המחברים רוצים להודות Kami האריס לעיצוב פריימר, אשלי McKibbon, ג'סיקה תומאס-Ebbett עבור הצילומים, ג'ון בלייקלי, אלכסנדרה פולי-Eby, כריס לאנגלי, ג'ולי לואיס, קלסי מקנטייר, אשלי McKibbon, כריס אלוהים ואני רוזי את הכלב על הופעה וידאו. א צברי נתמכה על ידי קרן המחקר הקנדי של מחלת ליים, מימון הפרויקט נמסר על-ידי מדעי הטבע, הנדסה מחקר המועצה של קנדה (NSERC). M. K. B. W קיבל משכורת המימון של קרן חדשנות ניו ברנזוויק (NBIF).

1. DNA בידוד מפני קרציות
<ol><li>רוכשים קרציות דרך שדה אוסף או מעקב סביל וטרינרים, הציבור. קרציות צריכים להיות נהרג על ידי הקפאת, להציב בשקית אטומה, שלח בטמפרטורת החדר.<ol>
<li>באמצעות טופס ההגשה, לאסוף מידע על תאריך, מיקום גיאוגרפי של המפגש, מצב קובץ מצורף שנתות, המארח מינים, נסיעות להיסטוריה של המחשב המארח.</li>
		<li>מאז ה-PCR מקונן הוא מטבעו פגיעים לזיהום, ודא כי סביבת העבודה מעבדה מוגדרת כדי למזער את הצלב-חשיפה של דגימות. פעולה זו כוללת ביצוע אלמנטים שונים של הפרוטוקול בקובץ נפרד חללים טוב מבודדים אחד מהשני הם מנקים ביסודיות את מחוטא, ולהבטיח כי כל כלים חופשיים של מזהמים.</li>
		<li>עם קבלת הדגימה, לצלם את תקתוק ולקבוע מינים, שלב התפתחותי, מין ומצב engorgement על ידי השוואה זיהוי מפתח32 .</li>
		<li>בתנאים aseptic, קטיעות השניה באמצעות גילוח סטרילי או אזמל, למקם את השברים שנתות שני צינורות microcentrifuge נפרדים.</li>
	</ol>
</li>
	<li>כדי לחלץ סך ה-DNA, להשתמש בכל הליך בידוד המניבה PCR תואמי תבנית; פרוטוקול זה מדגים גישה מבוססת קלאציה פשוטה.<ol>
<li>התחל על-ידי הוספת אמצעי אחסון המתאים (לעיתים קרובות בין 50-200 µL) של ריאגנט קלאציה lytic למקטע שנתות. הסכום הספציפי תלוי הדגימה הגודל engorgement ומצב; הנחיות צריך להינתן על ידי היצרן. Homogenize באמצעות כבעלי microtube.</li>
		<li>דגירה בדגימות באמבט מים ב 60 מעלות צלזיוס במשך 45 דקות, ו מערבולת בקצרה.</li>
		<li>צנטריפוגה דגימות במשך 4 דקות ב x 16,276 g (ומכרה כ-13,300 סל ד) ב- microcentrifuge שולחן העבודה.</li>
		<li>העברה תגובת שיקוע microtube טריים, שכותרתו המכיל 50 אלכוהול איזופרופיל µL, שילוב על-ידי היפוך ולאחר centrifuge מחדש כמו (1.2.3).</li>
		<li>Decant את תגובת שיקוע, ולשטוף את צניפה DNA עם 50 µL של 70% אתנול.</li>
		<li>להסיר את עודף אתנול עם פיפטה, ולאפשר בגדר מילה נהדרת. למשך 15 דקות בטמפרטורת החדר.</li>
		<li>Resuspend DNA, להוסיף 50 µL של 1 מ מ טריס pH 7.0 של דגירה בדגימות באמבט מים עבור h 1-60 ° C. עכשיו ניתן לאחסן את ה-DNA ב-20 ° C לבדיקה מולקולרית בעתיד.</li>
	</ol>
</li>
</ol>2. PCR לזיהוי של Borrelia OspA , FlaBמקונן.
הערה: סקירה כללית של כללי PCR עקרונות ושיטות מסופק על ידי לורנץ, 201233.
<ol><li>לסנתז או להשיג Borrelia גנים ספציפיים החיצוני והפנימי לנוקלאוטידים. ראה טבלה 1 פריימר ערכות שלהם גדלים אמפליקון בהתאמה, טמפרטורות ההיתוך.</li>
</ol><table border="1"><tbody>
<tr>
<td>פריימר שם</td>
			<td>ג'ין היעד</td>
			<td colspan="2">רצף (5' - 3')</td>
			<td>גודל אמפליקון</td>
			<td>חישול טמפרטורה</td>
		</tr>
<tr>
<td>FlaB החוצה Fw</td>
			<td>FlaB</td>
			<td colspan="2">gcatcactttcagggtctca</td>
			<td rowspan="2">503 bp</td>
			<td rowspan="2">55° C</td>
		</tr>
<tr>
<td>FlaB החוצה Rv</td>
			<td>FlaB</td>
			<td colspan="2">tggggaacttgattagcctg</td>
		</tr>
<tr>
<td>FlaB ב- Fw</td>
			<td>FlaB</td>
			<td colspan="2">ctttaagagttcatgttggag</td>
			<td rowspan="2">447 bp</td>
			<td rowspan="2">58° C</td>
		</tr>
<tr>
<td>FlaB ב Rv</td>
			<td>FlaB</td>
			<td colspan="2">tcattgccattgcagattgt</td>
		</tr>
<tr>
<td>OspA אאוט Fw</td>
			<td>OspA</td>
			<td colspan="2">cttgaagttttcaaagaagat</td>
			<td rowspan="2">487 bp</td>
			<td rowspan="2">55° C</td>
		</tr>
<tr>
<td>Rv OspA החוצה</td>
			<td>OspA</td>
			<td colspan="2">caactgctgacccctctaat</td>
		</tr>
<tr>
<td>OspA ב Fw</td>
			<td>OspA</td>
			<td colspan="2">acaagagcagacggaaccag</td>
			<td rowspan="2">350 bp</td>
			<td rowspan="2">58° C</td>
		</tr>
<tr>
<td>OspA ב Rv</td>
			<td>OspA</td>
			<td colspan="2">ttggtgccatttgagtcgta</td>
		</tr>
</tbody></table>טבלה 1: הפנימיים והחיצוניים צבעי יסוד nPCR של Borrelia burgdorferiFlaB, OspA. בפועל, לזהות תחל FlaB burgdorferi בי אס מקרוב נלווים אחרים Borrelia genospecies, בעוד OspA תחל ללכוד רק burgdorferi נולד ב- אס הגברה של שני לוקוסים יצביע B. burgdorferi. אס
<ol start="2"><li>מראש לעקר את ארון PCR עם UV אור ו- 70% אתנול. הערה: כדי לצמצם אפשרות של זיהום הדגימה, סביבת עבודה זו צריכה להיות ברורים מהמיקום של שנתות לנתיחה, הפקת דנ א, והוא ג'ל אלקטרופורזה.<ol>
<li>לריצה PCR הראשונית, להשתמש את תחל החיצוני בשילוב עם תבנית ה-DNA התאושש בשלב 1.0 לעיל, ולהגדיר את תערובת התגובה כמפורט בטבלה מס ' 2. במקביל, לבצע חיובי הבקרה פועל המורכב מאומת Borrelia DNA, ופועל שליטה שלילי כולל תגובות לא-תבנית כדי לזהות זיהום ריאגנט, תרסיס. להוסיף את הדנ א בסוף כדי לצמצם אפשרות של ריאגנטים זיהום. ודא שכל שפופרת סגורה בכלל פעמים כאשר ריאגנטים אינן מתווספות וסגור צינורות מיד לאחר תוספת ה-DNA, ולפני צינורות אחרים נפתחים.</li>
		<li>תוכנית הצנטרפוגה תרמי כדלקמן: 95 מעלות צלזיוס למשך 5 דקות; 40 מחזורי 95 ° C 15 s, חישול טמפרטורה ל 30 s, 72 מעלות צלזיוס במשך 45 s; 72 מעלות צלזיוס למשך 5 דקות; ולהחזיק ב 4 º C.</li>
	</ol>
</li>
	<li>ביצוע השלב השני של ה-PCR הדומה התגובה הראשונה, אלא להשתמש תחל פנימי עם 2 µL של המוצר הראשון PCR (מיוצר 2.2.2). הערה: התגובה כרכים ניתנים שוב בטבלה 2. יש לנקוט כדי למנוע זיהום של amplicons על-ידי תבנית ה-DNA מתווסף אחרונה מבטיחות כי צינורות היחיד המתאים דוגמא אחת פתוחות בו-זמנית. 
	 
	<table border="1"><tbody>
<tr>
<td>רכיב</td>
				<td>PCR # 1 כרכים</td>
				<td>PCR # 2 כרכים</td>
			</tr>
<tr>
<td>Taq מיקס מאסטר פולימראז 2 X</td>
				<td>12.5 ΜL</td>
				<td>12.5 ΜL</td>
			</tr>
<tr>
<td>נוקלאז ללא מים</td>
				<td>8.5 ΜL</td>
				<td>8.5 ΜL</td>
			</tr>
<tr>
<td>10 מיקרומטר תחל לפנים ולא לאחור</td>
				<td>תחל החיצוני 1.0 µL</td>
				<td>1.0 µL תחל פנימי</td>
			</tr>
<tr>
<td>תבנית ה-DNA</td>
				<td>µL 2.0, בין מדגם החילוץ (1.2.7)</td>
				<td>µL 2.0, סיבוב 1 של ה-PCR (2.2.2)</td>
			</tr>
</tbody></table>
טבלה 2: ה-PCR התגובה תערובות amplifications הראשון והשני. 
	 
	<ol>
<li>תוכנית הצנטרפוגה תרמי כמו קודם, אבל להתאים את טמפרטורת מחזק כדי להתאים את צבעי יסוד הפנימי (ראה טבלה 1).</li>
	</ol>
</li>
</ol>3. Agarose בג'ל והדמיה
הערה: לקבלת הוראות בסיסיות המפריד בין ה-DNA על ידי אלקטרופורזה, ראה לי et al., 201234.
<ol><li>הכנת ג'ל 1.2% agarose באמצעות מאגר X SB 20 (0.2 מ' NaOH, pH פנמיות 0.8 מ' 8), מדולל 1 X, ולהוסיף כ 5 µL של כתם דנ א, לפני לשפוך, אם מראש מכתים של הג'ל רצוי.</li>
	<li>לטעון 10 µL של המוצר מן התגובה השנייה PCR (הפנימי) של כל ניסיוני, ולטעום שליטה, לצד סולם bp 100 (5 µL).<ol>
<li>Electrophorese עבור 1 h 107 V (5V/ס מ).</li>
	</ol>
</li>
	<li>להציג ולתעד את הג'ל באמצעות transilluminator ו המשויכים מצלמה ותוכנות.</li>
</ol>

המחברים אין לחשוף.

במשך עשרות שנים של שימוש, טכניקות מבוססות PCR בעקביות הוכיחו את ערכם זיהוי Borrelia של דגימות arthropod, יונקים, אם Borrelia לבוא ממקורות סביבתיים או קליניים. PCR מציע שיפורים רבים קיימות גישות מעקב. ראוי לציין, שזה לא מסתמך על פיתוח, הביצועים של נוגדן ריאגנטים, במקום זאת ניתן להתאים בקלות לזהות מטרות חדשות עניין פשוט על ידי שינוי רצף פריימר. PCR להכיל גם הערכת לוקוסים מרובות במקביל, או באופן עצמאי או באמצעות תגובת מולטיפלקס. ניתן להחיל אותה על תשומות הדגימה מגוונים, כולל קרציות בארכיון ורענן22, חיה או בנוזלי הגוף האנושי של רקמת resected25. PCR גם התשואות amplicons זה יכול להיות מעובד יותר, לדוגמה על-ידי אנזים הגבלה עיכול, בדיקה הכלאה או רצף, כדי לספק תובנות זהות מיקרוביאלי21מוגברת.
ככלי קליני, PCR עדיפה מבחינה מושגית על האבחון סרולוגית רגיל, כפי שהיא מספקת מהווה אינדיקציה ישירה של נוכחות חיידקית, במקום להסתמך על התגובה החיסונית מארח כאמצעי משני לזיהום. לעומת זאת, ליים borreliosis מזוהה עם עומס מיקרוביאלי צנוע יחסית (< אורגניזמים 50/mL של שתן או פלזמה) ותוצאות spirochetemia ארעי, אשר יכולים להצמיח שלילית25. הרגישות של טכניקה זו במרפאה משתנה במידה ניכרת בהתאם לסוג הרקמה, שלב של זיהום, ובכל תנאי לדוגמה, נופל בין 12.5% ל- 62% במחקרים קיימים של דם, נוזל מוחי שדרתי הרקמה ביופסיה36. רגישות מולקולרית מגבלות אינם מעניינו של אם PCR נעשית לאחר התרבות חיידקי, אולם התאוששות של קיימא והחיידקים דגימות קליני הוכיח באופן דומה מאתגר. רק לאחרונה יש פרוטוקולים כבר אופטימיזציה עבור תשואה גבוהה יותר35. בינתיים, הכרס קרצייה נגועה למבוגרים יכול הנמל בממוצע בכל מקום מ- 2,000 ל מעל 50,000 Borrelia37,38,39, אשר באופן יציב בטווח זיהוי של nPCR. לפיכך, הפרוטוקול הוא גם מתאים למאמצים מעקב שנתות.
למרות יתרונותיה הרבים, nPCR מציבים אתגרים מסוימים, והיכולת של טכניקה זו לדווח במדויק שנתות זיהום ולכן תלויה הבחירה האסטרטגית של הגנים ושל amplicons, מוקפד זרימות עבודה ניסויית לשחזר איכות דנ א מ דגימות תוך מזעור קרוס-חשיפה של דגימות, ושימוש של הפקדים המתאימים ידווח מזהמים סביבת מעבדה, ריאגנטים. לפני כל ניסוי, והיקפה, הכוונות של החקירה צריכה כל כך ברור כך אתרים המקודדים גנטי המתאים ואזורים, ניתן לבחור אם המטרה היא לספק ומציג מסך לא משוחדת ס גורמי ליים Borrelia burgdorferi מורכבים, תחל ליצור כדי לזהות את כל של זנים הקשורים עם זיקה דומה, הגברה יעילות, ללא לכידת בלא אורגניזמים25. יכול להיות מעוצב חדשה תחל ועל המוערך סיליקו באמצעות כלי תוכנה כמו פריימר-הפיצוץ40, למרות שהם גם לאמת השפעול נגד הפניה רגיל מבודד לפני שחל דגימות uncharacterized. המטרה של ההליך מיצוי הדנ א היא להתאושש תבנית חיידקים שלמים מדגם הסביבה מעורב (שנתות homogenate). שלב אופציונלי לפני שתמשיך עם ה-PCR היא להעריך את תקינות ה-DNA שחולץ. בנוסף, ריאקציות מקבילות יכול להגדיר את היעד גנים משק הבית ב תקתוק. השיטה השנייה יכול גם להצביע על קיומו של מעכבי בתערובת התגובה, מתן ביטחון מוגבר כי Borrelia תגובות שליליות הן בשל העדר של האורגניזם, ולא על נוכחות מזהם מעכבות.
רגישות מוגברת של הגישה PCR מקוננים בא על חשבון זיהום פוטנציאליים שיוצר תוצאות חיוביות שגויות. יכול להיות מוצג תבנית אקסוגני מדגם במהלך שנתות ניתוח ושחזור DNA, או בתהליך של הגדרת את התגובות הגברה חיצוניות ופנימיות. לכן חשוב במיוחד לעקוב אחר פרוטוקולים האימון הטוב ביותר עבור PCR להימנע תבנית או אמפליקון זיהום צולב. אלה כוללים את השימוש תחנות עבודה נפרד עם ליאורה פרידמן עצמאית, בלימה ב- PCR וארונות בטיחות ביולוגית, ובמידת יסודית כימית פיזית ומנקה עיקור של משטחים, ריאגנטים, וטיפול זהיר של דנ א 41. הפקדים מתבנית לא חיוניים גם בזיהוי של ריאגנטים מניות זיהום. פגיעות מסוג מסוים של nPCR הוא אמפליקון טיפול זה מתרחשת בעת העברת המוצרים של התגובה הראשונה לתוך כלי ה-PCR שני. מאז המטרה DNA כבר עברה העשרה מעריכי הדגימות החיוביות, השלב זה נוטה במיוחד כדי זיהום צולב, נוהל בודדת-הצינור nPCR פותחה כדי לעקוף מגבלה זו. בגישה זו, שתי קבוצות של צבעי יסוד גן נתון יתווספו יחד צינור התגובה נשאר אטום עבור שני סיבובים של PCR31. זוגות תחל החיצוני והפנימי חייב להיות ברור למה, כזה כי הזוג החיצוני מגביר את תבנית בטמפרטורה מחזק גבוהה זה אוסרני עבור תחל הפנימית. בסיבוב השני, הטמפרטורה מחזק הוא הוריד כדי להכיל את זוג פנימי. לא רק האם זה לעקוף את צעד שעשוי להיות מבלבלים, הוא גם מאפשר שימוש נוסף נגד זיהום מודד31,42. עם זאת, שינוי זה עשוי להקריב רגישות וזמינותו. ללא קשר הגישה, הגדלת מספר משכפל הטכנית לבצע באופן עצמאי על מדגם תסייע לזהות זיהום כדין.
טכניקות מולקולריות המשיכו להתפתח מאז כניסתה של nPCR, גישות חדשות אלה מציעים יתרונות בחר העיצובים המקוריים, אמנם על הגדילה בהוצאה כספית. כפי שהשם מרמז, ה-PCR כמותי (qPCR או אמת זמן (RT)-PCR) מאפשר הספירה של פתוגנים במדגם, ואילו טכניקות שגרתיות איכותי בטבע43. הרגישות של qPCR אמנם הדיווחים דומה לזה של nPCR38, זה יכול להשתנות בהתאם פריימר מאפיינים28. וריאציה של qPCR המשתמשת משואות מולקולרית (MB) במקום קונבנציונאלי הגששים TaqMan הראו גם מבטיחה זיהוי Borrelia ב דגימות קליניות-44,-45,-46. בשל מבנה שניוני הייחודי שלהם, משואות מולקולרית לייצר הדיווחים התחתון רקע זריחה, אותות לגיטימי גבוה יותר, ובכך מספק רגישות מעולה47. הערכות קליניים מראים את הסף זיהוי פוטנציאל של בין עשרה ואחד והחיידקים44,45. יתר על כן, הטכניקה יושם בהצלחה בתגובות מולטיפלקס בו-זמנית לזהות גנים המארח בתרבית של44 ו אחרים שנוטלים פתוגנים45, אשר אינו בר השגה בחפץ-לב עם nPCR. שינויים עיצוב אחרים כוללים טכנולוגיה PCR (ddPCR) דיגיטלי רביב, אשר יכולים לכמת DNA ללא שימוש עיקול רגיל39,48. הגבול התחתון זיהוי של טכניקה זו עבור Borrelia הוא גם שמרכז/לדוגמה בערך עשרה39. בהשוואה nPCR, גישות אלה יש גם את היתרון של צמצום פוטנציאל זיהום, כפי שהם דורשים רק נוהל בודדת הגברה.
אם מטרת המעקב במקום לעשות פרופיל תכולת חיידקי מגוונת קרצייה, מטוסי אף-16 rRNA metagenomic ההקרנה היא אפשרות אטרקטיבית49. אף על פי גישה זו היא costlier, דורש מיוחדים סקוונסרים דנ א לא נמצאו כל מעבדות ביולוגיה מולקולרית, מחייבת פרשנות המבוססת על ביואינפורמטיקה מתוחכמים יותר, הוא יכול ללכוד קשת רחבה של חיידקים יותר במדויק מייצגים את העומס הפתוגן של וקטור.
בעוד qPCR ונגזרותיו הן שיטות של בחירה עבור יישומים כמותית, metagenomics מספקים מלאי רחב של microbiome שנתות, מאמצי המעקב יישוב מודאגים לעתים קרובות עם דיווח בינארי של נוכחות או היעדרות של פתוגנים אחד או כמה בוקטור. בנסיבות כאלה, גישות אלה חדשה יותר, משוכלל יותר עשויים להציג המורכבות מיותר ואת הנטל הכלכלי לתוך התהליך. מסיבות אלו, nPCR יש מהתעמולה במבחן הזמן כמו טכניקה מרכזית ב שנתות בדיקות.

מחלת ליים (LD) הוא הזיהום בעקיצות וקטורי הנפוץ ביותר בחצי הכדור הצפוני, שכיחותה ממשיך לגדול1. מחלה מתישה זו נגרמת על ידי פתוגנים spirocheteal של ליים borreliosis (LB) מורכבים (בדרך כלל מכונה לאטו. שאתה Borrelia burgdorferi , או ס), אשר מבחינה היסטורית כוללת את הפתוגן בצפון אמריקה הדומיננטית, B. burgdorferi . שאתה stricto (אס), בנוסף afzelii ב' garinii ב', אשר נפוץ ברחבי אירופה ואסיה, ויש מינים של המתעוררים הרלוונטיות הקלינית2,3. חיידקים אלה מועברים לבני אדם באמצעות הנשיכה של נגוע Ixodes קרציות2. למרות הווקטורים בצפון אמריקה המרכזית scapularis ט וט pacificus, מרובות בתוך הסוג התגלו הנמל ולהעביר את החיידק4. בבני אדם, נולד ב- burgdorferi יכול לגרום לסימפטומים מכשל המשפיעים על העור המפרקים, הלב, מערכת העצבים, בלוטות אנדוקריניות, מערכת העיכול, האיברים הפנימיים5,6,7, 8,9,10. המרכז לבקרת מחלות ומניעתן הערכות כיום מעל 300,000 מקרים אנושיים חדשים מדי שנה בארצות הברית11,12. בזמן האבחנה היא חיובית לעיתים קרובות כאשר המחלה מאובחנים ומטופלים בשלבים המוקדמים, מחקרים הראו כי בכל מקום בין 10% ו- 60% מהחולים אשר קיבלו את משטר אנטיביוטי המומלצת המשיך לחוות סימפטומים לאחר טיפול הפסקת, בתופעה כינה תסמונת מחלת ליים טיפול פוסט (PTLDS)13,14,15. יתר על כן, עיכובים בהתערבות קלינית יכול להיווצר עקב חוסר המודעות של קרצייה, שאינם ספציפיים במצגת של המחלה הראשונית, ואת הרגישות הנמוכה של מסורתי באבחון מבוסס סרולוגיה בעת שימוש עם תחילת הזיהום. כשל לטפל במהירות והולם מאפשר התקדמות סימפטום זה יכול להתבטא יותר ויותר מתישה סיבוכים16,17. מניעת מחלת ליים לכן אבן יסוד של ניהול סיכונים. אסטרטגיות כדי להתמודד עם האיום הגוברת כוללת מעקב חזקים אמצעים כדי לציין את השכיחות הפתוגן קרציות וזהה אזורים גיאוגרפיים של דאגה.
מאמר זה מדגים את התועלת של תגובת שרשרת של פולימראז מקוננים (nPCR) ככלי מיון המולקולרי שבאמצעותו לזהות קרציות נגועים. כדי להגדיל ירידה לפרטים, שני גנים Borrelia משמשים עבור הגברה מקבילים. Flagellin B (FlaB) מקודד חלבון פילמנט הגדולות שוטון18, הגן ממוקם בכרומוזום ליניארי יחיד, בעוד שהמוצר ליפופרוטאין החיצון משטח חלבון א' (OspA) שמתווכת קרציות-פיתול קולוניזציה, הוא פלסמיד מקודד19,20. זרימת העבודה מורכב אוסף שנתות, הפקת דנ א, ולאחר מכן התחלתית של ה-PCR לזיהוי Borrelia-לוקוסים ספציפיים. PCR עוקבות משתמש המוצר של התגובה הראשונה תבנית חדשה להפקת רסיסים קטנים, פנימי הגברה. קרציה נחשב חיובי עבור Borrelia burgdorferi כאשר ניתן להבחין amplicons הפנימי של שני הגנים Borrelia agarose בג'ל.
הטכניקה nPCR, ולא של FlaB וגם מטרות הגן OspA , היה בשימוש נרחב עבור מעקב אקולוגית וזיהוי קליני של החיידק ליים מאז תחילת שנות ה-9021,22,23 ,24,25. לפני הפיתוח של פרוטוקולים מולקולרית, קרציות היו העריכו במינים תוכן הבטן אנטי -Borrelia immunofluorescence (אם) מכתים, התרבות חיידקים או שילוב הימנו26. גישות אלה סובלים מגבלות הטבועות, כולל את הצמיחה האיטית והטבע בררן27 Borrelia, בעיות ביצועים נוגדן ואת הדרישה של קרציות בשידור חי אם עיבוד21. PCR לאחר מכן אומץ כדי לספק זיהוי מהיר, רגיש, וספציפי של וקטורים נגועים. הוא הציע שיפורים מסומן על המתודולוגיה מסורתיים, כולל יישום ישיר תלויית תרבות לסוגי הדגימה מגוונים, כמו קרציות בארכיון ומתה שאחרת היה מתאים לבדיקה21,22 . עיצובים מוטוריים מקוננות נוספות להשתפר ירידה לפרטים, ורגישות של ה-PCR קלאסית על ידי העסקת שתי מערכות נפרדות של גנים ספציפיים תחל בשני סבבים רצופים של הגברה25,28.
ניסיוני ההצלחה תלויה באופן ביקורתי בחירה אסטרטגית גנים ועיצוב אמפליקון. כדי לאמוד במדויק את הנוכחות של Borrelia burgdorferi, תחל אמור לזהות פתוגנים הרלוונטי ללא cross-reacting עם חום relapsing והחיידקים גם של הסוג Borrelia . במקרה של FlaB, סגוליות זה מושגת על ידי מיקוד משתנה אזור פנימי של הגן, יותר מאשר את רצפי איגוף יחסית שנשמרת שמשותפות מגוונות חיידקים (איור 1)24,29 , 30.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56471/56471fig1.jpg"> איור 1: הרעיון של nPCR, כמופיע באמצעות Borrelia FlaB ג'ין כמטרה. טרמיני 5' ו 3' של הגן נפוצים לאורגניזמים מעבר ס Borrelia burgdorferi , טיוח אזורים אלה מתאימים להערכה ספציפית של פתוגנים הגורמים ליים. באמצעות הרצף פנים והתפאורה פחות כמטרות פריימר, שני סיבובים של PCR מתבצעות כדי לזהות אמפליקון גמר, פנימי. <a href="//cloudflare.jove.com/files/ftp_upload/56471/56471fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
בבדיקה של קיבולת המפלה שלהם, תחל FlaB הפנים היו קיצוניות מעל 80 מבודד Borrelia שונים, וניתן למצוא כדי לזהות רק אלה הקשורים במחלת ליים24. הגבול התחתון של זיהוי של nPCR תועד ב בין שישה24 וחיידקים31 עשר מתרבות טהור, למרות הרגישות ניתן לשפר עוד יותר על ידי הדרומי סופג את אמפליקון, hybridizing radiolabelled או בדיקה chemiluminescent. צימוד הטכניקות מפחית את סף גילוי שמחולל יחיד31. על ידי השוואה ישירה, PCR יחיד-עגולים המקובלת, unprobed נמצאה לדווח הנוכחות של מינימום של4 10 והחיידקים31. יצוין, עם זאת, כי רגישות assay יהיה נמוך יותר בעת עבודה עם דגימות קליניות וסביבתיות מורכבים, בשל נוכחותם המכריע של DNA שאינם קשורים וחומרים מעכבות פוטנציאליים. האתגרים הללו יכולים שיפרו במידה רבה על ידי שימוש nPCR.
למרות ההתקדמות הטכנולוגיות מולקולרית בעשורים האחרונים, nPCR נשאר טכניקה סיכות מאמצי המעקב המודרנית. אם הטיפול נלקח עיצוב, ביצוע של פרוטוקול זה, זה בגישה רב-עוצמה, יכולת הסתגלות, פשוטה יחסית כדי ללכוד את הנוכחות של פתוגנים בוקטורים שנתות.

<table border="0" cellpadding="0" cellspacing="0" width="830">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">LabGard Class II, Type A2 biological safety cabinet</td>
			<td style="width:192px;">Nuaire</td>
			<td style="width:140px;">ES AIR NU-543&#160;</td>
			<td style="width:199px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Razor blades</td>
			<td style="width:192px;">VWR</td>
			<td style="width:140px;">55411-050</td>
			<td>0.22 mm thickness</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Microfuge Tubes (Microtubes 1.5 mL)</td>
			<td style="width:192px;">Axygen</td>
			<td style="width:140px;">311-08-051</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">AquaGenomic&#160;</td>
			<td style="width:192px;">MultiTarget Pharmaceuticals</td>
			<td style="width:140px;">2030</td>
			<td>DNA extraction reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Microtube Pestle</td>
			<td style="width:192px;">Diamed</td>
			<td style="width:140px;">DIATEC610-1551</td>
			<td>Designed for 1.5 ml tubes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Water bath - Isotemp 202</td>
			<td style="width:192px;">Fishse Scientific</td>
			<td style="width:140px;">15-462-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Vortex</td>
			<td style="width:192px;">Labnet</td>
			<td style="width:140px;">S0100 CAN</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Spectrafuge 24D Digital Microcentrifuge</td>
			<td style="width:192px;">Labnet</td>
			<td style="width:140px;">C2400</td>
			<td style="width:199px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Isopropanol</td>
			<td style="width:192px;">Sigma-Aldrich</td>
			<td style="width:140px;">190764</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">BIS-TRIS</td>
			<td style="width:192px;">Sigma-Aldrich</td>
			<td style="width:140px;">B9754</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Primer Synthesis</td>
			<td style="width:192px;">Sigma-Aldrich</td>
			<td style="width:140px;">OLIGO</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">PCR Cabinet</td>
			<td style="width:192px;">Misonix</td>
			<td style="width:140px;">PCR6-482</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">PCR tube with attached flat caps 0.2mL</td>
			<td style="width:192px;">VWR</td>
			<td style="width:140px;">20170-012</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">GoTaq Green Master Mix 2x</td>
			<td style="width:192px;">Promega</td>
			<td style="width:140px;">M7123</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Nuclease-free water</td>
			<td style="width:192px;">Promega</td>
			<td style="width:140px;">M7123</td>
			<td>The water comes with the GTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Spectrafuge Mini</td>
			<td style="width:192px;">Labnet</td>
			<td style="width:140px;">C1301</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">SYBR Safe DNA Stain 10,000X Concentration</td>
			<td style="width:192px;">EDVOTEK</td>
			<td style="width:140px;">608</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">Froggarose LE (Molecular Biology Grade Agarose)</td>
			<td style="width:192px;">FroggaBio</td>
			<td style="width:140px;">A87-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">GD 100 bp DNA Ladder</td>
			<td style="width:192px;">FroggaBio</td>
			<td style="width:140px;">DM001-R500&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Electrophoresis power pack&#160;</td>
			<td style="width:192px;">VWR</td>
			<td style="width:140px;">VWR 105</td>
			<td>EC Apparatus Corporation</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">Fluor-S MultiImager&#160;</td>
			<td style="width:192px;">BioRad</td>
			<td style="width:140px;">170-7700 (Serial number 433B0154)</td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:299px;">Quantity One 1-D Analysis Software (V. 4.5.2)</td>
			<td style="width:192px;">BioRad</td>
			<td style="width:140px;">1709600</td>
			<td></td>
		</tr>
	</tbody>
</table>

detecting the lyme disease spirochete, borrelia burgdorferi, in ticks using nested pcr

מחלת ליים היא זיהום רציני בעקיצות וקטור הנגרם על ידי משפחת לאטו Borrelia burgdorferi כמו. שאתה והחיידקים, אשר מועברים לבני אדם באמצעות הנשיכה של קרציות Ixodes נגוע. הסוכן etiological ראשי בצפון אמריקה הוא stricto. שאתה Borrelia burgdorferi . אזורי הסיכון הגיאוגרפי הרחב, זה שקול לשם תמיכה בתוכניות מעקב חזקים יכולים למדוד שנתות זיהום המחירים, ולא לדווח ממצאים רופאים, וטרינרים, והציבור הרחב. הטכניקה מולקולרית של תגובת שרשרת של פולימראז מקוננים (nPCR) שימש זמן למטרה זו, והוא נותר בגישה המרכזי, זול וחזק זיהוי Borrelia קרציות והן חיות הבר.
מאמר זה מדגים את היישום של nPCR לסמן את תמציות דנ א כדי לזהות דגימות נגועים. שני עצמאית burgdorferi נולד ב- מטרות, גנים קידוד Flagellin B (FlaB) החיצון משטח חלבון א' (OspA), נעשה שימוש נרחב בטכניקה זו. הפרוטוקול כרוך אוסף שנתות, הפקת דנ א, ולאחר מכן התחלתית של ה-PCR לזהות כל אחד שני Borrelia-לוקוסים ספציפיים. תגובת שרשרת של פולימראז עוקבות (PCR) משתמש המוצר של התגובה הראשונה תבנית חדשה להפקת רסיסים קטנים, פנימי הגברה. הגישה מקוננים משפר על ירידה לפרטים והן רגישות של ה-PCR קונבנציונלי. קרציה נחשב חיובי עבור המחלה כאשר ניתן להבחין amplicons הפנימי של שני הגנים Borrelia agarose בג'ל.

nPCR היא גישה אלגנטית כדי להגביר את ירידה לפרטים ואת הרגישות של זיהוי הפתוגן, במיוחד כאשר הם דוגמאות סביבתיים מורכבים תחת חקירה. כמתואר באיור1, שני סיבובים של PCR פילוח אזור אסטרטגי של לוקוס Borrelia FlaB (וגם OspA, לא בתמונה) יכול לדווח על נוכחותם של חיידקים Borrelia burgdorferi באמצעות הדור של הפנימית קצר amplicons. כאשר נפתרה על ידי אלקטרופורזה בג'ל, המוצרים FlaB התגובה OspA מן כל שנתות יכול להיות חזותי הבקיע והשוו פקדים. איור 2, מזהים ייחודיים הדגימה מסופקים לאורך החלק העליון של כל ג'ל, ויש לא-תבנית בקרות תרסיס מיוצגים בצד השמאלי המרוחק וימינה, בהתאמה, סמוך הסולמות.
להקות אמפליקון חזקים הם נראים בבירור בדגימות נסיוני בחירה, והם בקלות להבחין בין תחל עודפים, שרידי דנ א (איור 2). בהתבסס על עקרונות עיצוב ניסיוני שנקבעו, קרצייה נחשב חיובי עבור Borrelia כאשר במקביל פקדים שלילי להפגין אין הגברה, amplicons הפנימית מיוצרים מ תחל גם FlaB וגם OspA . במקרה זה, דגימות T907, T604 ו- T606 פגש מעקב לקריטריונים המחלה ליים (איור 2). . By contrast, T923 היה רק חיובי עבור OspA, תוצאה אשר ישנם מספר הסברים אפשריים: א) תקתוק ממוצא יצא שלילי Borrelia, אך ההכנה OspA PCR החיצוני או הפנימי spuriously היה נגוע תבנית ה-DNA (שים לב זיהום מערכתי של ריאגנטים היה לשלול באמצעות פקדי שלילי), B) תקתוק נשא ליים Borrelia, אבל כמויות נמוכות תבנית או שגיאה ניסיוני מנעה הגברה של FlaBאו C) אורגניזם היה נוכח זה הכיל את רצף OspA שנשמרת, אבל חסרה Flagellin או היה אין די זהות באזור ממוקד FlaB כדי anneal כדי תחל. ואכן, כבר ציינו דמיון רצף OspA במגוון רחב של אורגניזמים, כולל צמחים ובעלי חיים28. המצב הנגד, הגברה של יותר והתפאורה ג'ין Flagellin , אבל לא את הגן OspA , יכול להצביע על זן Borrelia קשורים. בפועל, פרוטוקול זה מניב תוצאות יחיד-חיוביות יותר OspA מאשר תחל FlaB , רומז תרחיש 'A' הוא ההסבר שהכי פחות סביר. ללא ניתוח ניסיוני נוסף של הדגימה במחלוקת, זאת, לא ניתן לקבוע את המקור של התוצאה יחיד-חיובית. הגדלת מספר טכני משכפל המבוצעת על דגימות דו-משמעית עשוי לעזור ליישב את מעמדם האמיתי, מאז כל מזהמים שהוצגו spuriously על תגובות קודמות לא יהיה נוכח ב- DNA בארכיון. עם זאת, אם הבאים המגיבה תחל אלה ייכשלו לספק תוצאות חותכות, לוקוסים Borrelia אחרים יכול תיחקר על-ידי ה-PCR. Amplicons שנוצר מתוך תגובות אלו יכול להיות גם רציף, בהשוואה בין מבודד כדי לסייע להקצות זהות, להעריך את מידת המתח גאוס. Sapi ועמיתיו לספק דוגמה של זרימת עבודה זו באמצעות דגימות קליניות האנושי35.
כל הגורמים בחשבון, יש כבר מוערך הקריטריונים פרוטוקול ופרשנות מחולקת לרמות להניב כוזב חיובי ו- false שלילי המחירים של 0.17% ל- 0.0063%, בהתאמה.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56471/56471fig2.jpg"> איור 2 : זיהוי של Borrelia burgdorferi בשנתות בודדים על-ידי nPCR של FlaB ו OspA. קודי המוקצים לכל שנתות מיוצגים לרוחב החלק העליון היחסי של ג'ל, זהויות יישור אנכי לדווח הזיהוי של OspA ושל FlaB כל הדגימה. מסלולים זכאי B בחלק השמאלי של הפקדים מתבנית לא לייצג תמונה, אמנם תרסיס פקדים כדי ללכוד של מעבדה זיהום (סמטאות ימין). <a href="//cloudflare.jove.com/files/ftp_upload/56471/56471fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>

Watch this Scientific Journal Video about Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR at JoVE.com

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

PCR מקוננת היא טכניקה רגיש, ספציפית, וברור כי ניתן להחיל על שנתות ש-DNA תמציות כדי לחקור Borrelia burgdorferi, סוכן סיבתי של מחלת ליים. הניסוי הראשוני של ה-PCR משתמשת תחל גנים ספציפיים כדי ליצור amplicons ארוכה, אשר לאחר מכן הופכים תבניות עבור ריאקציה עוקבות באמצעות תחל פנימי.

זיהוי החיידק מחלת ליים, Borrelia Burgdorferi, בשנתות באמצעות PCR מקוננים

Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to ...

detecting-lyme-disease-spirochete-borrelia-burgdorferi-ticks-using

Research

JoVE Journal

Biology

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

17.8K Views.  Mount Allison University. PCR מקוננת היא טכניקה רגיש, ספציפית, וברור כי ניתן להחיל על שנתות ש-DNA תמציות כדי לחקור Borrelia burgdorferi, סוכן סיבתי של מחלת ליים. הניסוי הראשוני של ה-PCR משתמשת תחל גנים ספציפיים כדי ליצור amplicons ארוכה, אשר לאחר מכן הופכים תבניות עבור ריאקציה עוקבות באמצעות תחל פנימי.

Video: Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to &gt;98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts.
Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process.
Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method.

The Solaris qPCR Gene Expression Assays are novel pre-designed qPCR primer/probe combinations designed to simplify the qPCR process without sacrificing the specificity and robustness of the assay.

כמותי Real-Time PCR באמצעות המדעית Thermo Solaris qPCR Assay

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and ...

Quantification of &gamma;H2AX Foci in Response to Ionising Radiation

DNA double-strand breaks (DSBs), which are induced by either endogenous metabolic processes or by exogenous sources, are one of the most critical DNA lesions with respect to survival and preservation of genomic integrity. An early response to the induction of DSBs is phosphorylation of the H2A histone variant, H2AX, at the serine-139 residue, in the highly conserved C-terminal SQEY motif, forming &gamma;H2AX1. Following induction of DSBs, H2AX is rapidly phosphorylated by the phosphatidyl-inosito 3-kinase (PIKK) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)2. Typically, only a few base-pairs (bp) are implicated in a DSB, however, there is significant signal amplification, given the importance of chromatin modifications in DNA damage signalling and repair. Phosphorylation of H2AX mediated predominantly by ATM spreads to adjacent areas of chromatin, affecting approximately 0.03% of total cellular H2AX per DSB2,3. This corresponds to phosphorylation of approximately 2000 H2AX molecules spanning ~2 Mbp regions of chromatin surrounding the site of the DSB and results in the formation of discrete &gamma;H2AX foci which can be easily visualized and quantitated by immunofluorescence microscopy2. The loss of &gamma;H2AX at DSB reflects repair, however, there is some controversy as to what defines complete repair of DSBs; it has been proposed that rejoining of both strands of DNA is adequate however, it has also been suggested that re-instatement of the original chromatin state of compaction is necessary4-8. The disappearence of &gamma;H2AX involves at least in part, dephosphorylation by phosphatases, phosphatase 2A and phosphatase 4C5,6. Further, removal of &gamma;H2AX by redistribution involving histone exchange with H2A.Z has been implicated7,8. Importantly, the quantitative analysis of &gamma;H2AX foci has led to a wide range of applications in medical and nuclear research. Here, we demonstrate the most commonly used immunofluorescence method for evaluation of initial DNA damage by detection and quantitation of &gamma;H2AX foci in &gamma;-irradiated adherent human keratinocytes9.

Quantification of &#947;H2AX Foci in Response to Ionising Radiation

Quantification of DNA double-strand streaks using &gamma;H2AX formation as a molecular marker has become an invaluable tool in radiation biology. Here we demonstrate the use of an immunofluorescence assay for quantification of &gamma;H2AX foci after exposure of cells to radiation.

כימות γH2AX מוקדים בתגובה קרינה Ionising

DNA double-strand breaks (DSBs), which are induced by either endogenous metabolic processes or by exogenous sources, are one of the most critical DNA ...

Analysis of Gene Expression in Emerald Ash Borer (Agrilus planipennis) Using Quantitative Real Time-PCR

Emerald ash borer (EAB, Agrilus planipennis) is an exotic invasive pest, which has killed millions of ash trees (Fraxinus spp) in North America. EAB continues to spread rapidly and attacks ash trees of different ages, from saplings to mature trees. However, to date very little or no molecular knowledge exists for EAB. We are interested in deciphering the molecular-based physiological processes at the tissue level that aid EAB in successful colonization of ash trees. In this report we show the effective use of quantitative real-time PCR (qRT-PCR) to ascertain mRNA levels in different larval tissues (including midgut, fat bodies and cuticle) and different developmental stages (including 1st-, 2nd-, 3rd-, 4th-instars, prepupae and adults) of EAB. As an example, a peritrophin gene (herein named, AP-PERI1) is exemplified as the gene of interest and a ribosomal protein (AP-RP1) as the internal control. Peritrophins are important components of the peritrophic membrane/matrix (PM), which is the lining of the insect gut. The PM has diverse functions including digestion and mechanical protection to the midgut epithelium.

Analysis of Gene Expression in Emerald Ash Borer Agrilus planipennis Using Quantitative Real Time-PCR

Quantitative real-time PCR (qRT-PCR) is an effective tool to diagnose mRNA levels in different insect tissues and developmental stages. In this report we show the use of qRT-PCR to ascertain mRNA levels in different larval tissues and developmental stages of the invasive insect species, emerald ash borer.

ניתוח של ביטוי גנים בורר אש אמרלד ( Agrilus planipennis) באמצעות Real Time-PCR כמותי

Emerald ash borer (EAB, Agrilus planipennis) is an exotic invasive pest, which has killed millions of ash trees (Fraxinus spp) in North America. EAB ...

Rapid PCR Thermocycling using Microscale Thermal Convection

Many molecular biology assays depend in some way on the polymerase chain reaction (PCR) to amplify an initially dilute target DNA sample to a detectable concentration level. But the design of conventional PCR thermocycling hardware, predominantly based on massive metal heating blocks whose temperature is regulated by thermoelectric heaters, severely limits the achievable reaction speed1. Considerable electrical power is also required to repeatedly heat and cool the reagent mixture, limiting the ability to deploy these instruments in a portable format.
Thermal convection has emerged as a promising alternative thermocycling approach that has the potential to overcome these limitations2-9. Convective flows are an everyday occurrence in a diverse array of settings ranging from the Earth's atmosphere, oceans, and interior, to decorative and colorful lava lamps. Fluid motion is initiated in the same way in each case: a buoyancy driven instability arises when a confined volume of fluid is subjected to a spatial temperature gradient. These same phenomena offer an attractive way to perform PCR thermocycling. By applying a static temperature gradient across an appropriately designed reactor geometry, a continuous circulatory flow can be established that will repeatedly transport PCR reagents through temperature zones associated with the denaturing, annealing, and extension stages of the reaction (Figure 1). Thermocycling can therefore be actuated in a pseudo-isothermal manner by simply holding two opposing surfaces at fixed temperatures, completely eliminating the need to repeatedly heat and cool the instrument.
One of the main challenges facing design of convective thermocyclers is the need to precisely control the spatial velocity and temperature distributions within the reactor to ensure that the reagents sequentially occupy the correct temperature zones for a sufficient period of time10,11. Here we describe results of our efforts to probe the full 3-D velocity and temperature distributions in microscale convective thermocyclers12. Unexpectedly, we have discovered a subset of complex flow trajectories that are highly favorable for PCR due to a synergistic combination of (1) continuous exchange among flow paths that provides an enhanced opportunity for reagents to sample the full range of optimal temperature profiles, and (2) increased time spent within the extension temperature zone the rate limiting step of PCR. Extremely rapid DNA amplification times (under 10 min) are achievable in reactors designed to generate these flows.

We describe a novel method to perform DNA replication via the polymerase chain reaction (PCR). Thermal convection is harnessed to continuously shuttle reagents between denaturing, annealing, and extension conditions by maintaining opposing surfaces of the reactor at constant temperature. This inherently simple design promises to make rapid PCR more accessible.

ראפיד PCR Thermocycling באמצעות הסעה תרמית Microscale

Many molecular biology assays depend in some way on the polymerase chain reaction (PCR) to amplify an initially dilute target DNA sample to a detectable ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway that polypeptide chain follows during co-translational folding to achieve its functional form is still an enigma. In order to understand this process and to determine the exact conformation of the co-translational folding intermediates, it is essential to develop techniques that allow the isolation of RNCs carrying nascent chains of predetermined sizes to allow their further structural analysis.
SecM (secretion monitor) is a 170 amino acid E. coli protein that regulates expression of the downstream SecA (secretion driving) ATPase in the secM-secA operon6. Nakatogawa and Ito originally found that a 17 amino acid long sequence (150-FSTPVWISQAQGIRAGP-166) in the C-terminal region of the SecM protein is sufficient and necessary to cause stalling of SecM elongation at Gly165, thereby producing peptidyl-glycyl-tRNA stably bound to the ribosomal P-site7-9. More importantly, it was found that this 17 amino acid long sequence can be fused to the C-terminus of virtually any full-length and/or truncated protein thus allowing the production of RNCs carrying nascent chains of predetermined sizes7. Thus, when fused or inserted into the target protein, SecM stalling sequence produces arrest of the polypeptide chain elongation and generates stable RNCs both in vivo in E. coli cells and in vitro in a cell-free system. Sucrose gradient centrifugation is further utilized to isolate RNCs.
The isolated RNCs can be used to analyze structural and functional features of the co-translational folding intermediates. Recently, this technique has been successfully used to gain insights into the structure of several ribosome bound nascent chains10,11. Here we describe the isolation of bovine Gamma-B Crystallin RNCs fused to SecM and generated in an in vitro translation system.

We describe here a technique that is now routinely used to isolate stably bound ribosome nascent chain complexes (RNCs). This technique takes advantage of the discovery that a 17 amino acid long SecM "arrest sequence" can halt translation elongation in a prokaryotic (E. coli) system, when inserted into (or fused to the C-terminus) of virtually any protein.

באמצעות רצף מעצר SecM ככלי לבודד פוליפפטידים כרוכים הריבוזום

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

מחיקות Gene הגנום ב<em&gt; סטרפטוקוקוס sanguinis</em&gt; על ידי תפוקה הגבוהה PCR

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

בדוגמנות Vivo של הגנום האנושי החולנית באמצעות Danio rerio

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

מהירה ויעילה דג הזברה Genotyping באמצעות PCR עם רזולוציה גבוהה ממיסים ניתוח

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

אפיון תאי גזע עוברי האנושי על ידי הפרט כמותי RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine disruption. Estrogenic ligands include both natural and manmade &#34;Environmental Estrogens&#34; (EEs) found in many consumer goods including Personal Care Products (PCPs), plastics, pesticides, and foods. EEs disrupt hormone signaling in humans and other animals, potentially reducing fertility and increasing disease risk. Despite the importance of EEs and other Endocrine Disrupting Chemicals (EDCs) to public health, endocrine disruption is not typically included in undergraduate curricula. This shortcoming is partly due to a lack of relevant laboratory activities that illustrate the principles involved while also being accessible to undergraduate students. This article presents an optimized YES for quantifying ligands in personal care products that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates one of the two colorimetric substrates (ortho-nitrophenyl-&#946;-D-galactopyranoside (ONPG) or chlorophenol red-&#946;-D-galactopyranoside (CPRG)) that are cleaved by &#946;-galactosidase, a 6-day refrigerated incubation step to facilitate use in undergraduate laboratory courses, an automated application for LacZ calculations, and R code for the associated 4-parameter logistic regression analysis. The protocol has been designed to allow undergraduate students to develop and conduct experiments in which they screen products of their choosing for estrogen mimics. In the process, they learn about endocrine disruption, cell culture, receptor binding, enzyme activity, genetic engineering, statistics, and experimental design. Simultaneously, they also practice fundamental and broadly applicable laboratory skills, such as: calculating concentrations; making solutions; demonstrating sterile technique; serially diluting standards; constructing and interpolating standard curves; identifying variables and controls; collecting, organizing, and analyzing data; constructing and interpreting graphs; and using common laboratory equipment such as micropipettors and spectrophotometers. Thus, implementing this assay encourages students to engage in inquiry-based learning while exploring emerging issues in environmental science and health.

This article presents an optimized yeast estrogen screen for quantifying ligands in Personal Care Products (PCPs) that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates two colorimetric substrate options, a six-day refrigerated incubation for use in undergraduate courses, and statistical tools for data analysis.

זיהוי החיידק מחלת ליים, Borrelia Burgdorferi, בשנתות באמצעות PCR מקוננים

Summary

Explore More Videos

Chapters in this video