Name: mrna interactome capture from plant protoplasts
Uploaded: 2017-07-28T13:00:00.000+00:00
Duration: 12 min 29 s
Description: Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

우리는 기존 UV 램프가 장착 된 UV 가교 장치를 제공 한 Joris Winderickx 교수의 실험실을 인정합니다. KG는 KU Leuven 연구 기금이 지원하며 FWO 교부금 G065713N의 지원을 인정합니다.

저자는 공개 할 것이 없습니다.

우리는 성공적으로 효모 및 인간 세포를 위해 개발 된 mRNA 상호 작용 포획을 엽초 엽 원형 엽록체에 적용했다. 잎 초 필 세포는 식물 잎의 지상 조직의 주요 유형입니다. 이 방법의 가장 큰 장점은 생체 환경에서 단백질을 발견하기 위해 생체 내 가교 결합을 사용한다는 것입니다. 이 프로토콜에서, 우리는 주로 최적의 실험 조건 (50) (예를 들...

진핵 생물은 세포 생물학적 과정을 유지하기 위해 다중 RNA 생합성 조절 경로를 사용합니다. 알려진 종류의 RNA 중에서 mRNA는 매우 다양하며 단백질과 그 이소 형의 코딩 용량을 가지고 있습니다 1. PTGR 경로는 pre-mRNA 2 , 3 의 운명을 지시합니다. 서로 다른 유전자 군의 RBP가 RNA의 조절을 조절하고, PTGR에서는 특정 mRBP가 기능적 mRNP를 형성하는 직접적인 물리적 상호 작용을 통해 mRNA를 유도합니다. 따라서, 식별 및 mRBPs의 특성과 mRNPs 것은 지난 30 년 .Over 세포의 mRNA 대사 2의 규정을 이해하는 데 중요하다, 다양한 시험 관내 방법 - RNA 전기 영동 이동성의 변화 (REMSA) 분석, 지수 농축 분석에 의한 리간드의 체계적 발전을 포함하여 (RBNS), 방사성 표지 또는 정량 분석 ​​(RNA Bind-n-Seq, RBNS)형광 RNA 결합 분석, X 선 결정학 및 NMR 분광법은 4, 5, 6, 7, 8, 9 - 널리 주로 포유 동물 세포에서 RBPs 연구에 적용되어왔다. 포유류 RBP에 대한 이러한 연구의 결과는 RNA-binding Protein DataBase (RBPDB)를 통해 검색 할 수 있으며, 이는 공개 된 관측치 10 을 수집합니다. 이러한 in vitro 접근법은 강력한 도구이지만 주어진 RNA 풀 시퀀스로부터 결합 된 RNA 모티프를 결정하므로 새로운 표적 RNA를 발견 할 수있는 능력이 제한적입니다. 계산 전략은 단백질 서열의 보존을 기반으로 게놈 전체의 RBPs을 예측하고 (15)를 구성하는 마찬가지입니다. 이를 극복하기 위해 새로운 실험 방법 인 ha이는 관심의 RBP가 상호 작용하는 RNA 모티프의 식별 및 결합의 정확한 위치 결정을 가능하게합니다. &quot;crosslinking and immunoprecipitation&quot;(CLIP)이라고 불리는이 방법 은 생체 내 UV 가교 결합 후 면역 침전 11로 구성 됩니다. 초기 연구에 따르면 245 nm보다 큰 자외선 파장에서 DNA 및 RNA 뉴클레오티드의 광 활성화가 발생할 수 있습니다. 티미 딘을 통한 반응이 선호되는 것으로 보인다 (광 반응성 감소 순서 : dT ≥ dC&gt; rU&gt; rC, dA, dG) 12 . 파장이 254 nm (UV-C) 인 UV 광을 사용하여 단 몇 옹스트롬 (Å) 범위에서 RNA 뉴클레오타이드와 단백질 잔기 사이의 공유 결합이 생성되는 것으로 관찰되었습니다. 따라서이 현상을 RNA와 RBP의 &quot;zero-length&quot;가교라고합니다. 이것은 엄격한 정화 과정<html> 배경이 거의없는 채약 13 , 14 . CLIP에 보완적인 전략은 RBP의 풍경을 기술하기 위해 단백질 확인과 생체 내 UV 교차 결합을 결합하는 것입니다. 이러한 게놈 전체 mRNA에 결합 된 프로테옴의 수는, &quot;mRNA의 상호 작용 체 캡처&quot;(18)라고, 효모 세포, 배아 줄기 세포 (는 ESC),이 새로운 실험 방법을 사용하여 인간의 세포 라인 (즉, HEK293와 헬라)에서 분리 된 19 , 20 , 21 . 이 방법은 생체 내 UV 가교 결합과 mRNP 정제 및 MS 기반 프로테오믹스로 구성됩니다. 이 전략을 적용함으로써, 비표준 RBD를 포함하는 많은 새로운 &quot;달빛&quot;RBP가 발견되었고, 더 많은 단백질이 이전에 상상했던 것보다 RNA 결합 능력을 가지고 있음이 분명 해졌다&quot;&gt; 15, 16, 17.이 방법의 사용은 새로운 애플리케이션과 RBPs을 조사 할 때 새로운 생물학적 질문에 대답 할 수있는 기능을 허용합니다. 예를 들어, 최근의 연구는 mRNA에 결합 된 프로테옴 (핵심 RBP의 보존을 조사하고있다 proteome) 22 . 식물 RBP는 이미 성장과 발달에 관여하고있다 ( 예 : 개화시기의 후 전사 조절, 24 시간주기, 미토콘드리아와 엽록체의 유전자 발현) 24 , 25 , 26 , 27 , 28 , 29 . 또한, 그들은 비 생물 적 스트레스에 반응하는 세포 과정에서 기능을 수행하는 것으로 생각된다 ( 예, 감기, 가뭄, salinity 및 abscisic acid (ABA)) 31 , 32 , 33 , 34 . RNA 인식 모티프 (RRM) 및 K 상 동성 (KH) 도메인 서열 모티프에 기초하여 애기 장대 게놈에 200 개 이상의 예측 된 RBP 유전자가 존재하며; 쌀에는 대략 250 개가 35 , 36 으로 기록되어있다. 예상되는 많은 RBP가 식물에만 고유 한 것으로 여겨지는 것은 주목할 만하다. ( 예를 들어, RRM 도메인을 포함하는 예측 된 Arabidopsis RBP의 약 50 %에 걸친 metazoan ortholog는 없다) 35) , 이는 많은 사람들이 새로운 기능을 수행 할 수 있음을 시사한다. 대부분의 예측 RBPs의 기능은 23지지 않은 남아있다. Arabidopsis 에서 발현 된 mRNA- 결합 된 프로테옴의 분리는 모종, 잎 조직, 배양 된 뿌리 세포 및 잎의 엽초 원형질체를mRNA의 상호 작용 체 캡처은 최근 39 (38)보고되었다. 이 연구는 가까운 장래에 식물에서 기능적 RBP를 체계적으로 목록화할 강력한 가능성을 보여줍니다. 여기, 우리는 식물 protoplasts ( 즉, 세포 벽이없는 세포)에서 mRNA interactome 캡처에 대한 프로토콜을 제시한다. Arabidopsis thaliana 엽초 엽 원형 엽 세포는 잎 세포의 주요 유형이다. 분리 된 원형질체는 세포에 자외선을 최적으로 닿게합니다. 이 세포 유형은 기능적 특성을 위해 단백질을 일시적으로 발현하는 분석법에서 사용할 수 있습니다 40 , 41 . 또한 protoplasting 다른 여러 식물 세포 종류 및 종을 42, 43, 44에 적용되어왔다 (., Bargmann 바움 및 2010; 예를 들어, 피터슨 등, 2009 년 홍콩 등, 2012).. &lt;p class = &quot;jove_content&quot;&gt;이 방법은 총 11 단계 ( 그림 1A )를 포함합니다. Arabidopsis 엽초 엽 원형체를 먼저 단리하고 (단계 1) UV 조사를하여 가교 결합 된 mRNP를 형성한다 (단계 2). 원형질체가 변성 조건 (단계 3) 하에서 용해 될 때, 가교 결합 된 mRNP는 용해 / 결합 완충액에서 방출되고 oligo-d (T) 25 비드에 의해 당겨진다 (단계 4). 몇 차례의 엄격한 세척 후에, mRNP를 정제하고 추가로 분석한다. mRBPs의 변성 펩티드는 가교 결합 mRNA가 정제되기 전에 프로 테이나 제 K에 의해 분해되고 RNA 품질은 qRT-PCR (단계 5 및 6)에 의해 검증된다. RNase 처리 및 단백질 농도 (단계 7) 후에, 단백질 품질은 SDS 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE) 및은 염색 (단계 8)에 의해 조절된다. 단백질 밴드 패턴의 차이점은 가교 샘플 (CL)과 비가 교 샘플 (non-crosslinked sample) 사이에서 쉽게 시각화 될 수 있습니다.UV 조사를받지 않은 원형질체로부터의 음성 대조군 샘플). 단백질의 확인은 MS 기반 프로테오믹스를 통해 이루어집니다. CL 샘플의 단백질은 1 차원 폴리 아크릴 아미드 겔 전기 영동 (1D-PAGE)으로 분리되어 가능한 배경 오염을 제거하고, 트립신을 사용하여 짧은 펩타이드로 &quot;in-gel digestion&quot;되고 정제됩니다 (9 단계). 질량 분광기 (nano-LC-MS)에 결합 된 나노 역상 액체 크로마토 그래피는 mRNA- 결합 프로테옴에서 결정적인 단백질의 양을 결정할 수있게합니다 (단계 10). 마지막으로, 확인 된 mRBPs는 생물 정보학 분석을 사용하여 특성화되고 목록 화됩니다 (11 단계).

<table><tbody><tr><td>&lt;strong&gt;REAGENTS&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>0.8 M Mannitol</td><td>Sigma</td><td>M1902-500G</td><td>Primary isotonic Enzyme solution &amp;amp;&lt;br/&gt; MMg solution</td></tr><tr><td>2 M KCl</td><td>MERCK</td><td>Art. 4935</td><td>Primary isotonic Enzyme solution &amp;amp;&lt;br/&gt; W5 buffer</td></tr><tr><td>0.2 M MES (pH 5.7)&lt;br/&gt; (4-morpholineethanesulfonic acid)</td><td>Sigma-aldrich</td><td>M2933</td><td>Primary isotonic Enzyme solution,&lt;br/&gt; W5 buffer &amp;amp;&lt;br/&gt; MMg solution,&lt;br/&gt; Filtration sterilization</td></tr><tr><td>Cellulase R10</td><td>Yakult Pharmaceutical Industry Co., Ltd.</td><td>CELLULASE&lt;br/&gt; &amp;ldquo;ONOZUKA&amp;rdquo;&lt;br/&gt; R-10, 10 g</td><td>Final isotonic enzyme solution</td></tr><tr><td>Macerozyme R10</td><td>Yakult Pharmaceutical Industry Co., Ltd.</td><td>MACEROZYME R-10, 10g</td><td>Final isotonic enzyme solution</td></tr><tr><td>10% (&lt;em&gt;w/v&lt;/em&gt;) BSA&lt;br/&gt; (Bovine Serum Albumin)</td><td>Sigma-aldrich</td><td>A7906-100G</td><td>Final isotonic enzyme solution &amp;amp;&lt;br/&gt; Filtration sterilization</td></tr><tr><td>1 M CaCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Chem-Lab NV</td><td>CL00.0317.1000</td><td>Final isotonic enzyme solution,&lt;br/&gt; W5 buffer &amp;amp;&lt;br/&gt; Digestion buffer</td></tr><tr><td>1 M NaCl</td><td>Fisher Chemical</td><td>S/3160/60</td><td>W5 buffer</td></tr><tr><td>2 M MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>M8266-100G</td><td>MMg solution</td></tr><tr><td>1 M LiCl&lt;br/&gt; (Lithium Chloride)</td><td>Acros</td><td>199885000</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2 &amp;amp;&lt;br/&gt; Low salt buffer</td></tr><tr><td>5% (&lt;em&gt;w/v&lt;/em&gt;) LiDS&lt;br/&gt; (Lithium Dodecyl Sulphate)</td><td>Sigma-aldrich</td><td>L4632-25G</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1 &amp;amp;&lt;br/&gt; Filtration sterilization</td></tr><tr><td>1 M DTT&lt;br/&gt; (Dithiothreitol)</td><td>Thermo Fisher Scientific&lt;br/&gt; Wash buffer 1 &amp;amp;&lt;br/&gt; Wash buffer 2</td><td>307866</td><td>Lysis/binding buffer,</td></tr><tr><td>1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl))</td><td>Acros &amp;amp;&lt;br/&gt; Fisher Chemical</td><td>167620010 &amp;amp;&lt;br/&gt; H/1200/PB15</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2,&lt;br/&gt; Low salt buffer &amp;amp;&lt;br/&gt; Elution buffer</td></tr><tr><td>0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid)</td><td>Sigma-aldrich</td><td>ED-500G</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2,&lt;br/&gt; Low salt buffer &amp;amp;&lt;br/&gt; Elution buffer</td></tr><tr><td>Tween 20</td><td>MERCK</td><td>8.22184.0500</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>0.1 M NaOH</td><td>VWR PROLABO CHEMICALS</td><td>28244.295</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>1x PBS (pH 7.4)&lt;br/&gt; (Phosphate Buffered Saline)&lt;br/&gt; containing&lt;br/&gt; (NaCl; KCl; Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;; KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Fisher Chemical, MERCK,&lt;br/&gt; Sigma-aldrich &amp;amp; SAFC</td><td>S/3160/60,&lt;br/&gt; Art. 4935,&lt;br/&gt; 71640-250G &amp;amp;&lt;br/&gt; 60230</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>Proteinase K solution (2 &amp;mu;g/&amp;mu;L)</td><td>Thermo Fisher Scientific</td><td>11789020</td><td>Protein digestion</td></tr><tr><td>Loading dye</td><td>Invitrogen</td><td>LC5925</td><td>SDS-PAGE</td></tr><tr><td>qPCR master mix</td><td>Promega</td><td>A6001</td><td>qRT-PCR assay</td></tr><tr><td>RNase Cocktail</td><td>Thermo Fisher Scientific</td><td>AM2286</td><td>RNA digestion</td></tr><tr><td>Methanol</td><td>Sigma-aldrich</td><td>322415</td><td>Gel fixation and gel destaining</td></tr><tr><td>Acetic acid</td><td>Sigma-aldrich</td><td>537020</td><td>Gel fixation and gel destaining</td></tr><tr><td>Coomassie Brilliant Blue R-250</td><td>Thermo Fisher Scientific</td><td>20278</td><td>Gel staining</td></tr><tr><td>1 M NH&lt;sub&gt;4&lt;/sub&gt;HCO&lt;sub&gt;3&lt;/sub&gt;&lt;br/&gt; (Ammonium bicarbonate)&lt;br/&gt; &amp;nbsp;</td><td>Sigma-aldrich</td><td>09830-500G</td><td>Gel hydration &amp;amp;&lt;br/&gt; Digestion buffer</td></tr><tr><td>CH&lt;sub&gt;3&lt;/sub&gt;CN&lt;br/&gt; (Acetonitrile)</td><td>Sigma-aldrich</td><td>34851-100ML</td><td>Gel dehydration &amp;amp;&lt;br/&gt; Peptide dissolving solution</td></tr><tr><td>IAA&lt;br/&gt; (Iodoacetic acid)</td><td>Sigma-aldrich</td><td>I4386-10G</td><td>Alkylating agent</td></tr><tr><td>TFA&lt;br/&gt; (Trifluoroacetic acid)</td><td>Sigma-aldrich</td><td>302031-10X1ML</td><td>Peptide dissolving solution</td></tr><tr><td>FA&lt;br/&gt; (Formic acid)</td><td>Sigma-aldrich</td><td>06554-5G</td><td>Peptide extraction</td></tr><tr><td>Trypsin solution (6 ng/&amp;mu;L)</td><td>Promega</td><td>V5280</td><td>Digestion buffer</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;EQUIPMENT&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Soil</td><td>Peltracom</td><td>LP2D</td><td>Plant growth</td></tr><tr><td>Vermiculite 3</td><td>Sibli AS</td><td>05VERMICULIET</td><td>Plant growth</td></tr><tr><td>Petri dish (150 x 20 mm)</td><td>Sarstedt</td><td>82.1184.500</td><td>Carrier for protoplast suspension</td></tr><tr><td>0.22 &amp;mu;m filter</td><td>Millipore</td><td>SE2M229104</td><td>Homogenization of final isotonic enzyme solution</td></tr><tr><td>Razorblade</td><td>Agar Scientific</td><td>T585</td><td>Rosette leaf strips</td></tr><tr><td>35-75 &amp;mu;m nylon mesh</td><td>SEFAR NITEX</td><td>74010</td><td>Protoplast suspension filtration</td></tr><tr><td>50 mL round bottom tubes</td><td>Sigma-aldrich</td><td>T1918-10EA</td><td>Carrier for protoplast suspension</td></tr><tr><td>Hemocytometer&lt;br/&gt; (B&amp;uuml;rker hemocytometer)</td><td>MARIENFELD</td><td>650030</td><td>Protoplast cell counting</td></tr><tr><td>UV crosslinking apparatus&lt;br/&gt; (HL-2000 HybriLinker)</td><td>UVP, LLC</td><td>UVP95003101</td><td>&lt;em&gt;in vivo&lt;/em&gt; UV crosslinking</td></tr><tr><td>UV lamp&lt;br/&gt; (Sankyo-Denki G8T5)</td><td>SANKYO&lt;br/&gt; DENKI</td><td>SD G8T5</td><td>&lt;em&gt;in vivo&lt;/em&gt; UV crosslinking</td></tr><tr><td>50 mL glass syringe</td><td>FORTUNA Optima</td><td>Z314560</td><td>Homogenization of protoplast lysate</td></tr><tr><td>Narrow needle (0.9 x 25 mm)</td><td>Becton Dickinson microlance 3</td><td>2021-04</td><td>Homogenization of protoplast lysate</td></tr><tr><td>Rotator Model L26</td><td>Labinco BV</td><td>26110912</td><td>Sample incubation by rotating</td></tr><tr><td>Oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; magnetic beads&lt;br/&gt; (5 mg/mL)</td><td>New England BioLabs</td><td>S1419S</td><td>mRNPs and mRNAs binding and pull-down</td></tr><tr><td>Magnetic rack</td><td>Invitrogen</td><td>CS15000</td><td>mRNPs and mRNAs binding and pull-down</td></tr><tr><td>Centrifugal filter units&lt;br/&gt; (Amicon Ultra-4 centrifugal filter units)</td><td>EMD Millipore</td><td>UFC800308</td><td>mRBP concentration</td></tr><tr><td>Pierce Silver Stain Kit</td><td>Thermo Fisher Scientific</td><td>24612</td><td>Silver-staining assay</td></tr><tr><td>RNA purification kit&lt;br/&gt; (InviTrap Spin Plant RNA Mini Kit)</td><td>STRATEC Molecular</td><td>1064100300</td><td>RNA purification</td></tr><tr><td>Spectrophotometer device (NanoDrop 1000 Spectrophotometer)</td><td>Thermo Fisher Scientific</td><td>ND-1000</td><td>RNA quality and quantity</td></tr><tr><td>Real-Time PCR cycler&lt;br/&gt; (StepOne Real-Time PCR cycler)</td><td>Thermo Fisher Scientific</td><td>4376600</td><td>cDNA quantification</td></tr><tr><td>&amp;micro;-C18 columns&lt;br/&gt; (Millipore Zip Tip &amp;micro;-C18 columns)</td><td>Sigma-aldrich</td><td>720046-960EA</td><td>Peptide purification</td></tr><tr><td>Mass spectrometer&lt;br/&gt; (Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)</td><td>Thermo Fisher Scientific</td><td>IQLAAEGAAPFALGMAZR</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument)</td><td>Thermo Fisher Scientific</td><td>ULTIM3000RSLCNANO</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>C18 column&lt;br/&gt; (Easy Spray Pepmap RSLC C18 column)</td><td>Thermo Fisher Scientific</td><td>ES800</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>C18 precolumn&lt;br/&gt; (Acclaim Pepmap 100 C18 precolumn)</td><td>Thermo Fisher Scientific</td><td>160321</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Primers for qRT-PCR assay&lt;/strong&gt;</td><td>&lt;strong&gt;Sequences&lt;/strong&gt;</td><td></td><td></td></tr><tr><td>&lt;em&gt;UBQ10&lt;/em&gt; mRNA&lt;br/&gt; (Li &lt;em&gt;et al.&lt;/em&gt;, 2014)</td><td>Fw: AACTTTGGTGGTTTGTGTTTTGG&lt;br/&gt; Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA</td><td></td><td></td></tr><tr><td>18S rRNA&lt;br/&gt; (Durut &lt;em&gt;et al.&lt;/em&gt;, 2014)</td><td>Fw: CGTAGTTGAACCTTGGGATG&lt;br/&gt; Rv: CACGACCCGGCCAATTA</td><td></td><td></td></tr></tbody></table>

mrna interactome capture from plant protoplasts

RNA 결합 단백질 (RBP)은 RNA의 운명을 결정합니다. 그들은 모든 RNA 생합성 경로에 참여하며 특히 mRNA (messenger RNAs)의 전사 후 유전자 조절 (post-transcriptional gene regulation, PTGR)에 기여합니다. 지난 몇 년 동안, 효모 및 포유류 세포주의 많은 mRNA 결합 단백질은 mRNA 결합 단백질 (mRBPs)의 동정을 가능케하는 &quot;mRNA 상호 작용 체 포획 (interaction)&quot;이라는 새로운 방법의 사용을 통해 성공적으로 분리되었다. 생리적 인 환경에서 직접적으로. 이 방법은 올리고 (dT) 비드에 의한 메신저 리보 뉴클레오타이드 복합체 (mRNP)의 생체 내 자외선 (UV) 가교 결합, 풀다운 및 정제, 및 질량 분석기 (MS)에 의한 가교 결합 단백질의 후속 확인으로 구성된다. 아주 최근에 같은 방법을 적용하여 여러 가지 식물 mRNA 결합 프로테옴이 다른 Arabidopsis 조직 공급원에서 동시에보고되었다 : 뿌리 뽑힌 묘목, 잎 조직,엽초 엽 모세포 및 배양 된 뿌리 세포를 포함한다. 여기, 우리는 Arabidopsis thaliana 엽초 엽 원형질에 대한 최적화 된 mRNA 인터랙티브 캡쳐 방법을 제시하는데, 이는 다양한 세포 분석을 포함하는 실험을위한 다용도 도구의 역할을하는 세포 유형이다. 최적의 단백질 수율을위한 조건에는 조직의 시작과 UV 조사 시간이 포함됩니다. 중간 규모 실험 (10 7 세포)에서 얻은 mRNA 결합 프로테옴에서 RNA 결합 능력을 가진 RBP가 과다하게 나타 났으며 많은 새로운 RBP가 확인되었다. 실험을 확대 (10 9 세포) 할 수 있으며 최적화 된 방법을 다른 식물 세포 유형 및 종에 적용하여 식물에서 mRNA 결합 단백질을 광범위하게 분리, 분류 및 비교할 수 있습니다.

우리는 세척 버퍼 2 ( 그림 1B )와 함께 세척 단계 4.3에서 CL 샘플의 비드 펠렛을 둘러싼 특징적인 후광을 관찰했습니다. 그것이 조사되지 않았지만,이 현상은 자성 포획 동안 가교 결합 된 mRNP 복합체가 비드 응집체와 간섭하여보다 확산 된 응집체가 형성되는 것으로 설명 될 수있다. 그것은 (T) (25)의 비드 포착 올리고 D 14 효?...

Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

mRNA Interactome Capture from Plant Protoplasts

여기, 우리는 Arabidopsis thaliana 엽초 엽 원형체에 적용된 상호 작용 캡처 프로토콜을 제시한다. 이 방법은 생체 내 UV 가교 결합에 비판적으로 의존하며 생리 환경으로부터 식물 mRNA 결합 단백질의 분리 및 동정을 허용합니다.

식물 원형질에서 mRNA Interactome 캡처

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

mrna-interactome-capture-from-plant-protoplasts

Research

JoVE Journal

Biochemistry

9.0K 조회수.  KU Leuven.  여기, 우리는 Arabidopsis thaliana 엽초 엽 원형체에 적용된 상호 작용 캡처 프로토콜을 제시한다. 이 방법은 생체 내 UV 가교 결합에 비판적으로 의존하며 생리 환경으로부터 식물 mRNA 결합 단백질의 분리 및 동정을 허용합니다. 

비디오: mRNA Interactome Capture from Plant Protoplasts

A Robotic Platform for High-throughput Protoplast Isolation and Transformation

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal transduction pathways, transcriptional regulatory networks, gene expression, genome-editing, and gene-silencing. Furthermore, significant progress has been made in the regeneration of plants from protoplasts, which has generated even more interest in the use of these systems for plant genomics. In this work, a protocol has been developed for automation of protoplast isolation and transformation from a &#39;Bright Yellow&#39; 2 (BY-2) tobacco suspension culture using a robotic platform. The transformation procedures were validated using an orange fluorescent protein (OFP) reporter gene (pporRFP) under the control of the Cauliflower mosaic virus 35S promoter (35S). OFP expression in protoplasts was confirmed by epifluorescence microscopy. Analyses also included protoplast production efficiency methods using propidium iodide. Finally, low-cost food-grade enzymes were used for the protoplast isolation procedure, circumventing the need for lab-grade enzymes that are cost-prohibitive in high-throughput automated protoplast isolation and analysis. Based on the protocol developed in this work, the complete procedure from protoplast isolation to transformation can be conducted in under 4 hr, without any input from the operator. While the protocol developed in this work was validated with the BY-2 cell culture, the procedures and methods should be translatable to any plant suspension culture/protoplast system, which should enable acceleration of crop genomics research.

A high-throughput, automated, tobacco protoplast production and transformation methodology is described. The robotic system enables massively parallel gene expression and discovery in the model BY-2 system that should be translatable to non-model crops.

높은 처리량 원형질체 분리 및 변환을위한 로봇 플랫폼

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal ...

연구

유전학

2 in 1: One-step Affinity Purification for the Parallel Analysis of Protein-Protein and Protein-Metabolite Complexes

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of protein-protein interactions (PPI) is no novelty, experimental approaches aiming to characterize endogenous protein-metabolite interactions (PMI) constitute a rather recent development. Herein, we present a protocol that allows simultaneous characterization of the PPI and PMI of a protein of choice, referred to as bait. Our protocol was optimized for Arabidopsis cell cultures and combines affinity purification (AP) with mass spectrometry (MS)-based protein and metabolite detection. In short, transgenic Arabidopsis lines, expressing bait protein fused to an affinity tag, are first lysed to obtain a native cellular extract. Anti-tag antibodies are used to pull down protein and metabolite partners of the bait protein. The affinity-purified complexes are extracted using a one-step methyl tert-butyl ether (MTBE)/methanol/water method. Whilst metabolites separate into either the polar or the hydrophobic phase, proteins can be found in the pellet. Both metabolites and proteins are then analyzed by ultra-performance liquid chromatography-mass spectrometry (UPLC-MS or UPLC-MS/MS). Empty-vector (EV) control lines are used to exclude false positives. The major advantage of our protocol is that it enables identification of protein and metabolite partners of a target protein in parallel in near-physiological conditions (cellular lysate). The presented method is straightforward, fast, and can be easily adapted to biological systems other than plant cell cultures.

Protein-protein and protein-metabolite interactions are crucial for all cellular functions. Herein, we describe a protocol that allows parallel analysis of these interactions with a protein of choice. Our protocol was optimized for plant cell cultures and combines affinity purification with mass spectrometry-based protein and metabolite detection.

2 1: 원스텝 단백질 단백질과 단백질 대사 산물 단지의 병렬 분석에 대 한 친 화력 정화

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of ...

생화학

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

식물 Protoplasts의 형광 활성 세포 정렬

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

생물학

Translating Ribosome Affinity Purification (TRAP) to Investigate Arabidopsis thaliana Root Development at a Cell Type-Specific Scale

In this article, we give hands-on instructions to obtain translatome data from different Arabidopsis thaliana root cell types via the translating ribosome affinity purification (TRAP) method and consecutive optimized low-input library preparation.
As starting material, we employ plant lines that express GFP-tagged ribosomal protein RPL18 in a cell type-specific manner by use of adequate promoters. Prior to immunopurification and RNA extraction, the tissue is snap frozen, which preserves tissue integrity and simultaneously allows execution of time series studies with high temporal resolution. Notably, cell wall structures remain intact, which is a major drawback in alternative procedures such as fluorescence-activated cell sorting-based approaches that rely on tissue protoplasting to isolate distinct cell populations. Additionally, no tissue fixation is necessary as in laser capture microdissection-based techniques, which allows high-quality RNA to be obtained.
However, sampling from subpopulations of cells and only isolating polysome-associated RNA severely limits RNA yields. It is, therefore, necessary to apply sufficiently sensitive library preparation methods for successful data acquisition by RNA-seq.
TRAP offers an ideal tool for plant research as many developmental processes involve cell wall-related and mechanical signaling pathways. The use of promoters to target specific cell populations is bridging the gap between organ and single-cell level that in turn suffer from little resolution or very high costs. Here, we apply TRAP to study cell-cell communication in lateral root formation.

Translating Ribosome Affinity Purification TRAP to Investigate Arabidopsis thaliana Root Development at a Cell Type-Specific Scale

Translating ribosome affinity purification (TRAP) offers the possibility to dissect developmental programs with minimal processing of organs and tissues. The protocol yields high-quality RNA from cells targeted with a green fluorescent protein (GFP)-labeled ribosomal subunit. Downstream analysis tools, such as qRT-PCR or RNA-seq, reveal tissue and cell type-specific expression profiles.

세포 유형 별 척도에서 애기장대 뿌리 개발을 조사하기 위해 리보솜 친화성 정제 (TRAP) 번역

In this article, we give hands-on instructions to obtain translatome data from different Arabidopsis thaliana root cell types via the translating ribosome ...

발생학

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation (BiFC) System

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein (YFP) into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest. These constructs can then be co-transformed into Nicotiana benthamiana via Agrobacterium mediated transformation, allowing the transit expression of fusion proteins. The reconstitution of YFP signal only occurs when the inquest proteins interact 1-7. To test and validate the protein-protein interactions, BiFC can be used together with yeast two hybrid (Y2H) assay. This may detect indirect interactions which can be overlooked in the Y2H. Gateway technology is a universal platform that enables researchers to shuttle the gene of interest (GOI) into as many expression and functional analysis systems as possible8,9. Both the orientation and reading frame can be maintained without using restriction enzymes or ligation to make expression-ready clones. As a result, one can eliminate all the re-sequencing steps to ensure consistent results throughout the experiments. We have created a series of Gateway compatible BiFC and Y2H vectors which provide researchers with easy-to-use tools to perform both BiFC and Y2H assays10. Here, we demonstrate the ease of using our BiFC system to test protein-protein interactions in N. benthamiana plants.

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation BiFC System

We have developed a technique to test protein-protein interactions in plant. A yellow fluorescent protein (YFP) is split into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest via Gateway system, enabling expression of fusion proteins. Reconstitution of YFP signal only occurs when the inquest proteins interact.

게이트웨이 가능 Bimolecular의 형광 Complementation (BiFC) 시스템을 사용하여 공장에서 단백질 상호 작용의 검출

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein ...

TurboID-Based Proximity Labeling for In Planta Identification of Protein-Protein Interaction Networks

Proximity labeling (PL) techniques using engineered ascorbate peroxidase (APEX) or Escherichia coli biotin ligase BirA (known as BioID) have been successfully used for identification of protein-protein interactions (PPIs) in mammalian cells. However, requirements of toxic hydrogen peroxide (H2O2) in APEX-based PL, longer incubation time with biotin (16&#8211;24 h), and higher incubation temperature (37 &#176;C) in BioID-based PL severely limit their applications in plants. The recently described TurboID-based PL addresses many limitations of BioID and APEX. TurboID allows rapid proximity labeling of proteins in just 10&#8201;min under room temperature (RT) conditions. Although the utility of TurboID has been demonstrated in animal models, we recently showed that TurboID-based PL performs better in plants compared to BioID for labeling of proteins that are proximal to a protein of interest. Provided here is a step-by-step protocol for the identification of protein interaction partners using the N-terminal Toll/interleukin-1 receptor (TIR) domain of the nucleotide-binding leucine-rich repeat (NLR) protein family as a model. The method describes vector construction, agroinfiltration of protein expression constructs, biotin treatment, protein extraction and desalting, quantification, and enrichment of the biotinylated proteins by affinity purification. The protocol described here can be easily adapted to study other proteins of interest in Nicotiana and other plant species.

Described here is a proximity labeling method for identification of interaction partners of the TIR domain of the NLR immune receptor in Nicotiana benthamiana leaf tissue. Also provided is a detailed protocol for the identification of interactions between other proteins of interest using this technique in Nicotiana and other plant species.

단백질-단백질 상호 작용 네트워크의 질라 식별을 위한 터보ID 기반 근접 라벨링

Proximity labeling (PL) techniques using engineered ascorbate peroxidase (APEX) or Escherichia coli biotin ligase BirA (known as BioID) have been ...

면역학 및 감염병학

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

식물 단백질 복합체의 번역 후 변형의 확인

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Protein-protein Interactions Visualized by Bimolecular Fluorescence Complementation in Tobacco Protoplasts and Leaves

Many proteins interact transiently with other proteins or are integrated into multi-protein complexes to perform their biological function. Bimolecular fluorescence complementation (BiFC) is an in vivo method to monitor such interactions in plant cells. In the presented protocol the investigated candidate proteins are fused to complementary halves of fluorescent proteins and the respective constructs are introduced into plant cells via agrobacterium-mediated transformation. Subsequently, the proteins are transiently expressed in tobacco leaves and the restored fluorescent signals can be detected with a confocal laser scanning microscope in the intact cells. This allows not only visualization of the interaction itself, but also the subcellular localization of the protein complexes can be determined. For this purpose, marker genes containing a fluorescent tag can be coexpressed along with the BiFC constructs, thus visualizing cellular structures such as the endoplasmic reticulum, mitochondria, the Golgi apparatus or the plasma membrane. The fluorescent signal can be monitored either directly in epidermal leaf cells or in single protoplasts, which can be easily isolated from the transformed tobacco leaves. BiFC is ideally suited to study protein-protein interactions in their natural surroundings within the living cell. However, it has to be considered that the expression has to be driven by strong promoters and that the interaction partners are modified due to fusion of the relatively large fluorescence tags, which might interfere with the interaction mechanism. Nevertheless, BiFC is an excellent complementary approach to other commonly applied methods investigating protein-protein interactions, such as coimmunoprecipitation, in vitro pull-down assays or yeast-two-hybrid experiments.

Formation of protein complexes in vivo can be visualized by bimolecular fluorescence complementation. Interaction partners are fused to complementary parts of fluorescent tags and transiently expressed in tobacco leaves, resulting in a reconstituted fluorescent signal upon close proximity of the two proteins.

담배 원형질체 및 잎에 이분자 형광 보완에 의해 시각 단백질 - 단백질 상호 작용

Many proteins interact transiently with other proteins or are integrated into multi-protein complexes to perform their biological function. Bimolecular ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

애기 장대 단백질 DNA 상호 작용의 식별을위한 염색질 면역 침전 분석<em&gt; 생체</em

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

Protein-protein interactions are fundamental mechanisms for relaying signal transduction in most cellular processes; therefore, identification of novel protein-protein interaction pairs and monitoring protein interaction dynamics are of particular interest for revealing how plants respond to environmental factors and/or developmental signals. A plethora of approaches have been developed to examine protein-protein interactions, either in vitro or in vivo. Among them, the recently established luciferase complementation imaging (LCI) assay is the simplest and fastest method for demonstrating in vivo protein-protein interactions. In this assay, protein A or protein B is fused with the amino-terminal or carboxyl-terminal half of luciferase, respectively. When protein A interacts with protein B, the two halves of luciferase will be reconstituted to form a functional and active luciferase enzyme. Luciferase activity can be recorded with a luminometer or CCD-camera. Compared with other approaches, the LCI assay shows protein-protein interactions both qualitatively and quantitatively. Agrobacterium infiltration in Nicotiana benthamiana leaves is a widely used system for transient protein expression. With the combination of LCI and transient expression, these approaches show that the physical interaction between COP1 and SPA1 was gradually reduced after jasmonate treatment.

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

This manuscript describes an easy and rapid experimental procedure for determining protein-protein interactions based on the measurement of luciferase activity.

Luciferase 보완성 이미징 분석 결과 Nicotiana benthamiana 잎 뚜렷이 결정 단백질 단백질 상호 작용 역동성에 대 한

Protein-protein interactions are fundamental mechanisms for relaying signal transduction in most cellular processes; therefore, identification of novel ...