לעבוד ביוקנן-ולאסטון המעבדה על תאים מסוג מסוים והתפתחותי פרופיל במה נתמכת על ידי אגרון-OMICS הפרויקט (מענק # LSHG-CT-2006-037704) במסגרת Progamme 6 שנים לנציבות האירופיות. העבודה במעבדת גיפורד באפיון ספציפי של תאים מהסוג נתמכת על ידי BBSRC ניו חוקר מענק (BB/H019502/1). את KC274 וKC464 קווי ארבידופסיס התקבלו מAAR ווב (אוניברסיטת קיימברידג&#39;).

1. Protoplast הדור <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> חומרי קציר עלים ולחתוך לרצועות ברוחב 1 מ&quot;מ (איור 1) עם סכין גילוח. לדגימות המכילות יותר מעלים עד 15 עלים בודדים יכולות להיערם בקלות לפני החיתוך. </li><li style=";text-align:right;direction:rtl"> מייד להעביר רצועות עלים לתוך צלחת פטרי עגולה 9 סנטימטר המכיל 20 מיליליטר פתרון (400 המ&quot;מ מניטול, מימה 20 מ&quot;מ MES, 20 המ&quot;מ KCl, 10 mM CaCl 2, 2 המ&quot;מ MgCl 2, 0.1% BSA ו2.5 מ&quot;מ β-mercaptoethanol, pH 5.7) כולל אנזימי protoplasting (צלולוזת R-10, 0.6% התאיים RS ו 0.4% macerozyme R-10 1.2%) וRNase ומעכבי תעתיק (1 × ProtectRNA ו10 מיקרוגרם / המ&quot;ל actinomycin D); עדינות להפריד את העלים ורצועות ואקום לחדור ל2 × 5 דקות. </li><li style=";text-align:right;direction:rtl"> צלחת פטרי מקום בהקפה ייקרה להגדיר עד 90 סל&quot;ד בטמפרטורת חדר וprotoplast עבור שעות 3-4. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> במהלך הדגירה את רצועות עלים צריכות להיות מופרדות אחד מהשני, על ידי שימוש בסט של פינצטה השטוחה, במחצית מרווחים לפי השעה. </li></ol></li><li style=";text-align:right;direction:rtl"> הנח 70 מיקרומטר תא מסננת (הפישר סיינטיפיק) בצינור מ&quot;ל 50 ועדינות לסנן פתרון protoplasting דרך. הפעולה זו תסיר את רצועות עלים, שתישארנה בידי המסננת ובמקביל לאפשר את protoplasts לעבור. </li><li style=";text-align:right;direction:rtl"> שוטף את רצועות עלים עם 4 פתרון מ&quot;ל ועדינות מסנן דרך אותה המסננת. </li><li style=";text-align:right;direction:rtl"> העבירו את protoplasts לתוך צינורות תחתונים עגולים וחובצה את פתרון protoplast ב 300 XG למשך 5 דקות לגלולה את protoplasts. </li><li style=";text-align:right;direction:rtl"> בעדינות לשאוב אותו במידה של supernatant ככל האפשר מבלי להפריע לprotoplasts. </li><li style=";text-align:right;direction:rtl"> שטוף את protoplasts עם פתרון 5 מ&quot;ל וצנטריפוגה XG ב 300 למשך 5 דקות. הסרת supernatant </li><li style=";text-align:right;direction:rtl"> Resuspend את protoplasts בנפח מתאים לפתרון, באמצעות פיפטה פסטר או טיפ P1000 חתך. </li></ol> 2. FACS של Protoplasts עלים </p&gt; <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מייד לפני המיון, resuspend את protoplasts באמצעות (ללא חתך) P1000 קצה להימנע protoplasts clumping יחד. </li><li style=";text-align:right;direction:rtl"> העברת protoplasts לצינור מיון 50 מיקרומטר filcon מסנן (BD Biosciences) ולדלל מתאימים כדי למנוע סתימת הנחיר של סדרן התא. את protoplasts מסודר באמצעות פיית מיקרומטר 100 בלחץ של 20 אטמוספרות (נדן) ו21-21.5 psi (מדגם), בתדר של 39.2 קילוהרץ ושיעור אירועים של &lt;4000 (הגדרות אלה הן אופטימליות על סדרן תא זרם BD . אופטימיזציה (BD Biosciences) על מכונות מיון תא אחרות ייתכן שתצטרך התאמות להגדרות אלה). </li><li style=";text-align:right;direction:rtl"> protoplasts החיובי GFP מזוהה באמצעות 488 ננומטר ארגון ליזר והתוויית הפלט מ580 / 30 bandpass המסנן (כתום) לעומת מסנן bandpass 530/40 (ירוק). protoplasts החיובי GFP יהיה ב580 אוכלוסיית 530/low הגבוהה, עם protoplasts הלא GFP ב580 אוכלוסייה 530 הנמוכות / נמוכה ומת / protoplasts הגוסס ופסולת בגובה 580 popuרח (איור 2). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בעת מיון protoplasts שממנו יהיה חילוץ רנ&quot;א, protoplasts יש למיין ישירות לתוך לפחות 4 כרכים של חיץ תמוגה מכיל סוכן צמצום (למשל β-mercaptoethanol). בנוסף, בפעם הסוג של מדגם יחיד צריכה להיות מוגבלת ל20-30 דקות, ועד למקסימום של 2-3 דגימות מעובד בכל זמן נתון. </li><li style=";text-align:right;direction:rtl"> להדמיה של protoplasts הממוין, את protoplasts יש למיין ישירות לתוך לפחות 8 כרכים של פתרון ושנאסף לאחר מכן על ידי צנטריפוגה לרכז את protoplasts. </li></ol></li></ol> 3. נציג תוצאות פרוטוקול זה מתאר שיטה לקבלת protoplasts מעלי ארבידופסיס, המשמשים למיון תא הופעל פלואורסצנטי (איור 1). דור Protoplast בנוכחות RNase ומעכבי תעתיק מונע f התאיםrom הרכבת תגובת תעתיק. זה עושה לי תוצאה מהוליד רב protoplasts המת והגוסס, אשר יש רמה משמעותית של autofluorescence. כשממיין את protoplasts הוכן בשיטה זו לכן זה מאוד נפוץ לראות כמה אוכלוסיות שונות בגרפים של 580 ננומטר לעומת קרינת ננומטר 530 שמש למיון. דוגמאות לכך, יחד עם שערי המיון השתמשו בפרוטוקול זה מוצגות באיור 3. Protoplasts ניתן למיין ל8 כרכים של פתרון ונאסף להדמיה כדי לאמת את ההעשרה. האיור 2G מראה דוגמה לכך באמצעות קו TP382, המבטא GFP בתאי השמירה. דוגמאות לתשואות שהשיגו בשיטה זו, היא לפני והן אחרי ההגברה, מוצגים בטבלת 1. הסכומים שהתקבלו מספיקים להגברת שימוש במערכת Ovation פיק WTA (500 pg-50 ng) ולכן זה<html> ניתוח ubsequent ידי אחד qPCR (איור 4), רצף הדור הבא או microarray. <img alt="איור 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> איור 1. עבודה כוללת לניסוי. 1) הקציר מותיר ריבית מלהביע GFP קו ארבידופסיס. 2) לחתוך במהירות לתוך ~ 1 רצועות רחבות מ&quot;מ ולהעביר באופן מיידי את אלה לפתרון והוואקום protoplasting לחדור. 3) דגירה עבור שעות 3-4. 4) בעדינות פתרון תסנין protoplast דרך מסנן מיקרומטר 70, להעביר לעגל צינורות תחתונים וprotoplasts גלולה ידי צנטריפוגה. 5) מייד לפני המיון, protoplasts resuspend והעברה לצינור מיון דרך 50 מיקרומטר מסנן. 6) protoplasts קיימא שלילי GFP מיין GFP חיובי ו. 7) Protoplasts כעת ניתן לנתח אם באופן חזותי או באמצעות טכניקות כגון qPCR, רצף הדור הבא או microarray. together.within עמודים = &quot;תמיד&quot;&gt; <img alt="איור 2" src="/files/ftp_upload/4214/4214fig2.jpg" /> איור 2. את KC464, KC274 וTP382 הקווים השתמשו במחקר זה. א) סעיף רוחבי של KC464 עלה מראה ביטוי של GFP באפידרמיס adaxial. B) Protoplasts נגזר מKC464 עלים. ג) סעיף רוחבי של KC274 עלה מראה ביטוי של GFP בכלי הדם. ד) Protoplasts נגזר מKC274 עלים. E) עלה TP382 מראה ביטוי של GFP בתאי השמירה. F) Protoplasts נגזר מTP382 עלים. ז) דוגמה להעשרה הושגה על ידי FACS של GFP להביע תאי שמירה ברקע המורכב של תאי עלים, מראה GFP המכיל protoplasts מ580 אוכלוסיית 530/low הגבוהה של protoplasts נגזר מTP382 עלים. AF: תמונות confocal מיקרוסקופ; G: תמונת מיקרוסקופ פלואורסצנטי. ברי קנה מידה בתוך תמונות הם 50 מיקרומטר. <img alt="איור 3" src="/files/ftp_upload/4214/4214fig3.jpg" /><html> איור 3. FACS חלקות נקודת רכישה אופייניות של הפלט מ580 / 30 ננומטר (כתום) לעומת ננומטר 530/40 (ירוק) מסנני bandpass (סדרן תא זרם BD). את שערי המיון המוצג הם אלה משמשות בדרך כלל במיון. א) עלילת דוט של Col-4 protoplasts עלים נגזרים, protoplasted בהיעדר מעכבים, מראה 580 אוכלוסיית 530/low יחידה ונמוכה. B) עלילת דוט מWT protoplasts Col-4 עלים נגזר, protoplasted בנוכחות מעכבים, מראה שינוי ב580 פלואורסצנטי בשל לחץ וצביעה על ידי המעכבים. הספירה) דוט חלקות protoplasts נגזר עלים מKC74, KC464 וTP382 קווים, בהתאמה, protoplasted בנוכחות מעכבים, מראים GFP המכיל אוכלוסיות ב530/low הגבוה 580 אוכלוסיות. את האחוזים של האירועים בGFP (הגבוה 530/low 580) אוכלוסיות נתונים. <a href="http://www.jove.com/files/ftp_upload/4214/4214fig3large.jpg" target="_blank">לחץ כאן לצפייה בדמות גדולה.</a> e_content &quot;fo: לשמור-together.within עמודים =&quot; תמיד &quot;&gt; <img alt="איור 4" src="/files/ftp_upload/4214/4214fig4.jpg" /> איור 4. ביטוי של GFP בשברי האוכלוסייה המגודרים היציגים כפי שמוצג באיור 3. שתיים ביולוגיים משכפל התקבלו לכל סוג חלקיק, מוגבר באמצעות Ovation פיק WTA המערכת וqPCR באמצעות פריימרים ספציפיים GFP (טבלה 2) אז בוצע. ערכים המוצגים הם (אדום) את הערכים הגבוהים ביותר, הנמוכים ביותר (ירוק) וממוצע יחסית. 580 האוכלוסייה הגבוהה הייתה במקרה זה נחצה לשניים, נמוך 530/low 580 ו530/low גבוה 580, שללשכפל ביולוגי יחיד היה בשימוש, כך שרק הערך היחיד שהיא מוצגת. Act2 (At3g18780) שמש כתקן עבור כל המדגמים. עלים: כל עלה. לא ממוין: protoplasts לא ממוין. GFP1: 530/low גבוה 580 וRest1: 530/low הנמוך 580, GFP2: 530/high הגבוה 580 וRest2: 530/high הנמוך 580, כפי שמתואר באיור 3 והוספה. התוצאות הן אימות of הערכות אופטיות של תוכן תא ה-GFP בשברים הממוינים (למשל 2G איור). <a href="http://www.jove.com/files/ftp_upload/4214/4214fig4large.jpg" target="_blank">לחצו כאן לצפייה בדמות גדולה.</a> <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> מדגם </td><td> מספר עלים </td><td> מספר תאים </td><td> RNA תשואה (נ&quot;ג) </td><td> RNA תשואה (מוגבר; ng) </td></tr><tr><td> עלה שלם B עלה השלם </td><td> 1 1 </td><td> - - </td><td> 8001 10525 </td><td> 4623 *** 4572 *** </td></tr><tr><td> protoplasts לא ממוין B protoplasts Unsorted </td><td> 5 5 </td><td> - - </td><td> 2433 2625 </td><td> 1152 *** 3321 *** </td></tr><tr><td> GFP1 Rest1 </td><td> 15 </td><td> 6039 (0.39% *) 55389 (6.40% *) </td><td> - ** - ** </td><td> 861 489 </td></tr><tr><td> GFP1 B Rest1 B </td><td> 15 </td><td> 10783 (0.63% *) 57040 (7.49% *) </td><td> - ** - ** </td><td> 537 420 </td></tr><tr><td> GFP2 Rest2 </td><td> 15 </td><td> 18337 (1.49% *) 62405 (73.49% *) </td><td> - ** - ** </td><td> 360 411 </td></tr></tbody></table> לוח 1. דוגמאות שנאספו ונותחו בעזרת FACS עם qPCR כדי לקבוע איזה חלק הכיל protoplasts החי GFP להביע-. כמו כן, נכללת בטבלה זו היא מוחלטת תשואת RNA בng לפני ואחרי ההגברה עם Ovation פיק WTA המערכת (NuGEN). GFP1, GFP2, Rest1 וRest2 שברים כמוצגים בעלון באיור 4. * אחוז מהתאים של טווח סוג התא הכולל ניתן בסוגריים ליד מספר התאים בשבריר. אחוזים אלה אינם קשורים לאחד את השני לכל דגימה כסוג FACS פועל לשברים &quot;לנוח&quot; נעצרו מוקדם יותר לשברי GFP עקב המספר הגדול בהרבה של תאי מנוחה שנאספו. ** 50 ng משמש כקלט להגברת תגובות, לפי הפרוטוקול של היצרן. <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> תחל </td><td> רצף </td></tr><tr><td> mGFP5-ER.fw </td><td> GCCTGAGGGATACGTGCAGGAGA </td></tr><tr><td> mGFP5-ER.rv </td><td> TGGCGGGTCTTGAAGTTGGCT </td></tr><tr><td> ACT2.fw </td><td> GCCATCCAAGCTGTTCTCTC </td></tr><tr><td> ACT2.rv </td><td> GCCATCCAAGCTGTTCTCTC </td></tr></tbody></table> לוח 2. פריימרים qPCR.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

אין ניגודי האינטרסים הכריזו.

כבר תארנו שיטה המאפשרת שימוש בצמחי ארבידופסיס מבטאים GFP את העלים לדור protoplast ומיון התא הבא באמצעות FACS. שיטה זו מניבה כמויות מספיקות של רנ&quot;א שישמש להגברה ולכן לאחר ניתוח על ידי אחד או qPCR microarray. השברים הממוינים מועשרים לתאי GFP המכיל, כפי שהוכיחו qPCR (איור 2). כדי להשיג תשואות גבוהות של protoplasts חיות זה הוא קריטי לעבודה במהירות במהלך השלבים הראשונים של התהליך, עד שרצועות העלים היו ואקום הסתנן עם פתרון protoplast מעכב המכיל. בנוסף, בעת יצירת רצועות עלי 1 מ&quot;מ זה מאוד חשוב לחתוך או לחתוך את העלים ולא &quot;צ&#39;ופ&quot; או לכתוש אותן, כפי שזה מוביל לפגיעה מוגזמת ובכך תשואת protoplast נמוכה יותר. הבדל קריטי בין השיטה המתוארת כאן וpublishe האחרשיטות d היא השימוש במעכבי RNase ומעכבי תעתיק. רוב השיטות שפותחו לשורשי ארבידופסיס, שממנו ניתן להפיק protoplasts בקלות רבה יותר. עם זאת, כשעובד עם עלים, למעט mesophyll, יש צורך להגדיל את זמן דור protoplast. לכן חשוב לכלול מעכבים אלה כדי להגן מפני שינויים בביטוי גנים כתוצאה מטיפול protoplast הדור עוצמה (מידע לא מוצג). עם זאת, נוכחותם של המעכבים מובילה לחוסר יכולת לפתח תגובת שעתוק, או על ידי החלפת גנים או לבטל, העשוי להפוך את protoplasts פגיע יותר כמו זה מוביל לאובדן הגמישות שבה כדי לאזן את הלחצים של protoplasting הליך. יש לנו להשתמש בשיטה המתוארת כאן בהצלחה עם מספר GFP-לבטא קווי ארבידופסיס. חשוב מכך, יש לנו להשתמש בשיטה זו עם קווי GFP להביע GFP באופן חזק בהגרעין, או הרבה יותר חלש באופן cytosolic non-localized/diffuse, כפי שקורה עם KC464 וKC274 קווים המשמשים כאן. שני הסוגים של קווים תואמים את השיטה ואת תשואת שברים מועשרים ברמה גבוהה של protoplasts GFP להביע-(איור 2 ו 3). השיטה יכולה להתאים בקלות לfluorophores האחר, אם כי יש לבחור fluorophore לניאון שהוא שונה באופן משמעותי מautofluorescence של תאים מתים / למות כדי לשמר את היכולת לבחור בתאים חיים.

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> שם המגיב </td><td> חברה </td><td> מספר קטלוגים </td></tr><tr><td> Cellulase R-10 </td><td> Melford </td><td> C8001 </td></tr><tr><td> Cellulase RS </td><td> Melford </td><td> C8003 </td></tr><tr><td> Macerozyme R-10 </td><td> Melford </td><td> M8002 </td></tr><tr><td> BSA </td><td> סיגמה אולדריץ </td><td> A3912 </td></tr><tr><td> ProtectRNA </td><td> סיגמה אולדריץ </td><td> R7397 </td></tr><tr><td> Actinomycin D </td><td> סיגמה אולדריץ </td><td> A1410 </td></tr><tr><td> מסננת תא 70 מיקרומטר </td><td> דיג </td><td> FB35181 </td></tr><tr><td> 50 מיקרומטר filcon מסנני כוס מסוג </td><td> BD Biosciences </td><td> 340630 </td></tr></tbody></table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

לאחר תחילת primordium העלה, הצטברות ביומסה נשלטת בעיקר על ידי תרבות של תאים והתרחבות העלים 1. עם זאת, עלה ארבידופסיס הוא איבר מורכב מורכבים מסוגים רבים ושונים של תאים וכמה מבנים. במקביל, עלה הגידול מכיל תאים בשלבים שונים של פיתוח, עם תאים הרחוקים מהפטוטרת להיות הראשון לעצור את ההרחבה ולעבור הזדקנות 1. תאים שונים בתוך העלה, אפוא, חלוקה, מאריכים או מבדל; פעיל, לחוץ או מת; ו / או להגיב לגירויים בתת קבוצות של הסוג הסלולרי שלהם בכל זמן נתון. זה עושה את המחקר הגנומי של מאתגר עלה: למשל בעת ניתוח נתוני ביטוי מעלים שלמים, אותות מרשתות גנטיות הפועלות באזורים ברורים סלולריים תגובה או סוגי תאים יהיה מבולבל, וכתוצאה מפרופיל מדויק שנוצר. לכתובת זו, שלשיטות everal כבר תאר המאפשרות לימודים של ביטוי גני התא ספציפי. אלה כוללים microdissection ליזר לכידה (LCM) 2 או צמחים המבטאים GFP משמשים למיון לאחר פלואורסצנטי הופעל תא (FACS) 3,4, המערכת השלמה שתוארה לאחרונה למשקעים גרעיניים 5 ו immunoprecipitation של 6 polysomes הדור וprotoplast. FACS שמש בהצלחה במשך מספר מחקרים, כולל ההצגה שזהות התא והמרחק מקצה השורש הייתה השפעה משמעותית על פרופילי הביטוי של מספר רב של גנים 3,7. FACS של קווי GFP יש גם שמש כדי להדגים בקרת שעתוק תא ספציפי בתגובות חנקן שורש ופיתוח לרוחב שורש 8, מתח מלח הפצת אוקסין 9 בשורש 10 וליצור מפה של ביטוי גני meristem הקודקוד לירות ארבידופסיס 11. למרותFACS יש בעבר נהג למיין protoplasts נגזר העלה ארבידופסיס מבוסס על autofluorescence 12,13, עד כה השימוש בFACS על קווי ארבידופסיס מבטאים GFP בעלים כבר מאוד מוגבל 4. בפרוטוקול הבא אנו מתארים שיטה לקבלת protoplasts העלה ארבידופסיס התואמים FACS תוך מזעור ההשפעה של משטר דור protoplast. אנחנו מדגימים את השיטה באמצעות קו ארבידופסיס KC464, שמביע GFP באפידרמיס adaxial 14, KC274 הקו, אשר מביעים GFP ברקמת כלי הדם 14 וקו ארבידופסיס TP382, שמבטא GFP כפול לבנות צמוד לאות לוקליזציה גרעינית ב את תאי שמירה (מידע לא מוצג; איור 2). כרגע אנחנו משתמשים בשיטה זו כדי ללמוד גם ביטוי תא מסוג מסוים במהלך פיתוח ומתח, כמו גם אוכלוסיות תאים הטרוגניים בשלבים שונים של הזדקנות.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

שיטה להפקה<em&gt; ארבידופסיס</em&gt; Protoplasts עלים התואמים את מיון תא הופעל פלואורסצנטי (FACS), המאפשר ללימודים של אוכלוסיות תאים ספציפיות. שיטה זו תואמת לכל<em&gt; ארבידופסיס</em&gt; קו שמבטא GFP בתת קבוצה של תאים.

ניתוח ספציפי של תא<em&gt; ארבידופסיס</em&gt; עלים באמצעות מיון תא הופעל פלואורסצנטי

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

cell-specific-analysis-arabidopsis-leaves-using-fluorescence

Research

JoVE Journal

Biology

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

15.1K Views.  University of Warwick. שיטה להפקה ארבידופסיס Protoplasts עלים התואמים את מיון תא הופעל פלואורסצנטי (FACS), המאפשר ללימודים של אוכלוסיות תאים ספציפיות. שיטה זו תואמת לכל ארבידופסיס קו שמבטא GFP בתת קבוצה של תאים.

Video: Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

מיון פלואורסצנטי תא פעיל של Protoplasts הצמח

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

חקירת רקמות ו איברים ספציפיים התגובות Phytochrome באמצעות FACS בסיוע נייד מסוג פרופיל ביטוי ספציפי ארבידופסיס thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification procedures. As an alternative, lipids can be coated on flat surfaces as used for lipid ELISA and Plasmon resonance spectroscopy. However, surface coating lipids do not form microdomain structures, which may be important for the lipid binding properties. Further, these methods do not allow for the purification of larger amounts of proteins binding to their target lipids.
 To overcome these limitations of testing lipid protein interaction and to purify lipid binding proteins we developed a novel method termed lipid vesicle-mediated affinity chromatography using magnetic-activated cell sorting (LIMACS). In this method, lipid vesicles are prepared with the target lipid and phosphatidylserine as the anchor lipid for Annexin V MACS. Phosphatidylserine is a ubiquitous cell membrane phospholipid that shows high affinity to the protein Annexin V. Using magnetic beads conjugated to Annexin V the phosphatidylserine-containing lipid vesicles will bind to the magnetic beads. When the lipid vesicles are incubated with a cell lysate the protein binding to the target lipid will also be bound to the beads and can be co-purified using MACS. This method can also be used to test if recombinant proteins reconstitute a protein complex binding to the target lipid. 
 We have used this method to show the interaction of atypical PKC (aPKC) with the sphingolipid ceramide and to co-purify prostate apoptosis response 4 (PAR-4), a protein binding to ceramide-associated aPKC. We have also used this method for the reconstitution of a ceramide-associated complex of recombinant aPKC with the cell polarity-related proteins Par6 and Cdc42. Since lipid vesicles can be prepared with a variety of sphingo- or phospholipids, LIMACS offers a versatile test for lipid-protein interaction in a lipid environment that resembles closely that of the cell membrane. Additional lipid protein complexes can be identified using proteomics analysis of lipid binding protein co-purified with the lipid vesicles.

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

To test the interaction of a protein with its target lipid we used MACS and Annexin V-conjugated magnetic beads and lipid vesicles synthesized from the target lipid and Annexin V-binding phosphatidylserine. Proteins bound to the target lipid are co-purified and analyzed after elution from the beads.

שלפוחיות בתיווך זיקה ליפידים כרומטוגרפיה באמצעות Cell מגנטי מיון פעיל (LIMACS): שיטה חדשה לנתח חלבון, שומנים אינטראקציה

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. 
Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Environmental bacterioplankton are incubated with a model dissolved organic carbon (DOC) compound and a DNA labeling reagent, bromodeoxyuridine (BrdU). Afterward, DOC-degrading cells are separated from the bulk community based on their elevated BrdU incorporation using fluorescence activated cell sorting (FACS). These cells are then identified by subsequent molecular analyses.

Bromodeoxyuridine (BrdU) תיוג ומיון לאחר פלואורסצנטי תא פעיל עבור זיהוי, תרבות עצמאית של פחמן אורגני מומסים משפיל Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of different cell types in vitro and in vivo.1-5 Although there are literally thousands of publications using such dyes, some of the most commonly encountered cell tracking applications include monitoring of:
<ol>
	<li>stem and progenitor cell quiescence, proliferation and/or differentiation6-8</li>
	<li>antigen-driven membrane transfer9 and/or precursor cell proliferation3,4,10-18 and</li>
	<li>immune regulatory and effector cell function1,18-21.</li>
</ol>
Commercially available cell tracking dyes vary widely in their chemistries and fluorescence properties but the great majority fall into one of two classes based on their mechanism of cell labeling. "Membrane dyes", typified by PKH26, are highly lipophilic dyes that partition stably but non-covalently into cell membranes1,2,11. "Protein dyes", typified by CFSE, are amino-reactive dyes that form stable covalent bonds with cell proteins4,16,18. Each class has its own advantages and limitations. The key to their successful use, particularly in multicolor studies where multiple dyes are used to track different cell types, is therefore to understand the critical issues enabling optimal use of each class2-4,16,18,24.
The protocols included here highlight three common causes of poor or variable results when using cell-tracking dyes. These are:
<ol>
	<li>Failure to achieve bright, uniform, reproducible labeling. This is a necessary starting point for any cell tracking study but requires attention to different variables when using membrane dyes than when using protein dyes or equilibrium binding reagents such as antibodies.</li>
	<li>Suboptimal fluorochrome combinations and/or failure to include critical compensation controls. Tracking dye fluorescence is typically 102 - 103 times brighter than antibody fluorescence. It is therefore essential to verify that the presence of tracking dye does not compromise the ability to detect other probes being used.</li>
	<li>Failure to obtain a good fit with peak modeling software. Such software allows quantitative comparison of proliferative responses across different populations or stimuli based on precursor frequency or other metrics. Obtaining a good fit, however, requires exclusion of dead/dying cells that can distort dye dilution profiles and matching of the assumptions underlying the model with characteristics of the observed dye dilution profile.</li>
</ol>
Examples given here illustrate how these variables can affect results when using membrane and/or protein dyes to monitor cell proliferation.

Successful use of cell tracking dyes to monitor immune cell function and proliferation involves several critical steps. We describe methods for: 1) obtaining bright, uniform, reproducible label-ing with membrane dyes; 2) selecting fluorochromes and data acquisition conditions; and 3) choosing a model to quantify cell proliferation based on dye dilution.

אופטימיזציה שיטות דוגמנות מכתימה והפצת נשק לניטור חלוקת תא באמצעות צבעי מעקב סלולרי

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their prominent presence is often associated with poor prognosis1,2. CAFs are an activated subpopulation of stromal fibroblasts, many of which express the myofibroblast marker &alpha;-SMA3. CAFs originate from local tissue fibroblasts as well as from bone marrow-derived cells recruited into the developing tumor and adopt a CAF phenotype under the influence of the tumor microenvironment4. CAFs were shown to facilitate tumor initiation, growth and progression through signaling that promotes tumor cell proliferation, angiogenesis, and invasion5-8. We demonstrated that CAFs enhance tumor growth by mediating tumor-promoting inflammation, starting at the earliest pre-neoplastic stages9. Despite increasing evidence of the key role CAFs play in facilitating tumor growth, studying CAFs has been an on-going challenge due to the lack of CAF-specific markers and the vast heterogeneity of these cells, with many subtypes co-existing in the tumor microenvironment10. Moreover, studying fibroblasts in vitro is hindered by the fact that their gene expression profile is often altered in tissue culture11,12 . To address this problem and to allow unbiased gene expression profiling of fibroblasts from fresh mouse and human tissues, we developed a method based on previous protocols for Fluorescence-Activated Cell Sorting (FACS)13,14. Our approach relies on utilizing PDGFR&alpha; as a surface marker to isolate fibroblasts from fresh mouse and human tissue. PDGFR&alpha; is abundantly expressed by both normal fibroblasts and CAFs9,15 . This method allows isolation of pure populations of normal fibroblasts and CAFs, including, but not restricted to &alpha;-SMA+ activated myofibroblasts. Isolated fibroblasts can then be used for characterization and comparison of the evolution of gene expression that occurs in CAFs during tumorigenesis. Indeed, we and others reported expression profiling of fibroblasts isolated by cell sorting16. This protocol was successfully performed to isolate and profile highly enriched populations of fibroblasts from skin, mammary, pancreas and lung tissues. Moreover, our method also allows culturing of sorted cells, in order to perform functional experiments and to avoid contamination by tumor cells, which is often a big obstacle when trying to culture CAFs.

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

Cancer Associated Fibroblasts (CAFs) facilitate tumor initiation, growth and progression through signaling that promotes proliferation, angiogenesis, and inflammation. Here we describe a method to isolate pure populations of normal fibroblasts and CAFs from fresh mouse and human tissues by cell sorting, using PDGFR&#x03B1; as a surface marker.

בידוד של פיברובלסטים נורמלים והסרטן הקשורים מרקמות טריות על ידי מיון תא הופעל פלואורסצנטי (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.

Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.

תא בודד מיקרו-שאיפה כאסטרטגיה חלופית מיון תאים פלואורסצנטית מופעל עבור הפרדה וירוס ענק תערובת

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...

Fluorescence-Activated Cell Sorting for the Isolation of Scleractinian Cell Populations

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the mechanisms are not well understood. To investigate coral response to stressors, we need tools for analyzing cellular responses. In particular, we need tools that facilitate the application of functional assays to better understand how cell populations are reacting to stress. In the current study, we use fluorescence-activated cell sorting (FACS) to isolate and separate different cell populations in stony corals. This protocol includes: (1) the separation of coral tissues from the skeleton, (2) creation of a single cell suspension, (3) labeling the coral cells using various markers for flow cytometry, and (4) gating and cell sorting strategies. This method will enable researchers to work on corals at the cellular level for analysis, functional assays, and gene expression studies of different cell populations.

Corals create biodiverse ecosystems important for both humans and marine organisms. However, we still do not understand the full potential and function of many coral cells. Here, we present a protocol developed for the isolation, labeling, and separation of stony coral cell populations.

תא מיון המופעל על ידי קרינה פלואורסצנטית לבידוד של אוכלוסיות תאים בלובן המין

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the ...

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.

This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

לבודד רנ"א ספציפיים לסוג תא מדגימות רקמות הטרוגניות קפואות ללא מיון תאים

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

Fluorescence Lifetime Macro Imager for Biomedical Applications

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ranging from solid-state, O2-sensitive coatings to live animal tissue samples stained with soluble O2-sensitive probes. In particular, the nanoparticle-based near-infrared probe NanO2-IR, which is excitable with a 625 nm light-emitting diode (LED) and emits at 760 nm, was used. The imaging system is based on the Timepix3 camera (Tpx3Cam) and the opto-mechanical adaptor, which also houses an image intensifier. O2 phosphorescence lifetime imaging microscopy (PLIM) is commonly required for various studies, but current platforms have limitations in their accuracy, general flexibility, and usability.
The system presented here is a fast and highly sensitive imager, which is built on an integrated optical sensor and readout chip module, Tpx3Cam. It is shown to produce high-intensity phosphorescence signals and stable lifetime values from surface-stained intestinal tissue samples or intraluminally stained fragments of the large intestine and allows the detailed mapping of tissue O2 levels in about 20 s or less. Initial experiments on the imaging of hypoxia in grafted tumors in unconscious animals are also presented. We also describe how the imager can be re-configured for use with O2-sensitive materials based on Pt-porphyrin dyes using a 390 nm LED for the excitation and a bandpass 650 nm filter for emission. Overall, the PLIM imager was found to produce accurate quantitative measurements of lifetime values for the probes used and respective two-dimensional maps of the O2 concentration. It is also useful for the metabolic imaging of ex vivo tissue models and live animals.

This paper describes the use of a new, fast optical imager for the macroscopic photoluminescence lifetime imaging of long decay emitting samples. The integration, image acquisition, and analysis procedures are described, along with the preparation and characterization of the sensor materials for the imaging and the application of the imager in studying biological samples.

Fluorescence Lifetime Macro Imager עבור יישומים ביו-רפואיים

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ...