella and vertebrates, G. mellonella does not harbor an adaptive immune system. Since the investigated components of the innate immune system are evolutionary conserved, the model allows a prescreening and first analysis of bacterial immunogenic properties.

A Galleria mellonella Oral Administration Model to Study Commensal-Induced Innate Immune Responses

Here, we provide a detailed protocol for an oral administration model using Galleria mellonella larvae and how to characterize induced innate immune responses. Using this protocol, researchers without practical experience will be able to use the G. mellonella force-feeding method.

Un modèle d’Administration orale à des réponses immunitaires innées Study Commensal-Induced Galleria mellonella

The investigation of the immunogenic potential of commensal bacteria on the host immune system is one essential component when studying intestinal ...

Isolation of Tonsillar Mononuclear Cells to Study Ex Vivo Innate Immune Responses in a Human Mucosal Lymphoid Tissue

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal immunity, because they can model host-pathogen interactions in the tissue. While isolated cells derived from tissues were the first cell culture model, their use has been neglected because tissue can be hard to obtain. In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells (TMCs) from healthy human tonsils to study innate immune responses upon activation, mimicking viral infection in mucosal tissues. Isolation of TMCs from the tonsils is quick, because the tonsils barely have any epithelium and yield up to billions of all major immune cell types. This method allows detection of cytokine production using several techniques, including immunoassays, qPCR, microscopy, flow cytometry, etc., similar to the use of peripheral mononuclear cells (PBMCs) from blood. Furthermore, TMCs show a higher sensitivity to drug testing than PBMCs, which needs to be considered for future toxicity assays. Thus, ex vivo TMCs cultures are an easy and accessible mucosal model.

In the present protocol, we explain how to easily process and culture tonsillar mononuclear cells from healthy humans undergoing partial surgical tonsillectomy to study innate immune responses upon activation, mimicking viral infection in mucosal tissues.

Isolement des cellules monnucléaires tonsillar pour étudier les réponses immunitaires innées Ex Vivo dans un tissu lymphoïde muqueuse humain

Studying isolated cells from mucosa-associated lymphoid tissues (MALT) allows understanding of immune cells response in pathologies involving mucosal ...

Microfluidic Co-Culture Models for Dissecting the Immune Response in in vitro Tumor Microenvironments

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise invisible processes. Advanced cell assays closely mimicking in vivo scenery are establishing themselves as novel ways to visualize and measure the bidirectional tumor-host interplay influencing the progression of cancer. Here we describe two versatile protocols to recreate highly controllable 2D and 3D co-cultures in microdevices, mimicking the complexity of the tumor microenvironment (TME), under natural and therapy-induced immunosurveillance. In section 1, an experimental setting is provided to monitor crosstalk between adherent tumor cells and floating immune populations, by bright field time-lapse microscopy. As an applicative scenario, we analyze the effects of anti-cancer treatments, such as the so-called immunogenic cancer cell death inducers on the recruitment and activation of immune cells. In section 2, 3D tumor-immune microenvironments are assembled in a competitive layout. Differential immune infiltration is monitored by fluorescence snapshots up to 72 h, to evaluate combination therapeutic strategies. In both settings, image processing steps are illustrated to extract a plethora of immune cell parameters (e.g., immune cell migration and interaction, response to therapeutic agents). These simple and powerful methods can be further tailored to simulate the complexity of the TME encompassing the heterogeneity and plasticity of cancer, stromal and immune cells subtypes, as well as their reciprocal interactions as drivers of cancer evolution. The compliance of these rapidly evolving technologies with live-cell high-content imaging can lead to the generation of large informative datasets, bringing forth new challenges. Indeed, the triangle &#39;&#39;co-cultures/microscopy/advanced data analysis&#34; sets the path towards a precise problem parametrization that may assist tailor-made therapeutic protocols. We expect that future integration of cancer-immune on-a-chip with artificial intelligence for high-throughput processing will synergize a large step forward in leveraging the capabilities as predictive and preclinical tools for precision and personalized oncology.

In the age of immunotherapy and single-cell genomic profiling, cancer biology requires novel in vitro and computational tools for investigating the tumor-immune interface in a proper spatiotemporal context. We describe protocols to exploit tumor-immune microfluidic co-cultures in 2D and 3D settings, compatible with dynamic, multiparametric monitoring of cellular functions.

Modèles de co-culture microfluidique pour disséquer la réponse immunitaire dans des microenvironnements tumoraux in vitro

Complex disease models demand cutting-edge tools able to deliver physiologically and pathologically relevant, actionable insights, and unveil otherwise ...