Name: mrna interactome capture from plant protoplasts
Uploaded: 2017-07-28T13:00:00
Description: Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

We acknowledge the lab of Prof. Joris Winderickx, who provided the UV crosslinking apparatus equipped with the conventional UV lamp. K. G. is supported by the KU Leuven research fund and acknowledges support from FWO grant G065713N.

1. Arabidopsis Leaf Mesophyll Protoplast Isolation
NOTE: Arabidopsis leaf mesophyll protoplasts are essentially isolated as described by Yoo et al., 2007, with several modifications40.
<ol>
	<li>Growth of plants
	<ol>
		<li>Soak approximately 200 Arabidopsis thaliana Col-0 ecotype seeds in sterilized water for 2 days at 4 &#176;C in darkness for stratification. 
		NOTE: This number of seeds is enough for one no...

We successfully applied mRNA interactome capture, developed for yeast and human cells, to plant leaf mesophyll protoplasts. Leaf mesophyll cells are the major type of ground tissue in plant leaves. The major advantage of this method is that it uses in vivo crosslinking to discover the proteins from a physiological environment.
In this protocol, we mainly present a number of optimized experimental conditions (e.g., the number of protoplasts to use as starting material and the ...

Eukaryotes use multiple RNA biogenesis regulatory pathways to maintain cellular biological processes. Among the known types of RNA, mRNA is very diverse and carries the coding capacity of proteins and their isoforms1.The PTGR pathway directs the fates of pre-mRNAs2,3. RBPs from different gene families control the regulation of RNA, and in PTGR, specific mRBPs guide mRNAs through direct physical interactions, forming functional mRNPs. Therefore, identifying and characterizing mRBPs and their mRNPs is critical to understanding the regulation of cellular mRNA metabolism2.Over the past three decades, various in vitro methods &#8211; including RNA electrophoretic mobility shift (REMSA) assays, systematic evolution of ligands by exponential enrichment assays (SELEX) based on library-derived constructs, RNA Bind-n-Seq (RBNS), radiolabeled or quantitative fluorescence RNA binding assays, X-ray crystallography, and NMR spectroscopy4,5,6,7,8,9 &#8211; have been widely applied to studies of RBPs, mainly from mammalian cells. The results of these studies of mammalian RBPs can be searched via the RNA-binding Protein DataBase (RBPDB), which collects the published observations10.
Although these in vitro approaches are powerful tools, they determine the bound RNA motifs from a given RNA pool of sequences and therefore are limited in their ability to discover new target RNAs. The same is true for computational strategies to predict genome-wide RBPs, which are based on the conservation of protein sequence and structure15. To overcome this, a new experimental method has been established that allows for the identification of the RNA motifs that an RBP of interest interacts with, as well as for the determination of the precise location of binding. This method, called &#34;crosslinking and immunoprecipitation&#34; (CLIP), is composed of in vivo UV crosslinking followed by immunoprecipitation11. Early studies have shown that photoactivation of DNA and RNA nucleotides can occur at excitation UV wavelengths greater than 245 nm. The reaction through thymidine seems to be favored (rank in order of decreased photoreactivity: dT &#8805; dC &#62; rU &#62; rC, dA, dG)12. Using UV light with a wavelength of 254 nm (UV-C), it was observed that covalent bonds between RNA nucleotides and protein residues are created when in the range of only a few Angstroms (&#197;). The phenomenon is therefore called the &#34;zero-length&#34; crosslinking of RNA and RBP. This can be followed by a stringent purification procedure with little background13,14.
A strategy complementary to CLIP is to combine in vivo UV crosslinking with protein identification to describe the landscape of RBPs. A number of such genome-wide mRNA-bound proteomes have been isolated from yeast cells, embryonic stem cells (ESCs), and human cell lines (i.e., HEK293 and HeLa) using this novel experimental approach, called &#34;mRNA interactome capture&#34;18,19,20,21. The method is composed of in vivo UV crosslinking followed by mRNP purification and MS-based proteomics. By applying this strategy, many novel &#34;moonlighting&#34; RBPs containing non-canonical RBDs have been discovered, and it has become clear that more proteins have RNA-binding capacities than previously supposed15,16,17. The use of this method allows for new applications and for the ability to answer new biological questions when investigating RBPs. For example, a recent study has investigated the conservation of the mRNA-bound proteome (the core RBP proteome) between yeast and human cells22.
Plant RBPs have already been found to be involved in growth and development (e.g., in the post-transcriptional regulation of flowering time, the circadian clock, and gene expression in mitochondria and chloroplasts)24,25,26,27,28,29. Furthermore, they are thought to perform functions in the cellular processes responding to abiotic stresses (e.g., cold, drought, salinity, and abscisic acid (ABA))31,32,33,34. There are more than 200 predicted RBP genes in the Arabidopsis thaliana genome, based on RNA recognition motif (RRM) and K homology (KH) domain sequence motifs; in rice, approximately 250 have been noted35,36. It is notable that many predicted RBPs seem to be unique to plants (e.g., no metazoan orthologs to approximately 50% of predicted Arabidopsis RBPs containing an RRM domain)35, suggesting that many may serve new functions. The functions of most predicted RBPs remain uncharacterized23.
The isolation of mRNA-bound proteomes from Arabidopsis etiolated seedlings, leaf tissue, cultured root cells, and leaf mesophyll protoplasts through the use of mRNA interactome capture has recently been reported38,39. These studies demonstrate the strong potential of systematically cataloging functional RBPs in plants in the near future. Here, we present a protocol for mRNA interactome capture from plant protoplasts (i.e., cells without cell walls). Arabidopsis thaliana leaf mesophyll protoplasts are the major type of leaf cell. The isolated protoplasts allow optimal access of UV light to the cells. This cell type can be used in assays that transiently express proteins for functional characterization40,41. Furthermore, protoplasting has been applied to several other plant cell types and species42,43,44 (e.g., Petersson et al., 2009; Bargmann and Birnbaum, 2010; and Hong et al., 2012).
The method encompasses a total of 11 steps (Figure 1A). Arabidopsis leaf mesophyll protoplasts are first isolated (step 1) and are subsequently UV irradiated to form crosslinked mRNPs (step 2). When protoplasts are lysed under denaturing conditions (step 3), the crosslinked mRNPs are released in lysis/binding buffer and pulled down by oligo-d(T)25 beads (step 4). After several rounds of stringent washes, the mRNPs are purified and further analyzed. The denatured peptides of mRBPs are digested by proteinase K before the crosslinked mRNAs are purified and the RNA quality is verified by qRT-PCR (steps 5 and 6). After RNase treatment and protein concentration (step 7), the protein quality is controlled by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and silver staining (step 8). The difference in protein band patterns can easily be visualized between a crosslinked sample (CL) and a non-crosslinked sample (non-CL; the negative control sample from protoplasts that is not subjected to UV irradiation). The identification of proteins is achieved through MS-based proteomics. The proteins from the CL sample are separated by one-dimensional polyacrylamide gel electrophoresis (1D-PAGE) to remove possible background contamination, are &#34;in-gel digested&#34; into short peptides using trypsin, and are purified (step 9). Nano reverse-phase liquid chromatography coupled to mass spectrometry (nano-LC-MS) allows for the determination of the amount of definitive proteins in the mRNA-bound proteome (step 10). Finally, the identified mRBPs are characterized and cataloged using bioinformatic analysis (step 11).

<table>
	<tbody>
		<tr>
			<td colspan="4">REAGENTS</td>
		</tr>
		<tr>
			<td>0.8 M Mannitol</td>
			<td>Sigma</td>
			<td>M1902-500G</td>
			<td>Primary isotonic Enzyme solution &#38; 
			MMg solution</td>
		</tr>
		<tr>
			<td>2M KCl</td>
			<td>MERCK</td>
			<td>Art. 4935</td>
			<td>Primary isotonic Enzyme solution &#38; 
			W5 buffer</td>
		</tr>
		<tr>
			<td>0.2 M MES (pH 5.7) 
			(4-morpholineethanesulfonic acid)</td>
			<td>Sigma-aldrich</td>
			<td>M2933</td>
			<td>Primary isotonic Enzyme solution, 
			W5 buffer &#38; 
			MMg solution, 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>Cellulase R10</td>
			<td>Yakult Pharmaceutical Industry Co., Ltd.</td>
			<td>CELLULASE 
			&#8220;ONOZUKA&#8221; 
			R-10, 10 g</td>
			<td>Final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>Macerozyme R10</td>
			<td>Yakult Pharmaceutical Industry Co., Ltd.</td>
			<td>MACEROZYME R-10, 10g</td>
			<td>Final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>10% (w/v) BSA 
			(Bovine Serum Albumin)</td>
			<td>Sigma-aldrich</td>
			<td>A7906-100G</td>
			<td>Final isotonic enzyme solution &#38; 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>1M CaCl2</td>
			<td>Chem-Lab NV</td>
			<td>CL00.0317.1000</td>
			<td>Final isotonic enzyme solution, 
			W5 buffer &#38; 
			Digestion buffer</td>
		</tr>
		<tr>
			<td>1M NaCl</td>
			<td>Fisher Chemical</td>
			<td>S/3160/60</td>
			<td>W5 buffer</td>
		</tr>
		<tr>
			<td>2M MgCl2</td>
			<td>Sigma</td>
			<td>M8266-100G</td>
			<td>MMg solution</td>
		</tr>
		<tr>
			<td>1M LiCl 
			(Lithium Chloride)</td>
			<td>Acros</td>
			<td>199885000</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2 &#38; 
			Low salt buffer</td>
		</tr>
		<tr>
			<td>5% (w/v) LiDS 
			(Lithium Dodecyl Sulphate)</td>
			<td>Sigma-aldrich</td>
			<td>L4632-25G</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1 &#38; 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>1M DTT 
			(Dithiothreitol)</td>
			<td>Thermo Fisher Scientific 
			Wash buffer 1 &#38; 
			Wash buffer 2</td>
			<td>307866</td>
			<td>Lysis/binding buffer,</td>
		</tr>
		<tr>
			<td>1M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl))</td>
			<td>Acros &#38; 
			Fisher Chemical</td>
			<td>167620010 &#38; 
			H/1200/PB15</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2, 
			Low salt buffer &#38; 
			Elution buffer</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>ED-500G</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2, 
			Low salt buffer &#38; 
			Elution buffer</td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>MERCK</td>
			<td>8.22184.0500</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>0.1 M NaOH</td>
			<td>VWR PROLABO CHEMICALS</td>
			<td>28244.295</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>1X PBS (pH 7.4) 
			(Phosphate Buffered Saline) 
			containing 
			(NaCl; KCl; Na2HPO4; KH2PO4)</td>
			<td>Fisher Chemical, MERCK, 
			Sigma-aldrich &#38; SAFC</td>
			<td>S/3160/60, 
			Art. 4935, 
			71640-250G &#38; 
			60230</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>Proteinase K solution (2 &#956;g/&#956;L)</td>
			<td>Thermo Fisher Scientific</td>
			<td>11789020</td>
			<td>Protein digestion</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>Invitrogen</td>
			<td>LC5925</td>
			<td>SDS-PAGE</td>
		</tr>
		<tr>
			<td>qPCR master mix</td>
			<td>Promega</td>
			<td>A6001</td>
			<td>qRT-PCR assay</td>
		</tr>
		<tr>
			<td>RNase Cocktail</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM2286</td>
			<td>RNA digestion</td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td>Sigma-aldrich</td>
			<td>322415</td>
			<td>Gel fixation and gel destaining</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Sigma-aldrich</td>
			<td>537020</td>
			<td>Gel fixation and gel destaining</td>
		</tr>
		<tr>
			<td>Coomassie Brilliant Blue R-250</td>
			<td>Thermo Fisher Scientific</td>
			<td>20278</td>
			<td>Gel staining</td>
		</tr>
		<tr>
			<td>1M NH4HCO3 
			(Ammonium bicarbonate) 
			&#160;</td>
			<td>Sigma-aldrich</td>
			<td>09830-500G</td>
			<td>Gel hydration &#38; 
			Digestion buffer</td>
		</tr>
		<tr>
			<td>CH3CN 
			(Acetonitrile)</td>
			<td>Sigma-aldrich</td>
			<td>34851-100ML</td>
			<td>Gel dehydration &#38; 
			Peptide dissolving solution</td>
		</tr>
		<tr>
			<td>IAA 
			(Iodoacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>I4386-10G</td>
			<td>Alkylating agent</td>
		</tr>
		<tr>
			<td>TFA 
			(Trifluoroacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>302031-10X1ML</td>
			<td>Peptide dissolving solution</td>
		</tr>
		<tr>
			<td>FA 
			(Formic acid)</td>
			<td>Sigma-aldrich</td>
			<td>06554-5G</td>
			<td>Peptide extraction</td>
		</tr>
		<tr>
			<td>Trypsin solution (6 ng/&#956;L)</td>
			<td>Promega</td>
			<td>V5280</td>
			<td>Digestion buffer</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td colspan="4">EQUIPMENT</td>
		</tr>
		<tr>
			<td>Soil</td>
			<td>Peltracom</td>
			<td>LP2D</td>
			<td>Plant growth</td>
		</tr>
		<tr>
			<td>Vermiculite 3</td>
			<td>Sibli AS</td>
			<td>05VERMICULIET</td>
			<td>Plant growth</td>
		</tr>
		<tr>
			<td>Petri dish (150 x 20 mm)</td>
			<td>Sarstedt</td>
			<td>82.1184.500</td>
			<td>Carrier for protoplast suspension</td>
		</tr>
		<tr>
			<td>0.22 &#956;m filter</td>
			<td>Millipore</td>
			<td>SE2M229104</td>
			<td>Homogenization of final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>Razorblade</td>
			<td>Agar Scientific</td>
			<td>T585</td>
			<td>Rosette leaf strips</td>
		</tr>
		<tr>
			<td>35-75 &#956;m nylon mesh</td>
			<td>SEFAR NITEX</td>
			<td>74010</td>
			<td>Protoplast suspension filtration</td>
		</tr>
		<tr>
			<td>50 mL round bottom tubes</td>
			<td>Sigma-aldrich</td>
			<td>T1918-10EA</td>
			<td>Carrier for protoplast suspension</td>
		</tr>
		<tr>
			<td>Hemocytometer 
			(B&#252;rker hemocytometer)</td>
			<td>MARIENFELD</td>
			<td>650030</td>
			<td>Protoplast cell counting</td>
		</tr>
		<tr>
			<td>UV crosslinking apparatus 
			(HL-2000 HybriLinker)</td>
			<td>UVP, LLC</td>
			<td>UVP95003101</td>
			<td>in vivo UV crosslinking</td>
		</tr>
		<tr>
			<td>UV lamp 
			(Sankyo-Denki G8T5)</td>
			<td>SANKYO 
			DENKI</td>
			<td>SD G8T5</td>
			<td>in vivo UV crosslinking</td>
		</tr>
		<tr>
			<td>50 mL glass syringe</td>
			<td>FORTUNA Optima</td>
			<td>Z314560</td>
			<td>Homogenization of protoplast lysate</td>
		</tr>
		<tr>
			<td>Narrow needle (0.9 x 25 mm)</td>
			<td>Becton Dickinson microlance 3</td>
			<td>2021-04</td>
			<td>Homogenization of protoplast lysate</td>
		</tr>
		<tr>
			<td>Rotator Model L26</td>
			<td>Labinco BV</td>
			<td>26110912</td>
			<td>Sample incubation by rotating</td>
		</tr>
		<tr>
			<td>Oligo-d(T)25 magnetic beads 
			(5 mg/mL)</td>
			<td>New England BioLabs</td>
			<td>S1419S</td>
			<td>mRNPs and mRNAs binding and pull-down</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>Invitrogen</td>
			<td>CS15000</td>
			<td>mRNPs and mRNAs binding and pull-down</td>
		</tr>
		<tr>
			<td>Centrifugal filter units 
			(Amicon Ultra-4 centrifugal filter units)</td>
			<td>EMD Millipore</td>
			<td>UFC800308</td>
			<td>mRBP concentration</td>
		</tr>
		<tr>
			<td>Pierce Silver Stain Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>24612</td>
			<td>Silver-staining assay</td>
		</tr>
		<tr>
			<td>RNA purification kit 
			(InviTrap Spin Plant RNA Mini Kit)</td>
			<td>STRATEC Molecular</td>
			<td>1064100300</td>
			<td>RNA purification</td>
		</tr>
		<tr>
			<td>Spectrophotometer device (NanoDrop 1000 Spectrophotometer)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ND-1000</td>
			<td>RNA quality and quantity</td>
		</tr>
		<tr>
			<td>Real-Time PCR cycler 
			(StepOne Real-Time PCR cycler)</td>
			<td>Thermo Fisher Scientific</td>
			<td>4376600</td>
			<td>cDNA quantification</td>
		</tr>
		<tr>
			<td>&#181;-C18 columns 
			(Millipore Zip Tip &#181;-C18 columns)</td>
			<td>Sigma-aldrich</td>
			<td>720046-960EA</td>
			<td>Peptide purification</td>
		</tr>
		<tr>
			<td>Mass spectrometer 
			(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)</td>
			<td>Thermo Fisher Scientific</td>
			<td>IQLAAEGAAPFALGMAZR</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ULTIM3000RSLCNANO</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>C18 column 
			(Easy Spray Pepmap RSLC C18 column)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ES800</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>C18 precolumn 
			(Acclaim Pepmap 100 C18 precolumn)</td>
			<td>Thermo Fisher Scientific</td>
			<td>160321</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Primers for qRT-PCR assay</td>
			<td colspan="3">Sequences</td>
		</tr>
		<tr>
			<td>UBQ10 mRNA 
			(Li et al., 2014)</td>
			<td colspan="3">Fw: AACTTTGGTGGTTTGTGTTTTGG 
			Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA</td>
		</tr>
		<tr>
			<td>18S rRNA 
			(Durut et al., 2014)</td>
			<td colspan="3">Fw: CGTAGTTGAACCTTGGGATG 
			Rv: CACGACCCGGCCAATTA</td>
		</tr>
	</tbody>
</table>

mrna interactome capture from plant protoplasts

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional gene regulation (PTGR) of messenger RNAs (mRNAs). In the past few years, a number of mRNA-bound proteomes from yeast and mammalian cell lines have been successfully isolated through the use of a novel method called &#34;mRNA interactome capture,&#34; which allows for the identification of mRNA-binding proteins (mRBPs) directly from a physiological environment. The method is composed of in vivo ultraviolet (UV) crosslinking, pull-down and purification of messenger ribonucleoprotein complexes (mRNPs) by oligo(dT) beads, and the subsequent identification of the crosslinked proteins by mass spectrometry (MS). Very recently, by applying the same method, several plant mRNA-bound proteomes have been reported simultaneously from different Arabidopsis tissue sources: etiolated seedlings, leaf tissue, leaf mesophyll protoplasts, and cultured root cells. Here, we present the optimized mRNA interactome capture method for Arabidopsis thaliana leaf mesophyll protoplasts, a cell type that serves as a versatile tool for experiments that include various cellular assays. The conditions for optimal protein yield include the amount of starting tissue and the duration of UV irradiation. In the mRNA-bound proteome obtained from a medium-scale experiment (107 cells), RBPs noted to have RNA-binding capacity were found to be overrepresented, and many novel RBPs were identified. The experiment can be scaled up (109 cells), and the optimized method can be applied to other plant cell types and species to broadly isolate, catalog, and compare mRNA-bound proteomes in plants.

We observed a characteristic halo, which surrounds the bead pellet in the CL sample, in wash step 4.3 with wash buffer 2 (Figure 1B). Although it has not been investigated, this phenomenon can probably be explained by the interference of crosslinked mRNP complexes with bead aggregation during the magnetic capture, causing a more diffuse aggregate to form. It indicates that the oligo-d(T)25 bead capture was effective14.
<...

Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

mRNA Interactome Capture from Plant Protoplasts

Here, we present an interactome capture protocol applied to Arabidopsis thaliana leaf mesophyll protoplasts. This method critically relies on in vivo UV crosslinking and allows for the isolation and identification of plant mRNA-binding proteins from a physiological environment.

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

The overall goal of this optimized mRNA interactome capture is to isolate and identify an mRNA-bound proteome from plant cells. This method is applied to arabidopsis thaliana leaf mesophil protoplasts, a cell type used as a versatile tool in various cellular assays. This method can help to answer key questions in the field of post-transcriptional gene regulation implants such as discovering and understanding the role of plant messengers RNA binding proteins.The main advantage of this technique is that it can isolate and identify a plant messenger on a bound proteome directly from the physiological environment. So this method can provide insight into the messenger RNA-bound protein from aribidopsis leaf mesophil protoplasts. It also can be applied to other systems like other plant's protoplasts or tissues.We first had the idea for this method when we noticed that it had been applied successfully to yeast and mammalian cell lines. Isolate arabidopsis leaf mesophil protoplasts for two different samples, as described in the text protocol. Keep the control sample that will not be UV crosslinked, or non-CL sample on ice.Transfer the protoplast suspension to be crosslinked, or CL-sample to a large petri dish. Add 30 milliliters of ice-cold MMG solution to the dish to cover the surface and spread the cells by gentle pipetting. Cover the petri dish with aluminum foil when transported to the UV crosslinking apparatus.Place the opened petri dish in a UV crosslinking apparatus immediately. Make sure that the distance between the dish and the UV lamp is eight centimeters and then irradiate the sample for one minute. After that, quickly aliquot the protoplast suspension from the petri dish into two new 50 milliliter round-bottom tubes.Wash the bottom of the dish with an additional five milliliters of the ice-cold MMG solution to collect the remainder of the protoplasts. Divide the suspension between the two tubes. Next, centrifuge the non-CL and two CL sample tubes at 100 times g at four degrees celsius for five minutes.After discarding the supernatant, place the tube with the non-CL pellet back on ice. Add 10 milliliters of ice-cold MMG solution to each CL sample tube and gently shake the tubes to re-suspend the pellets. After combining the two samples into one 50 milliliter round-bottom tube, centrifuge at 100 times g at four degrees celsius for five minutes.After discarding the supernatant, keep the pellet on ice. Then add nine milliliters of ice-cold lysis binding buffer to the cell pellet of each sample. Lyse the protoplasts by pipetting up and down approximately twenty times, until the solution is a homogenous light green color.For homogenization, pass the protoplast lysate two times through a 50 milliliter glass syringe with a narrow needle, and then incubate the lysate on ice for ten minutes. Freeze the samples in liquid nitrogen and store at minus 80 degrees celsius for up to three weeks. After thawing the tube with frozen protoplast lysate at room temperature, keep the tube on ice.Aliquot 1.8 milliliters of oligo-d(T)magnetic beads into six new two milliliter round-bottom micro centrifuge tubes placed on ice. Wash the bead suspension in each tube with 600 microliters of lysis binding buffer by briefly pipetting up and down and gently rotate the beads on a rotator for two minutes. Keep the beads on ice.Next, place all six tubes containing the beads into a magnetic rack for at least three minutes to allow enough time for the complete magnetic capture. When the beads are completely captured, the suspension will become clear. Then, discard the supernatant from all six tubes and immediately aliquot nine milliliters of protoplast lysate into them.Mix the beads with lysate by pipetting until the suspension appears brown and homogenous. Incubate the tubes at four degrees celsius for one hour with gentle rotation. After incubation, place the tubes back into the magnetic rack for three minutes.When all the beads are captured on the side of the tubes, collect the supernatant containing the protoplast lysate into six new two milliliter round-bottom micro centrifuge tubes. Next, add 1.5 milliliters of ice-cold wash buffer one to each tube containing beads, and resuspend the beads by pipetting. After gentle rotation for one minute, place the tubes back into the magnetic rack for three minutes.Discard the supernatant and repeat this wash step once. Using 1.5 milliliters of ice-cold wash buffer two, repeat the same washing procedure twice. If the mRNP's have been efficiently isolated from the protoplast lysate, there should be a halo visible around the bead pellet in the CL sample.Finally, repeat the washing procedure once with 1.5 milliliters of ice-cold low salt buffer. After washing, add 500 microliters of elution buffer to each tube, and gently re-suspend the beads by pipetting. Incubate at 50 degrees celsius for three minutes to release the poly-A tailed RNA's.Gently re-suspend the beads by pipetting once and place the tubes back into the magnetic rack at four degrees celsius for five minutes. Transfer and combine eluents from all six tubes into a 15 milliliter conical-bottom tube placed on ice. This will yield approximately three millimeters of the eluent.The quality and quantity of RNA can be immediately determined using a spectrophotometer. Prepare the oligo-d(T)beads to be re-used by washing them twice with one milliliter of ice-cold elution buffer. After that, wash them with one milliliter of ice-cold lysis binding buffer to adjust the salt concentration back to 500 millimolar.Use these washed oligo-d(T)beads to repeat the binding, washing, and elution procedures for an additional two rounds. This will deplete the poly-A tailed RNA's from the protoplast lysate and yield a total of nine millimeters of eluent for each sample. Beads can be stored and used for another experiment for a maximum of three times.To test the RNA for quality, digest the UV-crosslinked proteins with proteinase K solution according to the text protocol. Then, purify the RNA using the RNA purification kit to remove any residual contaminates. After purification, the samples are ready for the RNA quality test using qRT-PCR.Begin by treating eight milliliters of each sample with 100 units of RNAse cocktail containing RNAse A and RNAse T1.After brief vortexing, incubate the samples at 37 degrees celsius for one hour. To concentrate mRNA binding proteins, or mRBP's, filter the samples using centrifugal filter units. Each sample will yield 75 microliters with two micrograms of protein.For long-term storage, freeze the samples at minus 80 degrees celsius. To run an SDS-page gel, mix 25 microliters of each concentrated sample with 15 microliters of 2X loading dye and heat the samples at 95 degrees celsius for five minutes. Load the samples in a protein marker on an SDS-page gel with a five percent stacking gel and twelve percent resolving gel.Next, wash the gel twice with ultrapure water for five minutes per wash. Use a commercial silver staining kit to stain the gel. If the sufficient number of starting protoplasts has been used, the protein bands will show within five minutes.To further test the mRBP's, purify the peptides from a second 1D page gel as explained in the text protocol. These purified peptides can now be analyzed by nano reverse-phased liquid chromatography, mass spectrometry, and qualitative and quantitative proteomics. After oligo-d(T)bead capture, qRT-PCR demonstrated significantly higher levels of poly ubiquitin 10 reference mRNA versus 18S rRNA.Since oligo-d(T)beads only bind to poly-A tailed RNA, this suggests that mRNA's are enriched in the eluent. Capture of mRBP's by oligo-d(T)beads is further evaluated by a silver-stained SDS-page gel. The gel shows a significantly higher protein amount in the UV-crosslinked CL sample versus the non-crosslinked non-CL sample.The duration of UV irradiation can influence the efficiency of crosslinking. This silver-stained SDS-page gel confirms that one or three minutes of UV irradiation is the optimal condition, with the strongest band intensities. A total of 325 proteins were identified by quantitative proteomics analysis.225 of these proteins were below the significance level due to low abundant peptides present for each protein, with high variability of peptide intensities. However, because all of them were qualitatively detected only in CL samples, they were all considered positive results. These 325 proteins were further classified into three categories, Ribosomal proteins, main RBP's, and candidate RBP's.The candidate RBP's lack conventional RNA binding domains and most of their roles have not been validated, suggesting possible novel functions in RNA regulation. Once mastered, this technique can be done in one week if performed appropriately. After it's development, this technique paved the way for researchers in the field of molecular regulation pathways in plants to explore genome-wide messenger RNA-bound proteome in dicots and monocots cells and tissues.

Research

JoVE Journal

Biochemistry

Protein Complex Affinity Capture from Cryomilled Mammalian Cells

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this ...

Experimental Design for Laser Microdissection RNA-Seq: Lessons from an Analysis of Maize Leaf Development

Genes with important roles in development frequently have spatially and/or temporally restricted expression patterns. Often these gene transcripts are not ...

A Simple Fractionated Extraction Method for the Comprehensive Analysis of Metabolites, Lipids, and Proteins from a Single Sample

Understanding of complex biological systems requires the measurement, analysis and integration of multiple compound classes of the living cell, usually ...

Determination of the Glycogen Content in Cyanobacteria

Cyanobacteria accumulate glycogen as a major intracellular carbon and energy storage&#160;during photosynthesis. Recent developments in research have ...

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Leaf Spray Mass Spectrometry: A Rapid Ambient Ionization Technique to Directly Assess Metabolites from Plant Tissues

Plants produce thousands of small molecules that are diverse in their chemical properties. Mass spectrometry (MS) is a powerful technique for analyzing ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Studying Protein Import into Chloroplasts Using Protoplasts

The chloroplast is an essential organelle that is responsible for various cellular processes in plants, such as photosynthesis and the production of many ...

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture (CARIC) Strategy

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture CARIC Strategy

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...