우리는 기존 UV 램프가 장착 된 UV 가교 장치를 제공 한 Joris Winderickx 교수의 실험실을 인정합니다. KG는 KU Leuven 연구 기금이 지원하며 FWO 교부금 G065713N의 지원을 인정합니다.

저자는 공개 할 것이 없습니다.

우리는 성공적으로 효모 및 인간 세포를 위해 개발 된 mRNA 상호 작용 포획을 엽초 엽 원형 엽록체에 적용했다. 잎 초 필 세포는 식물 잎의 지상 조직의 주요 유형입니다. 이 방법의 가장 큰 장점은 생체 환경에서 단백질을 발견하기 위해 생체 내 가교 결합을 사용한다는 것입니다. 이 프로토콜에서, 우리는 주로 최적의 실험 조건 (50) (예를 들...

진핵 생물은 세포 생물학적 과정을 유지하기 위해 다중 RNA 생합성 조절 경로를 사용합니다. 알려진 종류의 RNA 중에서 mRNA는 매우 다양하며 단백질과 그 이소 형의 코딩 용량을 가지고 있습니다 1. PTGR 경로는 pre-mRNA 2 , 3 의 운명을 지시합니다. 서로 다른 유전자 군의 RBP가 RNA의 조절을 조절하고, PTGR에서는 특정 mRBP가 기능적 mRNP를 형성하는 직접적인 물리적 상호 작용을 통해 mRNA를 유도합니다. 따라서, 식별 및 mRBPs의 특성과 mRNPs 것은 지난 30 년 .Over 세포의 mRNA 대사 2의 규정을 이해하는 데 중요하다, 다양한 시험 관내 방법 - RNA 전기 영동 이동성의 변화 (REMSA) 분석, 지수 농축 분석에 의한 리간드의 체계적 발전을 포함하여 (RBNS), 방사성 표지 또는 정량 분석 ​​(RNA Bind-n-Seq, RBNS)형광 RNA 결합 분석, X 선 결정학 및 NMR 분광법은 4, 5, 6, 7, 8, 9 - 널리 주로 포유 동물 세포에서 RBPs 연구에 적용되어왔다. 포유류 RBP에 대한 이러한 연구의 결과는 RNA-binding Protein DataBase (RBPDB)를 통해 검색 할 수 있으며, 이는 공개 된 관측치 10 을 수집합니다. 이러한 in vitro 접근법은 강력한 도구이지만 주어진 RNA 풀 시퀀스로부터 결합 된 RNA 모티프를 결정하므로 새로운 표적 RNA를 발견 할 수있는 능력이 제한적입니다. 계산 전략은 단백질 서열의 보존을 기반으로 게놈 전체의 RBPs을 예측하고 (15)를 구성하는 마찬가지입니다. 이를 극복하기 위해 새로운 실험 방법 인 ha이는 관심의 RBP가 상호 작용하는 RNA 모티프의 식별 및 결합의 정확한 위치 결정을 가능하게합니다. &quot;crosslinking and immunoprecipitation&quot;(CLIP)이라고 불리는이 방법 은 생체 내 UV 가교 결합 후 면역 침전 11로 구성 됩니다. 초기 연구에 따르면 245 nm보다 큰 자외선 파장에서 DNA 및 RNA 뉴클레오티드의 광 활성화가 발생할 수 있습니다. 티미 딘을 통한 반응이 선호되는 것으로 보인다 (광 반응성 감소 순서 : dT ≥ dC&gt; rU&gt; rC, dA, dG) 12 . 파장이 254 nm (UV-C) 인 UV 광을 사용하여 단 몇 옹스트롬 (Å) 범위에서 RNA 뉴클레오타이드와 단백질 잔기 사이의 공유 결합이 생성되는 것으로 관찰되었습니다. 따라서이 현상을 RNA와 RBP의 &quot;zero-length&quot;가교라고합니다. 이것은 엄격한 정화 과정<html> 배경이 거의없는 채약 13 , 14 . CLIP에 보완적인 전략은 RBP의 풍경을 기술하기 위해 단백질 확인과 생체 내 UV 교차 결합을 결합하는 것입니다. 이러한 게놈 전체 mRNA에 결합 된 프로테옴의 수는, &quot;mRNA의 상호 작용 체 캡처&quot;(18)라고, 효모 세포, 배아 줄기 세포 (는 ESC),이 새로운 실험 방법을 사용하여 인간의 세포 라인 (즉, HEK293와 헬라)에서 분리 된 19 , 20 , 21 . 이 방법은 생체 내 UV 가교 결합과 mRNP 정제 및 MS 기반 프로테오믹스로 구성됩니다. 이 전략을 적용함으로써, 비표준 RBD를 포함하는 많은 새로운 &quot;달빛&quot;RBP가 발견되었고, 더 많은 단백질이 이전에 상상했던 것보다 RNA 결합 능력을 가지고 있음이 분명 해졌다&quot;&gt; 15, 16, 17.이 방법의 사용은 새로운 애플리케이션과 RBPs을 조사 할 때 새로운 생물학적 질문에 대답 할 수있는 기능을 허용합니다. 예를 들어, 최근의 연구는 mRNA에 결합 된 프로테옴 (핵심 RBP의 보존을 조사하고있다 proteome) 22 . 식물 RBP는 이미 성장과 발달에 관여하고있다 ( 예 : 개화시기의 후 전사 조절, 24 시간주기, 미토콘드리아와 엽록체의 유전자 발현) 24 , 25 , 26 , 27 , 28 , 29 . 또한, 그들은 비 생물 적 스트레스에 반응하는 세포 과정에서 기능을 수행하는 것으로 생각된다 ( 예, 감기, 가뭄, salinity 및 abscisic acid (ABA)) 31 , 32 , 33 , 34 . RNA 인식 모티프 (RRM) 및 K 상 동성 (KH) 도메인 서열 모티프에 기초하여 애기 장대 게놈에 200 개 이상의 예측 된 RBP 유전자가 존재하며; 쌀에는 대략 250 개가 35 , 36 으로 기록되어있다. 예상되는 많은 RBP가 식물에만 고유 한 것으로 여겨지는 것은 주목할 만하다. ( 예를 들어, RRM 도메인을 포함하는 예측 된 Arabidopsis RBP의 약 50 %에 걸친 metazoan ortholog는 없다) 35) , 이는 많은 사람들이 새로운 기능을 수행 할 수 있음을 시사한다. 대부분의 예측 RBPs의 기능은 23지지 않은 남아있다. Arabidopsis 에서 발현 된 mRNA- 결합 된 프로테옴의 분리는 모종, 잎 조직, 배양 된 뿌리 세포 및 잎의 엽초 원형질체를mRNA의 상호 작용 체 캡처은 최근 39 (38)보고되었다. 이 연구는 가까운 장래에 식물에서 기능적 RBP를 체계적으로 목록화할 강력한 가능성을 보여줍니다. 여기, 우리는 식물 protoplasts ( 즉, 세포 벽이없는 세포)에서 mRNA interactome 캡처에 대한 프로토콜을 제시한다. Arabidopsis thaliana 엽초 엽 원형 엽 세포는 잎 세포의 주요 유형이다. 분리 된 원형질체는 세포에 자외선을 최적으로 닿게합니다. 이 세포 유형은 기능적 특성을 위해 단백질을 일시적으로 발현하는 분석법에서 사용할 수 있습니다 40 , 41 . 또한 protoplasting 다른 여러 식물 세포 종류 및 종을 42, 43, 44에 적용되어왔다 (., Bargmann 바움 및 2010; 예를 들어, 피터슨 등, 2009 년 홍콩 등, 2012).. &lt;p class = &quot;jove_content&quot;&gt;이 방법은 총 11 단계 ( 그림 1A )를 포함합니다. Arabidopsis 엽초 엽 원형체를 먼저 단리하고 (단계 1) UV 조사를하여 가교 결합 된 mRNP를 형성한다 (단계 2). 원형질체가 변성 조건 (단계 3) 하에서 용해 될 때, 가교 결합 된 mRNP는 용해 / 결합 완충액에서 방출되고 oligo-d (T) 25 비드에 의해 당겨진다 (단계 4). 몇 차례의 엄격한 세척 후에, mRNP를 정제하고 추가로 분석한다. mRBPs의 변성 펩티드는 가교 결합 mRNA가 정제되기 전에 프로 테이나 제 K에 의해 분해되고 RNA 품질은 qRT-PCR (단계 5 및 6)에 의해 검증된다. RNase 처리 및 단백질 농도 (단계 7) 후에, 단백질 품질은 SDS 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE) 및은 염색 (단계 8)에 의해 조절된다. 단백질 밴드 패턴의 차이점은 가교 샘플 (CL)과 비가 교 샘플 (non-crosslinked sample) 사이에서 쉽게 시각화 될 수 있습니다.UV 조사를받지 않은 원형질체로부터의 음성 대조군 샘플). 단백질의 확인은 MS 기반 프로테오믹스를 통해 이루어집니다. CL 샘플의 단백질은 1 차원 폴리 아크릴 아미드 겔 전기 영동 (1D-PAGE)으로 분리되어 가능한 배경 오염을 제거하고, 트립신을 사용하여 짧은 펩타이드로 &quot;in-gel digestion&quot;되고 정제됩니다 (9 단계). 질량 분광기 (nano-LC-MS)에 결합 된 나노 역상 액체 크로마토 그래피는 mRNA- 결합 프로테옴에서 결정적인 단백질의 양을 결정할 수있게합니다 (단계 10). 마지막으로, 확인 된 mRBPs는 생물 정보학 분석을 사용하여 특성화되고 목록 화됩니다 (11 단계).

<table>
	<tbody>
		<tr>
			<td colspan="4">REAGENTS</td>
		</tr>
		<tr>
			<td>0.8 M Mannitol</td>
			<td>Sigma</td>
			<td>M1902-500G</td>
			<td>Primary isotonic Enzyme solution &#38; 
			MMg solution</td>
		</tr>
		<tr>
			<td>2M KCl</td>
			<td>MERCK</td>
			<td>Art. 4935</td>
			<td>Primary isotonic Enzyme solution &#38; 
			W5 buffer</td>
		</tr>
		<tr>
			<td>0.2 M MES (pH 5.7) 
			(4-morpholineethanesulfonic acid)</td>
			<td>Sigma-aldrich</td>
			<td>M2933</td>
			<td>Primary isotonic Enzyme solution, 
			W5 buffer &#38; 
			MMg solution, 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>Cellulase R10</td>
			<td>Yakult Pharmaceutical Industry Co., Ltd.</td>
			<td>CELLULASE 
			&#8220;ONOZUKA&#8221; 
			R-10, 10 g</td>
			<td>Final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>Macerozyme R10</td>
			<td>Yakult Pharmaceutical Industry Co., Ltd.</td>
			<td>MACEROZYME R-10, 10g</td>
			<td>Final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>10% (w/v) BSA 
			(Bovine Serum Albumin)</td>
			<td>Sigma-aldrich</td>
			<td>A7906-100G</td>
			<td>Final isotonic enzyme solution &#38; 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>1M CaCl2</td>
			<td>Chem-Lab NV</td>
			<td>CL00.0317.1000</td>
			<td>Final isotonic enzyme solution, 
			W5 buffer &#38; 
			Digestion buffer</td>
		</tr>
		<tr>
			<td>1M NaCl</td>
			<td>Fisher Chemical</td>
			<td>S/3160/60</td>
			<td>W5 buffer</td>
		</tr>
		<tr>
			<td>2M MgCl2</td>
			<td>Sigma</td>
			<td>M8266-100G</td>
			<td>MMg solution</td>
		</tr>
		<tr>
			<td>1M LiCl 
			(Lithium Chloride)</td>
			<td>Acros</td>
			<td>199885000</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2 &#38; 
			Low salt buffer</td>
		</tr>
		<tr>
			<td>5% (w/v) LiDS 
			(Lithium Dodecyl Sulphate)</td>
			<td>Sigma-aldrich</td>
			<td>L4632-25G</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1 &#38; 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>1M DTT 
			(Dithiothreitol)</td>
			<td>Thermo Fisher Scientific 
			Wash buffer 1 &#38; 
			Wash buffer 2</td>
			<td>307866</td>
			<td>Lysis/binding buffer,</td>
		</tr>
		<tr>
			<td>1M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl))</td>
			<td>Acros &#38; 
			Fisher Chemical</td>
			<td>167620010 &#38; 
			H/1200/PB15</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2, 
			Low salt buffer &#38; 
			Elution buffer</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>ED-500G</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2, 
			Low salt buffer &#38; 
			Elution buffer</td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>MERCK</td>
			<td>8.22184.0500</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>0.1 M NaOH</td>
			<td>VWR PROLABO CHEMICALS</td>
			<td>28244.295</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>1X PBS (pH 7.4) 
			(Phosphate Buffered Saline) 
			containing 
			(NaCl; KCl; Na2HPO4; KH2PO4)</td>
			<td>Fisher Chemical, MERCK, 
			Sigma-aldrich &#38; SAFC</td>
			<td>S/3160/60, 
			Art. 4935, 
			71640-250G &#38; 
			60230</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>Proteinase K solution (2 &#956;g/&#956;L)</td>
			<td>Thermo Fisher Scientific</td>
			<td>11789020</td>
			<td>Protein digestion</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>Invitrogen</td>
			<td>LC5925</td>
			<td>SDS-PAGE</td>
		</tr>
		<tr>
			<td>qPCR master mix</td>
			<td>Promega</td>
			<td>A6001</td>
			<td>qRT-PCR assay</td>
		</tr>
		<tr>
			<td>RNase Cocktail</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM2286</td>
			<td>RNA digestion</td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td>Sigma-aldrich</td>
			<td>322415</td>
			<td>Gel fixation and gel destaining</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Sigma-aldrich</td>
			<td>537020</td>
			<td>Gel fixation and gel destaining</td>
		</tr>
		<tr>
			<td>Coomassie Brilliant Blue R-250</td>
			<td>Thermo Fisher Scientific</td>
			<td>20278</td>
			<td>Gel staining</td>
		</tr>
		<tr>
			<td>1M NH4HCO3 
			(Ammonium bicarbonate) 
			&#160;</td>
			<td>Sigma-aldrich</td>
			<td>09830-500G</td>
			<td>Gel hydration &#38; 
			Digestion buffer</td>
		</tr>
		<tr>
			<td>CH3CN 
			(Acetonitrile)</td>
			<td>Sigma-aldrich</td>
			<td>34851-100ML</td>
			<td>Gel dehydration &#38; 
			Peptide dissolving solution</td>
		</tr>
		<tr>
			<td>IAA 
			(Iodoacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>I4386-10G</td>
			<td>Alkylating agent</td>
		</tr>
		<tr>
			<td>TFA 
			(Trifluoroacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>302031-10X1ML</td>
			<td>Peptide dissolving solution</td>
		</tr>
		<tr>
			<td>FA 
			(Formic acid)</td>
			<td>Sigma-aldrich</td>
			<td>06554-5G</td>
			<td>Peptide extraction</td>
		</tr>
		<tr>
			<td>Trypsin solution (6 ng/&#956;L)</td>
			<td>Promega</td>
			<td>V5280</td>
			<td>Digestion buffer</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td colspan="4">EQUIPMENT</td>
		</tr>
		<tr>
			<td>Soil</td>
			<td>Peltracom</td>
			<td>LP2D</td>
			<td>Plant growth</td>
		</tr>
		<tr>
			<td>Vermiculite 3</td>
			<td>Sibli AS</td>
			<td>05VERMICULIET</td>
			<td>Plant growth</td>
		</tr>
		<tr>
			<td>Petri dish (150 x 20 mm)</td>
			<td>Sarstedt</td>
			<td>82.1184.500</td>
			<td>Carrier for protoplast suspension</td>
		</tr>
		<tr>
			<td>0.22 &#956;m filter</td>
			<td>Millipore</td>
			<td>SE2M229104</td>
			<td>Homogenization of final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>Razorblade</td>
			<td>Agar Scientific</td>
			<td>T585</td>
			<td>Rosette leaf strips</td>
		</tr>
		<tr>
			<td>35-75 &#956;m nylon mesh</td>
			<td>SEFAR NITEX</td>
			<td>74010</td>
			<td>Protoplast suspension filtration</td>
		</tr>
		<tr>
			<td>50 mL round bottom tubes</td>
			<td>Sigma-aldrich</td>
			<td>T1918-10EA</td>
			<td>Carrier for protoplast suspension</td>
		</tr>
		<tr>
			<td>Hemocytometer 
			(B&#252;rker hemocytometer)</td>
			<td>MARIENFELD</td>
			<td>650030</td>
			<td>Protoplast cell counting</td>
		</tr>
		<tr>
			<td>UV crosslinking apparatus 
			(HL-2000 HybriLinker)</td>
			<td>UVP, LLC</td>
			<td>UVP95003101</td>
			<td>in vivo UV crosslinking</td>
		</tr>
		<tr>
			<td>UV lamp 
			(Sankyo-Denki G8T5)</td>
			<td>SANKYO 
			DENKI</td>
			<td>SD G8T5</td>
			<td>in vivo UV crosslinking</td>
		</tr>
		<tr>
			<td>50 mL glass syringe</td>
			<td>FORTUNA Optima</td>
			<td>Z314560</td>
			<td>Homogenization of protoplast lysate</td>
		</tr>
		<tr>
			<td>Narrow needle (0.9 x 25 mm)</td>
			<td>Becton Dickinson microlance 3</td>
			<td>2021-04</td>
			<td>Homogenization of protoplast lysate</td>
		</tr>
		<tr>
			<td>Rotator Model L26</td>
			<td>Labinco BV</td>
			<td>26110912</td>
			<td>Sample incubation by rotating</td>
		</tr>
		<tr>
			<td>Oligo-d(T)25 magnetic beads 
			(5 mg/mL)</td>
			<td>New England BioLabs</td>
			<td>S1419S</td>
			<td>mRNPs and mRNAs binding and pull-down</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>Invitrogen</td>
			<td>CS15000</td>
			<td>mRNPs and mRNAs binding and pull-down</td>
		</tr>
		<tr>
			<td>Centrifugal filter units 
			(Amicon Ultra-4 centrifugal filter units)</td>
			<td>EMD Millipore</td>
			<td>UFC800308</td>
			<td>mRBP concentration</td>
		</tr>
		<tr>
			<td>Pierce Silver Stain Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>24612</td>
			<td>Silver-staining assay</td>
		</tr>
		<tr>
			<td>RNA purification kit 
			(InviTrap Spin Plant RNA Mini Kit)</td>
			<td>STRATEC Molecular</td>
			<td>1064100300</td>
			<td>RNA purification</td>
		</tr>
		<tr>
			<td>Spectrophotometer device (NanoDrop 1000 Spectrophotometer)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ND-1000</td>
			<td>RNA quality and quantity</td>
		</tr>
		<tr>
			<td>Real-Time PCR cycler 
			(StepOne Real-Time PCR cycler)</td>
			<td>Thermo Fisher Scientific</td>
			<td>4376600</td>
			<td>cDNA quantification</td>
		</tr>
		<tr>
			<td>&#181;-C18 columns 
			(Millipore Zip Tip &#181;-C18 columns)</td>
			<td>Sigma-aldrich</td>
			<td>720046-960EA</td>
			<td>Peptide purification</td>
		</tr>
		<tr>
			<td>Mass spectrometer 
			(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)</td>
			<td>Thermo Fisher Scientific</td>
			<td>IQLAAEGAAPFALGMAZR</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ULTIM3000RSLCNANO</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>C18 column 
			(Easy Spray Pepmap RSLC C18 column)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ES800</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>C18 precolumn 
			(Acclaim Pepmap 100 C18 precolumn)</td>
			<td>Thermo Fisher Scientific</td>
			<td>160321</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Primers for qRT-PCR assay</td>
			<td colspan="3">Sequences</td>
		</tr>
		<tr>
			<td>UBQ10 mRNA 
			(Li et al., 2014)</td>
			<td colspan="3">Fw: AACTTTGGTGGTTTGTGTTTTGG 
			Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA</td>
		</tr>
		<tr>
			<td>18S rRNA 
			(Durut et al., 2014)</td>
			<td colspan="3">Fw: CGTAGTTGAACCTTGGGATG 
			Rv: CACGACCCGGCCAATTA</td>
		</tr>
	</tbody>
</table>

mrna interactome capture from plant protoplasts

RNA 결합 단백질 (RBP)은 RNA의 운명을 결정합니다. 그들은 모든 RNA 생합성 경로에 참여하며 특히 mRNA (messenger RNAs)의 전사 후 유전자 조절 (post-transcriptional gene regulation, PTGR)에 기여합니다. 지난 몇 년 동안, 효모 및 포유류 세포주의 많은 mRNA 결합 단백질은 mRNA 결합 단백질 (mRBPs)의 동정을 가능케하는 &quot;mRNA 상호 작용 체 포획 (interaction)&quot;이라는 새로운 방법의 사용을 통해 성공적으로 분리되었다. 생리적 인 환경에서 직접적으로. 이 방법은 올리고 (dT) 비드에 의한 메신저 리보 뉴클레오타이드 복합체 (mRNP)의 생체 내 자외선 (UV) 가교 결합, 풀다운 및 정제, 및 질량 분석기 (MS)에 의한 가교 결합 단백질의 후속 확인으로 구성된다. 아주 최근에 같은 방법을 적용하여 여러 가지 식물 mRNA 결합 프로테옴이 다른 Arabidopsis 조직 공급원에서 동시에보고되었다 : 뿌리 뽑힌 묘목, 잎 조직,엽초 엽 모세포 및 배양 된 뿌리 세포를 포함한다. 여기, 우리는 Arabidopsis thaliana 엽초 엽 원형질에 대한 최적화 된 mRNA 인터랙티브 캡쳐 방법을 제시하는데, 이는 다양한 세포 분석을 포함하는 실험을위한 다용도 도구의 역할을하는 세포 유형이다. 최적의 단백질 수율을위한 조건에는 조직의 시작과 UV 조사 시간이 포함됩니다. 중간 규모 실험 (10 7 세포)에서 얻은 mRNA 결합 프로테옴에서 RNA 결합 능력을 가진 RBP가 과다하게 나타 났으며 많은 새로운 RBP가 확인되었다. 실험을 확대 (10 9 세포) 할 수 있으며 최적화 된 방법을 다른 식물 세포 유형 및 종에 적용하여 식물에서 mRNA 결합 단백질을 광범위하게 분리, 분류 및 비교할 수 있습니다.

우리는 세척 버퍼 2 ( 그림 1B )와 함께 세척 단계 4.3에서 CL 샘플의 비드 펠렛을 둘러싼 특징적인 후광을 관찰했습니다. 그것이 조사되지 않았지만,이 현상은 자성 포획 동안 가교 결합 된 mRNP 복합체가 비드 응집체와 간섭하여보다 확산 된 응집체가 형성되는 것으로 설명 될 수있다. 그것은 (T) (25)의 비드 포착 올리고 D 14 효?...

Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

mRNA Interactome Capture from Plant Protoplasts

여기, 우리는 Arabidopsis thaliana 엽초 엽 원형체에 적용된 상호 작용 캡처 프로토콜을 제시한다. 이 방법은 생체 내 UV 가교 결합에 비판적으로 의존하며 생리 환경으로부터 식물 mRNA 결합 단백질의 분리 및 동정을 허용합니다.

식물 원형질에서 mRNA Interactome 캡처

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

mrna-interactome-capture-from-plant-protoplasts

Research

JoVE Journal

Biochemistry

9.0K 조회수.  KU Leuven.  여기, 우리는 Arabidopsis thaliana 엽초 엽 원형체에 적용된 상호 작용 캡처 프로토콜을 제시한다. 이 방법은 생체 내 UV 가교 결합에 비판적으로 의존하며 생리 환경으로부터 식물 mRNA 결합 단백질의 분리 및 동정을 허용합니다. 

비디오: mRNA Interactome Capture from Plant Protoplasts

Protein Complex Affinity Capture from Cryomilled Mammalian Cells

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this technique is also frequently referred to as immunoprecipitation. Affinity capture can be applied in a bench-scale and in a high-throughput context. When coupled with protein mass spectrometry, affinity capture has proven to be a workhorse of interactome analysis. Although there are potentially many ways to execute the numerous steps involved, the following protocols implement our favored methods. Two features are distinctive: the use of cryomilled cell powder to produce cell extracts, and antibody-coupled paramagnetic beads as the affinity medium. In many cases, we have obtained superior results to those obtained with more conventional affinity capture practices. Cryomilling avoids numerous problems associated with other forms of cell breakage. It provides efficient breakage of the material, while avoiding denaturation issues associated with heating or foaming. It retains the native protein concentration up to the point of extraction, mitigating macromolecular dissociation. It reduces the time extracted proteins spend in solution, limiting deleterious enzymatic activities, and it may reduce the non-specific adsorption of proteins by the affinity medium. Micron-scale magnetic affinity media have become more commonplace over the last several years, increasingly replacing the traditional agarose- and Sepharose-based media. Primary benefits of magnetic media include typically lower non-specific protein adsorption; no size exclusion limit because protein complex binding occurs on the bead surface rather than within pores; and ease of manipulation and handling using magnets.

Here we describe protocols to disrupt mammalian cells by solid-state milling at a cryogenic temperature, produce a cell extract from the resulting cell powder, and isolate protein complexes of interest by affinity capture upon antibody-coupled micron-scale paramagnetic beads.

Cryomilled 포유 동물 세포에서 단백질 단지 선호도 캡처

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this ...

연구

생화학

Experimental Design for Laser Microdissection RNA-Seq: Lessons from an Analysis of Maize Leaf Development

Genes with important roles in development frequently have spatially and/or temporally restricted expression patterns. Often these gene transcripts are not detected or are not identified as differentially expressed (DE) in transcriptomic analyses of whole plant organs. Laser Microdissection RNA-Seq (LM RNA-Seq) is a powerful tool to identify genes that are DE in specific developmental domains. However, the choice of cellular domains to microdissect and compare, and the accuracy of the microdissections are crucial to the success of the experiments. Here, two examples illustrate design considerations for transcriptomics experiments; a LM RNA-seq analysis to identify genes that are DE along the maize leaf proximal-distal axis, and a second experiment to identify genes that are DE in liguleless1-R (lg1-R) mutants compared to wild-type. Key elements that contributed to the success of these experiments were detailed histological and in situ hybridization analyses of the region to be analyzed, selection of leaf primordia at equivalent developmental stages, the use of morphological landmarks to select regions for microdissection, and microdissection of precisely measured domains. This paper provides a detailed protocol for the analysis of developmental domains by LM RNA-Seq. The data presented here illustrate how the region selected for microdissection will affect the results obtained.

Many developmentally important genes have cell- or tissue-specific expression patterns. This paper describes LM RNA-seq experiments to identify genes that are differentially expressed at the maize leaf blade-sheath boundary and in lg1-R mutants compared to wild-type. The experimental considerations discussed here apply to transcriptomic analyses of other developmental phenomena.

레이저 이외에 Microdissection RNA-서열에 대한 실험 디자인 : 옥수수 잎 개발의 분석 교훈

Genes with important roles in development frequently have spatially and/or temporally restricted expression patterns. Often these gene transcripts are not ...

A Simple Fractionated Extraction Method for the Comprehensive Analysis of Metabolites, Lipids, and Proteins from a Single Sample

Understanding of complex biological systems requires the measurement, analysis and integration of multiple compound classes of the living cell, usually determined by transcriptomic, proteomic, metabolomics and lipidomic measurements. In this protocol, we introduce a simple method for the reproducible extraction of metabolites, lipids and proteins from biological tissues using a single aliquot per sample. The extraction method is based on a methyl tert-butyl ether: methanol: water system for liquid: liquid partitioning of hydrophobic and polar metabolites into two immiscible phases along with the precipitation of proteins and other macromolecules as a solid pellet. This method, therefore, provides three different fractions of specific molecular composition, which are fully compatible with common high throughput 'omics' technologies such as liquid chromatography (LC) or gas chromatography (GC) coupled to mass spectrometers. Even though the method was initially developed for the analysis of different plant tissue samples, it has proved to be fully compatible for the extraction and analysis of biological samples from systems as diverse as algae, insects, and mammalian tissues and cell cultures.

A protocol for comprehensive extraction of lipids, metabolites and proteins from biological tissues using one sample is presented.

단일 시료의 대사 산물, 지질 및 단백질의 종합 분석을위한 간단한 분취 추출 방법

Understanding of complex biological systems requires the measurement, analysis and integration of multiple compound classes of the living cell, usually ...

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from the oxidation of reduced compounds such as nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2). The complete annotation of the Arabidopsis thaliana genome has established it as the most widely used plant model system, and thus the need to purify mitochondria from a variety of organs (leaf, root, or flower) is necessary to fully utilize the tools that are now available for Arabidopsis to study mitochondrial biology. Mitochondria are isolated by homogenization of the tissue using a variety of approaches, followed by a series of differential centrifugation steps producing a crude mitochondrial pellet that is further purified using continuous colloidal density gradient centrifugation. The colloidal density material is subsequently removed by multiple centrifugation steps. Starting from 100 g of fresh leaf tissue, 2 - 3 mg of mitochondria can be routinely obtained. Respiratory experiments on these mitochondria display typical rates of 100 - 250 nmol O2 min-1 mg total mitochondrial protein-1 (NADH-dependent rate) with the ability to use various substrates and inhibitors to determine which substrates are being oxidized and the capacity of the alternative and cytochrome terminal oxidases. This protocol describes an isolation method of mitochondria from Arabidopsis thaliana leaves using continuous colloidal density gradients and an efficient respiratory measurements of purified plant mitochondria.

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

As mitochondria are only a small percentage of the plant cell, they need to be purified for a range of studies. Mitochondria can be isolated from a variety of plant organs by homogenization, followed by differential and density gradient centrifugation to obtain a highly purified mitochondrial fraction.

절연 및 호흡 측정의 미토 콘 드리 아 애기 thaliana 에서

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Leaf Spray Mass Spectrometry: A Rapid Ambient Ionization Technique to Directly Assess Metabolites from Plant Tissues

Plants produce thousands of small molecules that are diverse in their chemical properties. Mass spectrometry (MS) is a powerful technique for analyzing plant metabolites because it provides molecular weights with high sensitivity and specificity. Leaf spray MS is an ambient ionization technique where plant tissue is used for direct chemical analysis via electrospray, eliminating chromatography from the process. This approach to sampling metabolites allows for a wide range of chemical classes to be detected simultaneously from intact plant tissues, minimizing the amount of sample preparation needed. When used with a high-resolution, accurate mass MS, leaf spray MS facilitates the rapid detection of metabolites of interest. It is also possible to collect tandem mass fragmentation data with this technique to facilitate a compound identification. The combination of accurate mass measurements and fragmentation is beneficial in confirming compound identities. The leaf spray MS technique requires only minor modifications to a nanospray ionization source and is a useful tool to further expand the capabilities of a mass spectrometer. Here, fresh leaf tissue from Sceletium tortuosum (Aizoaceae), a traditional medicinal plant from South Africa, is analyzed; numerous mesembrine alkaloids are detected with leaf spray MS.

Leaf spray mass spectrometry is a direct chemical analysis technique that minimizes the sample preparation and eliminates chromatography, allowing for the rapid detection of small molecules from plant tissues.

잎 스프레이 질량 분석: 식물 조직에서 대사를 직접 평가 하는 급속 한 대기 이온화 기술

Plants produce thousands of small molecules that are diverse in their chemical properties. Mass spectrometry (MS) is a powerful technique for analyzing ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a chemical defense because it has antimicrobial activity and is considered a natural insecticide. Caffeine can also produce negative allelopathic effects that prevent the growth of surrounding plants. In addition, people around the world consume caffeine for its analgesic and stimulatory effects. Due to interest in the technological applications of caffeine, research on the biosynthetic pathway of this compound has grown. These studies have primarily focused on understanding the biochemical and molecular mechanisms that regulate the biosynthesis of caffeine. In vitro tissue culture has become a useful system for studying this biosynthetic pathway. This article will describe a step-by-step protocol for the quantification of caffeine and for measuring the transcript levels of the gene (CCS1) encoding caffeine synthase (CS) in cell suspensions of C. arabica L. as well as its activity.

This protocol describes an efficient methodology for the extraction and quantification of caffeine in cell suspensions of C. arabica L. and an experimental process for evaluating the enzymatic activity of caffeine synthase with the expression level of the gene that encodes this enzyme.

카페인 추출, 효소 활동 및 식물 세포 정지에서 카페인 Synthase의 유전자 발현

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Studying Protein Import into Chloroplasts Using Protoplasts

The chloroplast is an essential organelle that is responsible for various cellular processes in plants, such as photosynthesis and the production of many secondary metabolites and lipids. Chloroplasts require a large number of proteins for these various physiological processes. Over 95% of chloroplast proteins are nucleus-encoded and imported into chloroplasts from the cytosol after translation on cytosolic ribosomes. Thus, the proper import or targeting of these nucleus-encoded chloroplast proteins to chloroplasts is essential for the proper functioning of chloroplasts as well as the plant cell. Nucleus-encoded chloroplast proteins contain signal sequences for specific targeting to chloroplasts. Molecular machinery localized to the chloroplast or cytosol recognize these signals and carry out the import process. To investigate the mechanisms of protein import or targeting to chloroplasts in vivo, we developed a rapid, efficient protoplast-based method to analyze protein import into chloroplasts of Arabidopsis. In this method, we use protoplasts isolated from leaf tissues of Arabidopsis. Here, we provide a detailed protocol for using protoplasts to investigate the mechanism by which proteins are imported into chloroplasts.

Here we describe a protocol to express proteins into protoplasts by using PEG-mediated transformation method. The method provides easy expression of proteins of interest, and efficient investigation of protein localization and the import process for various experimental conditions in vivo.

Protoplasts를 사용 하 여 엽록체로 공부 단백질 가져오기

The chloroplast is an essential organelle that is responsible for various cellular processes in plants, such as photosynthesis and the production of many ...

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture (CARIC) Strategy

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used strategy for RBP capture exploits the polyadenylation [poly(A)] of target RNAs, which mostly occurs on eukaryotic mature mRNAs, leaving most binding proteins of non-poly(A) RNAs unidentified. Here we describe the detailed procedures of a recently reported method termed click chemistry-assisted RNA-interactome capture (CARIC), which enables the transcriptome-wide capture of both poly(A) and non-poly(A) RBPs by combining the metabolic labeling of RNAs, in vivo UV cross-linking, and bioorthogonal tagging.

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture CARIC Strategy

A detailed protocol for applying the click chemistry-assisted RNA-interactome capture (CARIC) strategy to identify proteins binding to both coding and noncoding RNAs is presented.

캡처 클릭 화학 기반 RNA 위하여를 사용 하 여 RNA 의무적인 단백질의 포착 (CARIC) 전략

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological functions. Such interactions can be highly dynamic, meaning the interacting subunits are constantly associated and dissociated at certain rates. While measuring the binding affinity using techniques such as quantitative pull-down reveals the strength of the interaction, studying the binding kinetics provides insights on how fast the interaction occurs and how long each complex can exist. Furthermore, measuring the kinetics of an interaction in the presence of an additional factor, such as a protein exchange factor or a drug, helps reveal the mechanism by which the interaction is regulated by the other factor, providing important knowledge for the advancement of biological and medical research. Here, we describe a protocol for measuring the binding kinetics of a protein complex that has a high intrinsic association rate and can be dissociated quickly by another protein. The method uses fluorescence resonance energy transfer to report the formation of the protein complex in vitro, and it enables monitoring the fast association and dissociation of the complex in real time on a stopped-flow fluorimeter. Using this assay, the association and dissociation rate constants of the protein complex are quantified.

Protein-protein interactions are critical for biological systems, and studies of the binding kinetics provide insights into the dynamics and function of protein complexes. We describe a method that quantifies the kinetic parameters of a protein complex using fluorescence resonance energy transfer and the stopped-flow technique. &#160;

체 외 형광 공명 에너지 전달에 밀리초 시간 규모에서 단백질 복합물의 역학을 공부 하는 사용 하 여

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...

Label-Free Immunoprecipitation Mass Spectrometry Workflow for Large-scale Nuclear Interactome Profiling

Immunoaffinity purification mass spectrometry (IP-MS) has emerged as a robust quantitative method of identifying protein-protein interactions. This publication presents a complete interaction proteomics workflow designed for identifying low abundance protein-protein interactions from the nucleus that could also be applied to other subcellular compartments. This workflow includes subcellular fractionation, immunoprecipitation, sample preparation, offline cleanup, single-shot label-free mass spectrometry, and downstream computational analysis and data visualization. Our protocol is optimized for detecting compartmentalized, low abundance interactions that are difficult to identify from whole cell lysates (e.g., transcription factor interactions in the nucleus) by immunoprecipitation of endogenous proteins from fractionated subcellular compartments. The sample preparation pipeline outlined here provides detailed instructions for the preparation of HeLa cell nuclear extract, immunoaffinity purification of endogenous bait protein, and quantitative mass spectrometry analysis. We also discuss methodological considerations for performing large-scale immunoprecipitation in mass spectrometry-based interaction profiling experiments and provide guidelines for evaluating data quality to distinguish true positive protein interactions from nonspecific interactions. This approach is demonstrated here by investigating the nuclear interactome of the CMGC kinase, DYRK1A, a low abundance protein kinase with poorly defined interactions within the nucleus.

Described is a proteomics workflow for identifying protein interaction partners from a nuclear subcellular fraction using immunoaffinity enrichment of a given protein of interest and label-free mass spectrometry. The workflow includes subcellular fractionation, immunoprecipitation, filter aided sample preparation, offline cleanup, mass spectrometry, and a downstream bioinformatics pipeline.

대규모 핵 상호 작용 프로파일링을 위한 라벨 없는 면역 침전 질량 분광 워크플로우

Immunoaffinity purification mass spectrometry (IP-MS) has emerged as a robust quantitative method of identifying protein-protein interactions. This ...