עבודה זו נתמכה על ידי הקרן הלאומית לאווירונאוטיקה וחלל מנהל מערב וירג&#39;יניה שטח גרנט Consortium (נאס&quot;א WVSGC), קרן סיסטיק פיברוזיס (CFF-YU11G0) ו-NIH P20RR016477 וP20GM103434 לרשת רעיון המערב וירג&#39;יניה ביו רפואית מצוינות מחקר. אנו מודים Vonya מ &#39;אייזינגר לסיוע הטכני בעבודה זו.

1. הכנה של זני חיידקים וBiparental נטיה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחסן E. coli SM10/λpir/pFAC ב 5 מיליליטר של מרק לוריא (LB) בתוספת 15 מיקרוגרם / מיליליטר של gentamycin ומקום בחממה רועדת הלילה בשעה 37 ° C. </li><li style=";text-align:right;direction:rtl"> לחסן פ PAO1 aeruginosa המתח ב 5 מיליליטר של LB, ומקום בחממה רועדת הלילה בשעה 42 ° C. </li><li style=";text-align:right;direction:rtl"> מדוד OD 600 של תרבויות לילה ולערבב כמויות שווה של PAO1 וא coli pFAC כך שהנפח הסופי הוא בין 1-1.4 מיליליטר. </li><li style=";text-align:right;direction:rtl"> תערובת צנטריפוגה ב 6,000 XG במשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> בינתיים, ייבוש צלחות LB לנטייה: להשאיר צלחות פתוחות באינקובטור ב 37 מעלות צלזיוס למשך 10-15 דקות. </li><li style=";text-align:right;direction:rtl"> הסר את כל אבל 50 μl של supernatant מתערובת תא. </li><li style=";text-align:right;direction:rtl"> Resuspend התא גלולה ב μl 50 הנותר של supernatant וטפטף על צלחת LB יבשה בטיפה אחת קומפקטית. </li><li style=";text-align:right;direction:rtl"> למקם את הצלחת בזהירות במנדף לייבוש (impoהערה RTANT: אל תתנו לתאים משתרעים על פני הצלחת, זה יהיה להקטין באופן משמעותי את היעילות של נטיה). </li><li style=";text-align:right;direction:rtl"> ברגע שרביב הוא יבש, להפוך את צלחת LB ו לדגור על 37 מעלות צלזיוס למשך 4-6 שעות. </li><li style=";text-align:right;direction:rtl"> בעוד תערובת התא היא דוגרת, להכין צלחות פיא (150 OD x 15 מ&quot;מ) גדולות עם 300 מיקרוגרם / מיליליטר של gentamycin. לפני השימוש, הסר את כל לחות שיורית על ידי הצבת באינקובטור ב 37 מעלות צלזיוס למשך 15-20 דקות. </li><li style=";text-align:right;direction:rtl"> לאחר הדגירה של תערובת התא היא מלאה, לאסוף את התאים באמצעות לולאת חיסון סטרילי ובצינור microcentrifuge המכיל 1 מיליליטר LB ומערבולת, או פיפטה, לערבב ביסודיות. </li><li style=";text-align:right;direction:rtl"> מורחים את התאים באופן שווה על גבי צלחות PIA הגדולות מכילות 300 מיקרוגרם / מיליליטר gentamycin. (חשוב: לצעד זה, עדיף להוסיף כמויות הולך וגדל של תערובת התאים להפריד צלחות (למשל פלייט 1: 10 μl, 2 פלייט: 50 μl, צלחת 3: 100 μl, צלחת 4: 500 μl, וכו &#39;) . </li><li style=";text-align:right;direction:rtl"> דגירה הלילה בשעה 37° C. </li></ol> 2. זיהוי ובידוד של מושבות רירני <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הסר את הצלחות מן החממה ולבחון למושבות רירני. </li><li style=";text-align:right;direction:rtl"> לבודד מושבה רירני יחידה ופס לבידוד על צלחות קטנות (100 OD x 10 מ&quot;מ) עם PIA ו300 / מיליליטר מיקרוגרם של gentamycin. </li><li style=";text-align:right;direction:rtl"> דגירה הלילה בשעה 37 ° C. </li><li style=";text-align:right;direction:rtl"> חזור על שלב 2.2 על תרבות הלילה הקודמת. </li><li style=";text-align:right;direction:rtl"> חזור על שלבים 2.2-2.4 עוד פעמיים כדי לקבוע את היציבות של בודד רירני. </li><li style=";text-align:right;direction:rtl"> לאחר שלב בודד סופי, לחסן 4.5 מיליליטר של LB עם מושבה רירני יחידה ודגירה שבייקרה לילה בשעה 37 ° C. </li><li style=";text-align:right;direction:rtl"> למחרת, תווית 3 microcentrifuge צינורות עבור כל מוטציה רירני. </li><li style=";text-align:right;direction:rtl"> הכן שני 1.25 aliquots מיליליטר של תרבות הלילה ל -2 צינורות להפקת DNA גנומי וזיהוי של אתר הכנסת transposon (ראה פרוטוקול 3). </li><li style=";text-align:right;direction:rtl"> בנוסף, בארכיון בכל מוטציה רירני ידי pipetting 1 מיליליטר תרבות הלילה לתוך appropriatcryovial איליי שכותרת המכילה נפח שווה של 10% חלב דל שומן. חנות ב -86 ° C. </li></ol> 3. הגבלת gDNA עיכול וקשירה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחלץ gDNA ממוטצית רירני באמצעות כל שיטה מועדפת (לדוגמא. פנול, כלורופורם, טור ספין, וכו &#39;). </li><li style=";text-align:right;direction:rtl"> קבע את הריכוז של gDNA, לעכל כולל של 2 מיקרוגרם עם 1 μl של endonuclease ההגבלה סאלי, 0.5 μl של אלבומין בסרום שור, 5 μl של חיץ אנזים סאלי (100 mM NaCl, 50 מ&quot;מ טריס-HCl, 10 מ&quot;מ MgCl 2 , 1 מ&quot;מ Dithiothrietol (DTT), pH 7.9 בטמפרטורת חדר), והנפח המתאים של DH 2 O להשיג בנפח כולל של 50 μl. </li><li style=";text-align:right;direction:rtl"> לעכל דנ&quot;א לילה בשעה 37 ° C. (חשוב:. בהתאם ליעילות של אנזים ההגבלה, ייתכן שיהיה צורך להוסיף μl 1 נוסף כדי לעכל הלילה ולדגור על 37 מעלות צלזיוס למשך 1-2 שעות זאת בנוסף לתקציר בלילה.) </li><li style=";text-align:right;direction:rtl"> לטהר את DIGEה-DNA STED באמצעות כל שיטה מועדפת (לדוגמא טיהור agarose ג&#39;ל, עמודות ספין) וelute עם 25 μl של חיץ. </li><li style=";text-align:right;direction:rtl"> ולקשור את ה-DNA מתעכל על ידי ערבוב 11 μl של DNA מטוהר עם ריכוז המועדף על ~ 10-20 ng / μl, 1.5 μl של קשירת חוצץ (330 pH מ&quot;מ טריס-אצטט 7.5, 660 אצטט mM אשלגן, מגנזיום 100 אצטט מ&quot;מ, 5 מ&quot;מ DTT), 1.5 μl של 100 מ&quot;מ ATP ואנזים דנ&quot;א μl 1. </li><li style=";text-align:right;direction:rtl"> דגירה את התערובת ל15 דקות בטמפרטורת חדר, ולאחר מכן להשבית את האנזים על ידי דוגרים ל15 דקות ב 70 ° C. (הערה: דוגרים את התערובת בטמפרטורת חדר למשך זמן ארוך יותר עשוי להגדיל את ההצלחה של קשירה). </li></ol> 4. PCR ההפוך (iPCR) ורצף ניתוח <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בצע iPCR על מוצר קשירה באמצעות הפעולות הבאות קדימה לאחור פריימרים וthermocycling תנאים: קדימה פריימר (Gm3OUT): GGGCATACGGGAAGAAGTGA -ההפוך פריימר (Gm5OUT): GACTGCCCTGCTGCGTAACA Thermocycler קונדיtions: 1. C ° 94 דקות 1. 2. C ° 94 דקות 1. 3. C ° 58 למשך 2 דקות. 4. C ° 72 למשך 2 דקות. 5. C ° 72 במשך 8 דקות. 6. אחיזת C ° 10. חזור על השלבים 2-4 ל34 מחזורים. (הערה: ניתן לאחסן מוצרי Amplified iPCR ב 4 ° C.) </li><li style=";text-align:right;direction:rtl"> בצע ג&#39;ל אלקטרופורזה agarose כדי לאשר הגברה iPCR מוצלחת. </li><li style=";text-align:right;direction:rtl"> לבצע רצף על מוצר iPCR באמצעות פריימרים Gm3OUT וGm5OUT. אתר ההכנסה ואת הכיוון של himar1 ממופים החוצה. </li></ol>

<ol>
	<li>Govan, J. R., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+pathogenesis+in+cystic+fibrosis:+mucoid+Pseudomonas+aeruginosa+and+Burkholderia+cepacia.">Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.</a> Microbiol. Rev. 60, 539-574 (1996).</li><li>Chitnis, C. E., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+the+alginate+biosynthetic+gene+cluster+of+Pseudomonas+aeruginosa+shows+evidence+of+an+operonic+structure.">Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure.</a> Mol. Microbiol. 8, 583-593 (1993).</li><li>Franklin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+AlgG+is+a+polymer+level+alginate+C5-mannuronan+epimerase.">Pseudomonas aeruginosa AlgG is a polymer level alginate C5-mannuronan epimerase.</a> J. Bacteriol. 176, 1821-1830 (1994).</li><li>Franklin, M. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+analysis+and+cellular+localization+of+the+AlgI,+AlgJ,+and+AlgF+proteins+required+for+O+acetylation+of+alginate+in+Pseudomonas+aeruginosa.">Mutant analysis and cellular localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of alginate in Pseudomonas aeruginosa.</a> J. Bacteriol. 184, 3000-3007 (2002).</li><li>Deretic, V., Gill, J. F., Chakrabarty, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+algD+coding+for+GDPmannose+dehydrogenase+is+transcriptionally+activated+in+mucoid+Pseudomonas+aeruginosa.">Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.</a> J. Bacteriol. 169, 351-358 (1987).</li><li>Mathee, K., McPherson, C. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+the+algT+(algU)-encoded+sigma22+for+expression+of+the+alginate+regulon+in+Pseudomonas+aeruginosa+and+localization+of+its+antagonist+proteins+MucA+and+MucB+(AlgN)..">Posttranslational control of the algT (algU)-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN)..</a> J. Bacteriol. 179, 3711-3720 (1997).</li><li>Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+in+cystic+fibrosis:+role+of+mucC+in+the+regulation+of+alginate+production+and+stress+sensitivity.">Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity.</a> Microbiology. 143, 3473-3480 (1997).</li><li>Martin, D. W., Holloway, B. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+locus+determining+the+mucoid+status+of+Pseudomonas+aeruginosa:+AlgU+shows+sequence+similarities+with+a+Bacillus+sigma+factor.">Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor.</a> J. Bacteriol. 175, 1153-1164 (1993).</li><li>Damron, F. H., Goldberg, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteolytic+regulation+of+alginate+overproduction+in+Pseudomonas+aeruginosa.">Proteolytic regulation of alginate overproduction in Pseudomonas aeruginosa.</a> Mol. Microbiol. 84 (4), 595-607 (2012).</li><li>Browne, P., Barret, M., O'Gara, F., Morrissey, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+prediction+of+the+Crc+regulon+identifies+genus-wide+and+species-specific+targets+of+catabolite+repression+control+in+Pseudomonas+bacteria.">Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria.</a> BMC Microbiol. 10, 300 (2010).</li><li>Damron, F. H., Qiu, D., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pseudomonas+aeruginosa+sensor+kinase+KinB+negatively+controls+alginate+production+through+AlgW-dependent+MucA+proteolysis.">The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis.</a> J. Bacteriol. 191, 2285-2295 (2009).</li><li>Damron, F. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pseudomonas+aeruginosa+regulon+controlled+by+the+sensor+kinase+KinB+and+sigma+factor+RpoN.">Analysis of the Pseudomonas aeruginosa regulon controlled by the sensor kinase KinB and sigma factor RpoN.</a> J. Bacteriol. 194, 1317-1330 (2012).</li><li>Qiu, D., Eisinger, V. M., Rowen, D. W., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+proteolysis+controls+mucoid+conversion+in+Pseudomonas+aeruginosa.">Regulated proteolysis controls mucoid conversion in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 104, 8107-8112 (2007).</li><li>Schurr, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Which+bacterial+biofilm+exopolysaccharide+is+preferred,+Psl+or+alginate.">Which bacterial biofilm exopolysaccharide is preferred, Psl or alginate.</a> J. Bacteriol. 195, 1623-1626 (2013).</li><li>Wong, S. M., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+footprinting+with+mariner-based+transposition+in+Pseudomonas+aeruginosa.">Genetic footprinting with mariner-based transposition in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 10191-10196 (2000).</li><li>Lampe, D. J., Akerley, B. J., Rubin, E. J., Mekalanos, J. J., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hyperactive+transposase+mutants+of+the+Himar1+mariner+transposon.">Hyperactive transposase mutants of the Himar1 mariner transposon.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 11428-11433 (1999).</li></ol>

המחבר Hongwei ד יו הוא קצין המדע הראשי ומייסדים של Progenesis טכנולוגיות, LLC.

חשוב לציין כי בשיטה זו ניתן להשתמש במינים Pseudomonas אחרים עם השינויים הבאים: דגירה פ fluorescens ו פ putida ב30 מעלות צלזיוס, ופ stutzeri על 42 מעלות צלזיוס; פ stuzeri צריך להיות מתורבת על צלחות LB בתוספת 150 מיקרוגרם / מ&quot;ל של gentamycin; על צעד 1.11, פ תאי stutzeri צריכ?...

היכולת של האופורטוניסטי, הפתוגן גראם השלילי Pseudomonas aeruginosa לoverproduce אלגינט היא גורם מרכזי ביכולתה להקים biofilm. ייצור יתר של אלגינט הוא הפנוטיפ המכונה לעתים קרובות כmucoidy. הבידוד של מושבות רירני מספוטה של אנשים לוקים בסיסטיק פיברוזיס (CF) הוא מעיד על זיהום כרוני, והיא קשור באופן ישיר עם ירידה כללית בבריאותו של החולה 1. נכון לעכשיו, הוא הבין כי הרגולציה וייצור של אלגינט בפ aeruginosa מתרחש בעיקר בשני operons. הראשון הוא אופרון biosynthetic אלגינט, המכיל 12 גנים (algD - alg8 - alg44 - algK - alge - algG - algX - algL - algI - algJ - algF - אצה) שאחראים לסינתזה והיצוא של פולימר אלגינט פני periplasm לenvironme תאיNT 2-5. אופרון השני הוא אשכול גנים החל עם גורם סיגמא האלטרנטיבי algU / T וממשיך בmucA, mucB, וmucD. AlgU / T הוא רגולטור חיובי, בעוד mucAB-D מסווגים כרגולטורים שליליים של ייצור אלגינט 6-8. בנוסף, רגולטורים תעתיק, כגון AlgB, AlgQ, AlgR, וRpoN, כמו גם לאחר תעתיק ושינוי שלאחר translational על ידי שליטת catabolite דיכוי, פעילות קינאז (KinB) וproteolysis intramembrane, יש גם הוכחו להיות מעורבים באלגינט הרגולציה 9-14. וקטור transposon מיני himar1 המכונה pFAC נוצר במקור במעבדה של ד&quot;ר Mekalanos בבית הספר לרפואה של אוניברסיטת הרווארד 15. פלסמיד pFAC מורכב מאלמנט transposable המוקף שתי חזרות הפוכות של 27 bps וקלטת gentamycin התנגדות באמצע (aacC1: 534 נ&quot;ב), גן מקודד hyperactive transposase ספן 16, וβ-lactamase גן קידוד (בלה) (איור 1). מידע רצף עבור אלמנט transposable של pFAC זמין במספר הצטרפות GenBank: 13 DQ366300. בpFAC, יש אתר שיבוט מרובה (MCS) מאחורי גן aacC1 המשמש לזיהוי של אתר ההכנסה כרומוזומליות באמצעות PCR ההפוך. אחד יתרונות גדולים בשימוש בtransposon מיני himar1 אין גורמי מארח ספציפיים נדרשים לטרנספוזיציה (mutagenesis). בנוסף, יש שפע גבוה של החדרת אתרי dinucleotide ת&quot;א נמצאים בכל הגנום של פ aeruginosa. לדוגמא, אתרי החדרת dinucleotide ת&quot;א מתרחש 94,404 ו100,229 פעמים בPAO1 (6,264,404 bps, מספר הצטרפות GenBank NC_002516.2) וPA14 (6,537,648 bps; מספר גישת GenBank NC_008463) הגנום, בהתאמה. בגלל השפע של dinucleotide ת&quot;א בגנום, מיני himar1 </em&gt; Transposon יכול לגרום לצפיפות גבוהה וmutagenesis האקראי, שהוא מתאים במיוחד לניתוח של גנים ארסיות והגנים שקבועים בתקנות. באופן תיאורטי, transposon מיני himar1 יכול להכניס לתוך כל גן חיוני בתוך הגנום של פ aeruginosa. זה מספק כ 18 אתרי החדרה ת&quot;א לכל מסגרת קריאה פתוחה בגנום PAO1. כאן אנו מתארים פרוטוקול באמצעות mutagenesis בתיווך transposon מיני himar1 לזהות רגולטורים רומן של mucoidy בפ aeruginosa. באופן ספציפי יותר, אנו biparentally מצומדת וקטור pFAC מכיל transposon מיני himar1 מE. coli SM10/λpir לPAO1 מתח prototrophic nonmucoid. לאחר transposon משולב בגנום, מתח הנמען הוא תרבית על אגר בידוד Pseudomonas טריקלוזן (PIA) המכיל אשר מעכב את הצמיחה של E. coli. לפיכך, ספרייה של מוטציות של <em&gt; פ ניתן לבחור aeruginosa על ידי הגידול בצלחת PIA בתוספת gentamycin ואת הנוכחות של פנוטיפ רירני. שים לב, לעומת מוטציה אינטגרציה בתיווך transposon יהיה אמיתי הפנוטיפ עמיד וcarbenicillin רגיש gentamycin. במחקר זה, כ -80,000 מוטציות החדרת PAO1 היו מבודדות באמצעות ארבעה פעלים נפרדים. אנחנו מכן הוקרנו מבודדים רירני, וקבענו את האתר של הכנסה על ידי עיכול אנזים הגבלה, קשירה והפוכה ה-PCR. ביצענו ניתוח כתם דרום באמצעות קלטת התנגדות gentamycin כמו בדיקה כדי לראות את המספר של החדרה לגנום. אנחנו קבענו כי יותר מ 90% ממוטציות שהושגו לנטיית שימוש בפרוטוקול זה היה עותק אחד בלבד של himar1 בגנום ומוצגים הפנוטיפ עמיד וcarbenicillin רגיש gentamycin. כולל של 32 מבודדים רירני זוהו, 22 שלהם מופו ללוקוסים של פ שונים aeruginosa PAO1כרומוזום. שיעור זה של הכנסה מספק כיסוי הולם לזהות כמה רגולטורים רומן של ייצור יתר אלגינט.

<table border="0" cellpadding="0" cellspacing="0" width="780">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:267px;">Luria Broth</td>
			<td style="width:187px;">Difco</td>
			<td style="width:125px;">240230</td>
			<td style="width:203px;">via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pseudomonas isolation agar</td>
			<td>Difco</td>
			<td>292710</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Small Plates (100 O.D. x 10 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-13</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Large Plates (150 O.D. x 15 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-14</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycerol</td>
			<td>Fisher Scientific</td>
			<td>BP229-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Shaking Incubator</td>
			<td>New Brunswick Scientific</td>
			<td>Innova 4080</td>
			<td>shake at 200 rpm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cabinet Incubator</td>
			<td>VWR</td>
			<td>1540</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Microcentrifuge</td>
			<td>Sorvall</td>
			<td>75-003-287</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SmartSpec Plus Spectrophotometer</td>
			<td>Bio-Rad</td>
			<td>170-2525</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Diposable Inoculation Loops</td>
			<td>Fisher Scientific</td>
			<td>22-363-597</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1.5 mL Microcentrifuge Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-408-129</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">15 mL Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-539-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Skim Milk</td>
			<td>Difco</td>
			<td>DF0032-17-3</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNeasy Blood and Tissue (250)&#160;</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick PCR Purification Kit (250)</td>
			<td>Qiagen</td>
			<td>28106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAprep Spin Miniprep Kit (250)&#160;</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastLink II DNA Ligation Kit</td>
			<td>Epicentre Technologies</td>
			<td>LK6201H</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accu block Digital Dry Bath&#160;</td>
			<td>Labnet</td>
			<td>NC0205808</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sal1, restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0138L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EasyStart Micro 50</td>
			<td>Molecular BioProducts</td>
			<td>6020</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq DNA Polymerase</td>
			<td>New England BioLabs</td>
			<td>M0267L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iCycler, Thermocycler</td>
			<td>Bio-Rad</td>
			<td>170-8740</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LE agarose</td>
			<td>Genemate</td>
			<td>3120-500</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gentamycin Sulfate</td>
			<td>Fisher Scientific</td>
			<td>BP918-1</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
	</tbody>
</table>

identification of novel genes associated with alginate production in pseudomonas aeruginosa using mini-himar1 mariner transposon-mediated mutagenesis

Pseudomonas aeruginosa הוא חיידק גראם שלילי, סביבתי עם יכולות מטבוליות צדדי. פ aeruginosa הוא פתוגן חיידקים אופורטוניסטי הקובע דלקות ריאה כרוניות בחולי סיסטיק פיברוזיס (CF). ייצור יתר של פוליסכריד קופסית נקרא אלגינט, הידוע גם mucoidy, מקדם את הקמתה של biofilms רירני שהם עמידים יותר מאשר תאי פלנקטון לכימותרפיה אנטיביוטיקה והגנה מארחת. בנוסף, ההמרה מnonmucoid לפנוטיפ רירני היא סמן קליני לתחילתה של דלקת כרונית בCF. ייצור יתר אלגינט על ידי פ &#39; aeruginosa הוא תהליך endergonic מיסי אנרגיה בתאים כבד. לכן, ייצור אלגינט מוסדר מאוד בפ aeruginosa. כדי להבין טוב יותר רגולציה אלגינט, אנו מתארים פרוטוקול באמצעות mutagenesis transposon מיני himar1 לזיהוי רגולטור אלגינט רומןים בPAO1 זן אב טיפוס. ההליך מורכב משני שלבים בסיסיים. ראשית, העברנו את transposon מיני himar1 (pFAC) מהמארח א coli SM10/λpir לנמען P. aeruginosa PAO1 באמצעות נטיית biparental ליצור ספריית מוטציה הכנסה בצפיפות גבוהה, אשר נבחרו על צלחות אגר בידוד Pseudomonas בתוספת gentamycin. שנית, אנו הוקרנו ובודדנו את מושבות רירני למפה אתר ההחדרה באמצעות PCR ההפוך באמצעות פריימרים DNA מצביעים החוצה מקלטת gentamycin ורצפי DNA. באמצעות פרוטוקול זה, זיהינו שני רגולטורים רומן אלגינט, mucE (PA4033) וkinB (PA5484), בPAO1 מתח עם mucA פראי מסוג קידוד הגורם אנטי סיגמא MucA לרגולטור אלגינט מאסטר AlgU (AlgT, σ 22) . פרוטוקול mutagenesis תפוקה גבוהה זה יכול להיות שונה לזיהוי גנים הקשורים לאלימות אחרים הגורם לשינוי בקולומורפולוגיה ניו יורק.

כפי שמודגם באיור 1, וקטור transposon ספן מיני himar1, pFAC, מכיל שתי חזרות הפוכות 27 נ&quot;ב עם אתרי החדרת ת&quot;א איגוף קלטת התנגדות gentamycin aacC1, עם האמרגן שלה σ 70 תלוי, ואתר מרובה שיבוט (MCS). בנוסף, וקטור pFAC מכיל גנים המקודדים את transposase הפעיל מאוד himar1, β-lactamase <...

Watch this Scientific Journal Video about Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis at JoVE.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

כאן אנו מתארים פרוטוקול באמצעות mutagenesis בתיווך transposon ספן מיני himar1 ליצירת ספריית מוטציה הכנסה בצפיפות גבוהה למסך, לבודד ולזהות רגולטורים אלגינט רומן בPAO1 מתח Pseudomonas aeruginosa אב הטיפוס.

זיהוי גנים הקשורים לרומן אלגינט ייצור ב<em&gt; Pseudomonas aeruginosa</em&gt; שימוש מיני<em&gt; Himar1</em&gt; Mutagenesis תיווך transposon מרינר

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

identification-novel-genes-associated-with-alginate-production

Research

JoVE Journal

Immunology and Infection

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

12.2K Views.  Marshall University.  כאן אנו מתארים פרוטוקול באמצעות mutagenesis בתיווך transposon ספן מיני himar1 ליצירת ספריית מוטציה הכנסה בצפיפות גבוהה למסך, לבודד ולזהות רגולטורים אלגינט רומן בPAO1 מתח Pseudomonas aeruginosa אב הטיפוס. 

Video: Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living surfaces. In this paper, we describe protocols for forming Pseudomonas aeruginosa biofilms on human airway epithelial cells (CFBE cells) grown in culture. In the first method (termed the Static Co-culture Biofilm Model), P. aeruginosa is incubated with CFBE cells grown as confluent monolayers on standard tissue culture plates. Although the bacterium is quite toxic to epithelial cells, the addition of arginine delays the destruction of the monolayer long enough for biofilms to form on the CFBE cells. The second method (termed the Flow Cell Co-culture Biofilm Model), involves adaptation of a biofilm flow cell apparatus, which is often used in biofilm research, to accommodate a glass coverslip supporting a confluent monolayer of CFBE cells. This monolayer is inoculated with P. aeruginosa and a peristaltic pump then flows fresh medium across the cells. In both systems, bacterial biofilms form within 6-8 hours after inoculation. Visualization of the biofilm is enhanced by the use of P. aeruginosa strains constitutively expressing green fluorescent protein (GFP). The Static and Flow Cell Co-culture Biofilm assays are model systems for early P. aeruginosa infection of the Cystic Fibrosis (CF) lung, and these techniques allow different aspects of P. aeruginosa biofilm formation and virulence to be studied, including biofilm cytotoxicity, measurement of biofilm CFU, and staining and visualizing the biofilm.

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

This paper describes different methods of growing Pseudomonas aeruginosa biofilms on cultured human airway epithelial cells. These protocols can be adapted to study different aspects of biofilm formation, including visualization of the biofilm, staining of the biofilm, measuring the colony forming units (CFU) of the biofilm, and studying biofilm cytotoxicity.

Co-מודלים של תרבות Pseudomonas aeruginosa Biofilms גדל על תאים חיים Airway האדם

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living ...

Transfection and Mutagenesis of Target Genes in Mosquito Cells by Locked Nucleic Acid-modified Oligonucleotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new infections each year. Despite decades of research, there is still no vaccine against malaria, highlighting the need for novel control strategies. One innovative approach is the use of genetically modified mosquitoes to effectively control malaria parasite transmission. Deliberate alterations of cell signaling pathways in the mosquito, via targeted mutagenesis, have been found to regulate parasite development 1. From these studies, we can begin to identify potential gene targets for transformation. Targeted mutagenesis has traditionally relied upon the homologous recombination between a target gene and a large DNA molecule. However, the construction and use of such complex DNA molecules for generation of stably transformed cell lines is costly, time consuming and often inefficient. Therefore, a strategy using locked nucleic acid-modified oligonucleotides (LNA-ONs) provides a useful alternative for introducing artificial single nucleotide substitutions into episomal and chromosomal DNA gene targets (reviewed in 2). LNA-ON-mediated targeted mutagenesis has been used to introduce point mutations into genes of interest in cultured cells of both yeast and mice 3,4. We show here that LNA-ONs can be used to introduce a single nucleotide change in a transfected episomal target that results in a switch from blue fluorescent protein (BFP) expression to green fluorescent protein (GFP) expression in both Anopheles gambiae and Anopheles stephensi cells. This conversion demonstrates for the first time that effective mutagenesis of target genes in mosquito cells can be mediated by LNA-ONs and suggests that this technique may be applicable to mutagenesis of chromosomal targets in vitro and in vivo.

Oligonucleotides can be used to site specifically substitute a single nucleotide of transfected target genes in both Anopheles gambiae and Anopheles stephensi cells.

Transfection ו mutagenesis של גני מטרה של תאים על ידי יתוש נעול חומצה שונה oligonucleotides גרעין

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new ...

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological properties compared to free living microorganisms. Biofilms in nature are often difficult to investigate and reside under poorly defined conditions1. Using a transparent substratum it is possible to device a system where simple biofilms can be examined in a non-destructive way in real-time: here we demonstrate the assembly and operation of a flow cell model system, for in vitro 3D studies of microbial biofilms generating high reproducibility under well-defined conditions2,3.
The system consists of a flow cell that serves as growth chamber for the biofilm. The flow cell is supplied with nutrients and oxygen from a medium flask via a peristaltic pump and spent medium is collected in a waste container. This construction of the flow system allows a continuous supply of nutrients and administration of e.g. antibiotics with minimal disturbance of the cells grown in the flow chamber. Moreover, the flow conditions within the flow cell allow studies of biofilm exposed to shear stress. A bubble trapping device confines air bubbles from the tubing which otherwise could disrupt the biofilm structure in the flow cell.
The flow cell system is compatible with Confocal Laser Scanning Microscopy (CLSM) and can thereby provide highly detailed 3D information about developing microbial biofilms. Cells in the biofilm can be labeled with fluorescent probes or proteins compatible with CLSM analysis. This enables online visualization and allows investigation of niches in the developing biofilm. Microbial interrelationship, investigation of antimicrobial agents or the expression of specific genes, are of the many experimental setups that can be investigated in the flow cell system.

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Protocol describing the application of a flow cell system for growing and analyzing microbial biofilms for Confocal Laser Scanning Microscopy (CLSM).

Pseudomonas aeruginosa ו biofilm Saccharomyces cerevisiae בתוך תאים Flow

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological ...

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with leukemia, severe burn wounds, or organ transplants1. In patients at high-risk for developing PA bloodstream infections, the gastrointestinal (GI) tract is the main reservoir for colonization2, but the mechanisms by which PA transitions from an asymptomatic colonizing microbe to an invasive, and often deadly, pathogen are unclear. Previously, we performed in vivo transcription profiling experiments by recovering PA mRNA from bacterial cells residing in the cecums of colonized mice 3 in order to identify changes in bacterial gene expression during alterations to the host&#x2019;s immune status.
As with any transcription profiling experiment, the rate-limiting step is in the isolation of sufficient amounts of high quality mRNA. Given the abundance of enzymes, debris, food residues, and particulate matter in the GI tract, the challenge of RNA isolation is daunting. Here, we present a method for reliable and reproducible isolation of bacterial RNA recovered from the murine GI tract. This method utilizes a well-established murine model of PA GI colonization and neutropenia-induced dissemination4. Once GI colonization with PA is confirmed, mice are euthanized and cecal contents are recovered and flash frozen. RNA is then extracted using a combination of mechanical disruption, boiling, phenol/chloroform extractions, DNase treatment, and affinity chromatography. Quantity and purity are confirmed by spectrophotometry (Nanodrop Technologies) and bioanalyzer (Agilent Technologies) (Fig 1). This method of GI microbial RNA isolation can easily be adapted to other bacteria and fungi as well.

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

A reliable method for the RNA isolation of Pseudomonas aeruginosa recovered from murine cecums is described. The RNA recovered is of sufficient quantity and quality for subsequent qPCR, transcription profiling, and RNA Seq experiments. This technique can be adapted for RNA isolation of other intestinal microbes.

RNA בידוד Pseudomonas aeruginosa מיישבים את מערכת העיכול Murine

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with ...

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

There is growing concern about the relevance of in vitro antimicrobial susceptibility tests when applied to isolates of P. aeruginosa from cystic fibrosis (CF) patients. Existing methods rely on single or a few isolates grown aerobically and planktonically. Predetermined cut-offs are used to define whether the bacteria are sensitive or resistant to any given antibiotic1. However, during chronic lung infections in CF, P. aeruginosa populations exist in biofilms and there is evidence that the environment is largely microaerophilic2. The stark difference in conditions between bacteria in the lung and those during diagnostic testing has called into question the reliability and even relevance of these tests3.
 Artificial sputum medium (ASM) is a culture medium containing the components of CF patient sputum, including amino acids, mucin and free DNA. P. aeruginosa growth in ASM mimics growth during CF infections, with the formation of self-aggregating biofilm structures and population divergence4,5,6. The aim of this study was to develop a microtitre-plate assay to study antimicrobial susceptibility of P. aeruginosa based on growth in ASM, which is applicable to both microaerophilic and aerobic conditions.
 An ASM assay was developed in a microtitre plate format. P. aeruginosa biofilms were allowed to develop for 3 days prior to incubation with antimicrobial agents at different concentrations for 24 hours. After biofilm disruption, cell viability was measured by staining with resazurin. This assay was used to ascertain the sessile cell minimum inhibitory concentration (SMIC) of tobramycin for 15 different P. aeruginosa isolates under aerobic and microaerophilic conditions and SMIC values were compared to those obtained with standard broth growth. Whilst there was some evidence for increased MIC values for isolates grown in ASM when compared to their planktonic counterparts, the biggest differences were found with bacteria tested in microaerophilic conditions, which showed a much increased resistance up to a &gt;128 fold, towards tobramycin in the ASM system when compared to assays carried out in aerobic conditions.
 The lack of association between current susceptibility testing methods and clinical outcome has questioned the validity of current methods3. Several in vitro models have been used previously to study P. aeruginosa biofilms7, 8. However, these methods rely on surface attached biofilms, whereas the ASM biofilms resemble those observed in the CF lung9 . In addition, reduced oxygen concentration in the mucus has been shown to alter the behavior of P. aeruginosa2 and affect antibiotic susceptibility10. Therefore using ASM under microaerophilic conditions may provide a more realistic environment in which to study antimicrobial susceptibility.

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

Current diagnostic antimicrobial susceptibility testing relies on the planktonic growth of isolates in nutrient rich, aerobic conditions. Here, we employ an alternative artificial sputum medium to study antimicrobial susceptibility of Pseudomonas aeruginosa biofilms under both aerobic and microaerophilic conditions more representative of the cystic fibrosis lung.

שימוש בינוני כיח מלאכותית לבדיקת יעילות אנטיביוטי נגד<em&gt; Pseudomonas aeruginosa</em&gt; בתנאי רלוונטיים יותר ריאות סיסטיק פיברוזיס

There  is growing concern about the relevance of in vitro antimicrobial  susceptibility tests when applied to isolates of P. aeruginosa from  cystic ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

כרוני לטווח ארוך<em&gt; Pseudomonas aeruginosa</em&gt; זיהום דרכי הנשימה בעכברים

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

Pseudomonas aeruginosa Induced Lung Injury Model

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. Here we have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa (P. aeruginosa or PA). Using this model, we were able to show lung inflammation at the early phase of injury. In addition, alveolar epithelial barrier leakiness was observed by analyzing bronchoalveolar lavage (BAL); and alveolar cell death was observed by Tunel assay using tissue prepared from injured lungs. At a later phase following injury, we observed cell proliferation required for the repair process. The injury was resolved 7 days from the initiation of P. aeruginosa injection. This model mimics the sequential course of lung inflammation, injury and repair during pneumonia. This clinically relevant animal model is suitable for studying pathology, mechanism of repair, following acute lung injury, and also can be used to test potential therapeutic agents for this disease.

Pseudomonas aeruginosa Induced Lung Injury Model

We have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa. This model mimics lung injury during pneumonia and is clinically relevant.

Pseudomonas aeruginosa מושרה ריאות פגיעה דגם

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

שכפול של הוזמן, ספריית Nonredundant של Pseudomonas aeruginosa זן PA14 Transposon ההכנסה מוטציות

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary tissue during pneumonia results in the production of long-lived cytotoxins that can lead to subsequent end organ failure. We have developed in vitro assays to test the hypothesis that cytotoxins are produced during pulmonary infection. Isolated rat pulmonary endothelial cells and the bacterium Pseudomonas aeruginosa are used as model systems, and the production of cytoxins following infection of the endothelial cells by the bacteria is demonstrated using cell culture followed by direct quantitation using lactate dehydrogenase assays and a novel microscopic method utilizing ImageJ technology. The amyloid nature of these cytotoxins was demonstrated by thioflavin T binding assays and by immunoblotting and immunodepletion using A11 anti-amyloid antibody. Further analyses using immunoblotting demonstrated that oligomeric tau and A&#946; were produced and released by endothelial cells following infection by P. aeruginosa. These methods should be readily adaptable to analyses of human clinical samples.

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Simple methods are described for demonstrating the production of cytotoxic amyloids following infection of pulmonary endothelium by Pseudomonas aeruginosa.

שיטות זיהוי ציטוטוקסיות Amyloids הבאים זיהום של אנדותל תאי הריאות על ידי Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

הדור של המסגרת של גן In-Frame מוטציות מחיקה ב פסאודומונס aeruginosa ובדיקת התקפה אלימה מודל עכבר פשוט של זיהום

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...