뇌관 디자인을 위해 카 미 해리스, 애슐리 McKibbon 촬영, 제시카 토마스 Ebbett 죤 Blakely, 알렉산드라 폴 리-Eby, 크리스 랭 글 리, 줄리 루이스, 켈 시 매 킨 타이어, 애슐리 McKibbon, 크리스 하느님, 그리고로 지에 대 한 개 감사 하고자 하는 저자는 비디오입니다. A. M. K. 캐나다 라임 질병 연구 재단에 의해 지원 되었다 그리고 프로젝트 자금 자연과학 및 캐나다 엔지니어링 연구 위원회 (NSERC)에 의해 제공 했다. M. K. B. W. 급여 자금 뉴 브 런 즈 윅 혁신 재단 (NBIF)에서 받았다.

1. DNA 별개로 틱
<ol><li>필드 컬렉션, 또는 수 의사와 공중의 구성원에서 수동 감시를 통해 진드기를 취득 합니다. 틱 해야 동결에 의해 살해, 봉인된 된 봉투에 배치 되며 실 온에서 발송.<ol>
<li>제출 양식을 사용 하 여, 날짜와 만남, 틱 부착 상태, 호스트 종, 및 호스트의 최근 여행 역사의 지리적 위치에 대 한 정보를 수집 합니다.</li>
		<li>중첩된 한 PCR 본질적으로 오염에 취약 한 이기 때문에, 실험실 작업 샘플의 크로스-노출을 최소화 하기 위해 설정 되어 확인 합니다. 이 프로토콜의 다른 요소를 철저 하 게 청소 하 고 소독, 서로 잘 분리 별도, 전용 공간에서 실행을 포함 하 고 모든 계측을 보장 하는 것은 오염 물질의 무료.</li>
		<li>시료를 받으면 진드기 사진 하 고 식별 키32 종, 발달 단계, 섹스, 그리고 engorgement 상태를 비교 하 여 결정 합니다.</li>
		<li>무 균 조건 하에서 무 균 면도날 또는 메스를 사용 하 여 눈금을 이등분 고 두 틱 조각 별도 microcentrifuge 관 합니다.</li>
	</ol>
</li>
	<li>총 DNA 추출, PCR 호환 서식 파일;을 생성 하 어떤 격리 절차 사용 하 여 이 프로토콜에서는 간단한 chelation 기반 접근 방식을 보여 줍니다.<ol>
<li>진드기 파편 용균성 킬레이트 시 약의 (수시로 50-200 µ L) 사이의 적절 한 볼륨을 추가 하 여 시작 합니다. 구체적인 금액 표본 크기와 engorgement 상태;에 따라 달라 집니다. 지침 서는 제조 업체에 의해 제공 되어야 한다. 균질 microtube 방 앗 공이 사용 하 여.</li>
		<li>짧게 45 분, 그리고 소용돌이 60 ° C에서 물 욕조에 샘플을 품 어.</li>
		<li>데스크톱 microcentrifuge에서 16,276 x g (13300 rpm)에서 4 분에 대 한 샘플을 원심.</li>
		<li>50 µ L 소 프로 파 놀, 반전, 그리고 다시 (1.2.3)에서 원심에 의해 혼합을 포함 하는 신선한, 레이블이 microtube 상쾌한 전송.</li>
		<li>상쾌한, 가만히 따르다와 DNA 펠 릿의 70% 에탄올 50 µ L와 린스.</li>
		<li>초과 에탄올을 피 펫을 제거 하 고 실 온에서 15 분 동안 건조를 펠 릿을 허용.</li>
		<li>Resuspend DNA, 1 mM Tris pH 7.0의 50 µ L을 추가 하 고 60 ° c.에 1 시간을 위한 물 욕조에 샘플을 품 어 DNA는 이제 미래 분자 분석-20 ° C에 저장할 수 있습니다.</li>
	</ol>
</li>
</ol>2. 중첩 된 PCR Borrelia OspA FlaB의 탐지.
참고: 일반적인 PCR 원칙 및 관행에 대 한 개요는 로렌스, 201233에 의해 제공 됩니다.
<ol><li>합성 또는 보렐 리아 유전자 특정 외부 및 내부 oligonucleotide 뇌관을 얻을. 뇌관 세트, 그들의 각각 amplicon 크기, 및 녹는 온도 대 한 표 1 을 참조 하십시오.</li>
</ol><table border="1"><tbody>
<tr>
<td>뇌관 이름</td>
			<td>진 대상</td>
			<td colspan="2">시퀀스 (5'-3')</td>
			<td>Amplicon 크기</td>
			<td>어 닐 링 온도</td>
		</tr>
<tr>
<td>Fw 아웃 flaB</td>
			<td>군살</td>
			<td colspan="2">gcatcactttcagggtctca</td>
			<td rowspan="2">503 혈압</td>
			<td rowspan="2">55 ° C</td>
		</tr>
<tr>
<td>Rv가 밖으로 군살</td>
			<td>군살</td>
			<td colspan="2">tggggaacttgattagcctg</td>
		</tr>
<tr>
<td>Fw에 flaB</td>
			<td>군살</td>
			<td colspan="2">ctttaagagttcatgttggag</td>
			<td rowspan="2">447 혈압</td>
			<td rowspan="2">58 ° C</td>
		</tr>
<tr>
<td>Rv에 flaB</td>
			<td>군살</td>
			<td colspan="2">tcattgccattgcagattgt</td>
		</tr>
<tr>
<td>OspA 아웃 Fw</td>
			<td>OspA</td>
			<td colspan="2">cttgaagttttcaaagaagat</td>
			<td rowspan="2">487 혈압</td>
			<td rowspan="2">55 ° C</td>
		</tr>
<tr>
<td>OspA 아웃 Rv</td>
			<td>OspA</td>
			<td colspan="2">caactgctgacccctctaat</td>
		</tr>
<tr>
<td>Fw에 OspA</td>
			<td>OspA</td>
			<td colspan="2">acaagagcagacggaaccag</td>
			<td rowspan="2">350 혈압</td>
			<td rowspan="2">58 ° C</td>
		</tr>
<tr>
<td>OspA Rv</td>
			<td>OspA</td>
			<td colspan="2">ttggtgccatttgagtcgta</td>
		</tr>
</tbody></table>표 1: 내부 및 외부 뇌관 Borrelia burgdorferiFlaB 및 OspA nPCR에 대 한. 실제로, FlaB 뇌관 B. burgdorferi s.s. 등 밀접 한 보렐 리아 genospecies OspA 뇌관만 B. burgdorferi s.s. 캡처 동안 감지 두 loci에서 증폭 B. 나타냅니다 burgdorferi. s.s.
<ol start="2"><li>미리 소독 UV 빛과 70% 에탄올과 PCR 캐비닛. 참고: 잠재적인 샘플 오염을 최소화 하려면이 작업 한다 틱 해 부, DNA 추출의 위치에서 되며 젤 전기 이동 법.<ol>
<li>초기 PCR 실행에 대 한 외부 뇌관을 사용 하 여 DNA 1.0, 위의 단계에서 복구 하 고 반응 혼합물 표 2에 설명 된 대로 템플릿와 함께. 동시에 긍정적인 제어 실행 확인된 보렐 리아 DNA의 구성 하 고 부정적인 제어 없음 템플릿 반응 시 약 및에 어로 졸 오염 감지를 포함 하 여 실행을 수행 합니다. 시 약의 잠재적인 오염을 최소화 하기 위해 끝에 DNA를 추가 합니다. 각 튜브 시 약의 추가 되지 및 DNA 추가 후 즉시 및 다른 튜브 열 전에 튜브를 닫을 때 항상 모든 닫힌 확인 하십시오.</li>
		<li>다음과 같이 열 cycler 프로그램: 95 ° C 5 분; 15 95 ° C의 40 주기 어 닐 링 온도 30 s s, 45 72 ° C s; 72 ° C 5 분; 4 ° c.에서 개최</li>
	</ol>
</li>
	<li>2 µ L의 첫 번째 PCR 제품 (2.2.2에서 생산)와 내부 뇌관을 사용 하 여 제외 하 고 첫 번째 반응에 유사한 PCR의 두번째 라운드를 수행 합니다. 참고: 반응 볼륨 다시 표 2에 제공 됩니다. 서식 파일 DNA 마지막 추가 되 고 한 번에 하나의 샘플에 해당 하는 관은 오픈 함으로써 amplicons의 교차 오염을 방지 하려면 주의 해야 합니다. 
	 
	<table border="1"><tbody>
<tr>
<td>구성 요소</td>
				<td>PCR # 1 볼륨</td>
				<td>PCR # 2 볼륨</td>
			</tr>
<tr>
<td>Taq 중 합 효소 마스터 믹스 2 X</td>
				<td>12.5 Μ L</td>
				<td>12.5 Μ L</td>
			</tr>
<tr>
<td>Nuclease 무료 물</td>
				<td>8.5 Μ L</td>
				<td>8.5 Μ L</td>
			</tr>
<tr>
<td>10 µ M 앞으로 반전 뇌관</td>
				<td>1.0 µ L 외부 뇌관</td>
				<td>1.0 µ L 내부 뇌관</td>
			</tr>
<tr>
<td>DNA 템플렛</td>
				<td>샘플 추출 (1.2.7)에서 2.0 µ L</td>
				<td>PCR (2.2.2)의 1 라운드에서 2.0 µ L</td>
			</tr>
</tbody></table>
표 2: 첫 번째 및 두 번째 확대에 대 한 PCR 반응 혼합물. 
	 
	<ol>
<li>이전, 열 cycler 프로그램 하지만 내부 뇌관 (표 1 참조)에 맞게 어 닐 링 온도 조정.</li>
	</ol>
</li>
</ol>3. Agarose 젤 전기 이동 법 및 이미징
참고: 기본 DNA 전기 이동 법으로 분리, 참조 리 외. 2012,34.
<ol><li>20 X SB 버퍼 (0.2 M NaOH, 0.8 M 붕 소의 산 성 pH 8), 1 X, 희석을 사용 하 여 1.2 %agarose 젤 준비 하 고 바란다면 미리 젤의 얼룩은 따르고, 전에 DNA 얼룩의 약 5 µ L를 추가 합니다.</li>
	<li>10 µ L의 각 실험에서 두 번째 (내부) PCR 반응에서 제품 및 제어 샘플 100 bp 사다리 (5 µ L)와 함께 로드 합니다.<ol>
<li>107에서 1 h electrophorese V (5V/cm).</li>
	</ol>
</li>
	<li>보기 및 문서는 transilluminator와 연결 된 카메라와 소프트웨어를 사용 하 여 젤.</li>
</ol>

저자는 공개 없다.

사용의 년간 PCR 기반 기술을 일관 되 게 입증 Borrelia 의 검출에 그들의 가치 arthropod와 포유류 표본에서 보렐 리아 환경 또는 임상에서 온 여부. PCR 감시를 기존의 방법 많은 개선을 제공합니다. 특히, 그것은 개발 및 항 체 시 약의 성능에 의존 하 고 대신 적용할 수 있습니다 쉽게 단순히 뇌관 시퀀스를 수정 하 여 관심의 새로운 목표를 검출 하기. 독립적으로 또는 다중 반응을 통해 PCR는 또한 동시에 여러 개의 loci의 평가 수용 한다. 그것은 신선 하 고 보관 된 틱22, 동물 또는 인간의 체액 및 절제 조직25를 포함 하 여 다양 한 표본 입력에 적용할 수 있습니다. PCR amplicons 처리할 수 있는 추가, 예를 들면 금지 효소 소화, 프로브 교 잡, 또는 시퀀싱, 미생물 정체성21에 증가 된 통찰력을 제공 하 여 생성 됩니다.
임상 도구로 PCR 바람직합니다 개념적으로 표준 혈 청 학적인 진단에 감염의 보조 수단으로 호스트 면역 반응에 의존 하는 것 보다는 세균 존재의 직접적인 표시를 제공 합니다. 그러나, 라임 borreliosis 상대적으로 겸손 한 미생물 부담으로 연결 됩니다 (< 소변 또는 플라즈마의 50 생물/mL) 및 false 네거티브를 야기할 수 있는 일시적인 spirochetemia 결과25. 병원에서이 기법의 감도 조직 유형, 감염, 및 샘플 상태의 단계 12.5%와 혈액, 중추 신 경계, 그리고 biopsied 조직36의 기존 연구에서 62% 사이 떨어지는 상당히 다릅니다. 그러나 분자 감도 제한 되지 않습니다 우려 PCR은 세균성 문화, 이후 착수 하는 경우 복구 가능한 나 선상 세균의 임상 표본에서 마찬가지로 어려운 입증 했다. 최근에 프로토콜 높은 수익률35에 대 한 최적화 되었습니다. 한편, 감염된 된 성인 진드기의 용기 수 항구 평균 어디 2000에서 50000 이상의 보렐 리아37,38,39, 단단하게 nPCR의 감지 범위 내에서입니다. 따라서, 프로토콜은 틱 감시 활동에 적합 합니다.
그 많은 장점에도 불구 하 고 특정 도전과 정확 하 게 보고 진드기 감염 따라서 유전자 그리고 amplicons, 품질 DNA를 복구 하는 세심 한 실험 워크플로의 전략적 선택에 따라이 기술 수 nPCR 포즈지 않습니다. 크로스-노출의 샘플, 그리고 실험실 환경 및 시 약에서 오염 물질을 보고할 수 있는 적절 한 컨트롤의 사용을 최소화 하면서의 표본에서 어떤 실험에 앞서 범위와 조사 의도 정의 되어야 한다 명확 하 게 되도록 적절 한 유전 loci과 지역, 선택할 수 있습니다. 목적은 라임을 일으키는 보렐 리아 burgdorferi s.l. 복잡 한에 대 한 편견된 화면을 제공 하는, 모두 비슷한 선호도와 관련 된 긴장을 검출 하기 위하여 뇌관을 생성 해야 하 고 증폭 효율, 캡처 없이 무관 유기 체25. 새로운 뇌관 디자인 될 수 있다 고 평가 철에 비록 그들은 또한 유효성을 검사 해야 실험적으로 표준 참조에 대 한 뇌관 폭발40, 같은 소프트웨어 도구를 사용 하 여 새롭거나 샘플에 적용 되 고 전에 격리. DNA 추출 절차의 목표 혼합된 환경 샘플 (틱 homogenate)에서 그대로 미생물 서식 파일을 복구 하는 것입니다. PCR 진행 하기 전에 단계는 선택적 추출 된 DNA의 무결성을 평가 하는 것입니다. 또한, 병렬 반응 수 설정할 수 틱에 하우스키핑 유전자를 대상으로. 두 번째 방법은 반응 혼합물, 제공 하 고 증가 자신감을 부정적인 보렐 리아 반응 유기 체, 그리고 하지 억제 오염 물질의 존재 때문에 억제제의 존재를 나타낼 수도 있습니다.
중첩 된 PCR 방법의 감도 증가 거짓 양성 결과 생성 하는 잠재적인 오염 비용으로 온다. 틱 해 부 및 DNA 복구 동안 또는 외부 및 내부 증폭 반응을 설정 하는 과정 외 인 템플릿 샘플 소개 수 있습니다. 그것은 따라서 템플릿이나 amplicon 피하기 위해 PCR 위한 최상의 연습 프로토콜에 따라 특히 중요 한 교차 오염. 이 PCR 및 생물 안전 캐비닛에 독립적인 기류, 봉쇄와 별도 워크 스테이션의 사용을 포함 적절 한, 철저 한 화학 및 물리적 청소와 표면 및 시 약, 살 균 및 DNA 의 신중한 처리 41. 아니-템플릿 컨트롤은 또한 재고 시 약의 오염 식별에 중요 한. NPCR의 특정 취약점을 처리 하는 amplicon 발생 두 번째 PCR 선박에 첫 번째 반응의 제품을 전송 하는 경우입니다. 이후 대상 DNA 이미 긍정적인 샘플 지 수 농축 겪은,이 단계는 교차 오염을, 특히 경향이 그리고 단일 튜브 nPCR 프로토콜이이 한계를 우회 하도록 개발 되었습니다. 이 방법에서는, 주어진된 유전자를 위한 뇌관의 두 세트는 PCR31의 두 라운드 봉인 남아 있는 반응 관에 함께 추가 됩니다. 외부 및 내부 뇌관 쌍 외부 몇 증폭 템플릿의 내부 프라이 머에 대 한 금지는 높은 어 닐 링 온도에서 그런 열역학으로 고유 해야 합니다. 두 번째 라운드에서 어 닐 링 온도 내부 쌍에 맞게 낮 췄 다. 뿐만 아니라이 잠재적으로 혼란 단계를 무시, 그것은 또한 추가의 사용 방지 오염 측정31,42. 그러나,이 수정 일부 시험 감도 희생 수 있습니다. 접근 방식에는 샘플에 독립적으로 수행 하는 기술 복제의 수를 증가 가짜 감염을 식별 하 데 도움이 됩니다.
분자 기술, nPCR의 도입 이후 진화를 계속 하 고 이러한 새로운 접근 선택 이점이 원래 디자인을 제공 하는 금융 비용 증가에 불구 하 고. 마찬가지로 이름이 있듯이, 정량 PCR (정량 또는 진짜 시간 (RT)-PCR) 기존의 기법 자연43질적 동안 샘플, 병원 체의 열거에 대 한 수 있습니다. 정량의 감도가 비슷합니다 보도 nPCR38의 뇌관 특성28에 따라 변동 될 수 있지만. 기존의 TaqMan 프로브 대신 분자 비콘 (MB)를 사용 하 여 정량의 변화는 또한 임상 표본44,,4546에 보렐 리아 의 검출에 약속을 보여주었다. 그들의 독특한 보조 구조 때문 분자 비콘 보도 낮은 배경 형광 및 그로 인하여 제공 탁월한 감도47높은 합법적인 신호를 생성 합니다. 전 임상 평가 제안 하나, 10 나 선상 세균44,45사이 잠재적인 검출 임계값. 또한, 기술은 멀티플렉스 반응을 동시에 포유류 호스트 유전자44 및45의 다른 tick-borne 병원 균 감지는 nPCR과 같이 쉽게 달성에서 성공적으로 적용 되었다. 다른 디자인 수정 포함 표준 곡선39,48를 사용 하지 않고 DNA를 계량 수 방울 디지털 PCR (ddPCR) 기술. 보렐 리아 에 대 한이 기술의 낮은 검출 한계는 똑같이 약 10 나 선상 세균/샘플39이다. NPCR에 비해, 이러한 접근 또한 이점을 오염, 감소 잠재력의 그들은 단일 증폭 프로토콜을 필요로.
감시의 목적은 프로 틱의 다양 한 세균성 내용 대신 경우 16S rRNA metagenomic 심사는 매력적인 옵션49이다. 그것은 정확 하 게 더 많은 미생물의 광범위 한 스펙트럼을 캡처할 수 있습니다 있지만이 이렇게 costlier, 모든 분자 생물학 실험실에서 찾을 수 없는 특수 DNA 시퀀서 필요 필요로 보다 정교한 생물 정보학 기반 해석, 벡터의 병원 체 로드를 나타냅니다.
정량 및 그 유도체는 양적 응용 프로그램에 대 한 선택의 방법 metagenomics 화면 틱 미생물의 광범위 한 재고를 제공 하는 동안 대상된 감시 노력은 종종 염려의 유무의 이진 보고 벡터에 하나 또는 소수의 병원 이러한 상황에서이 최신, 더 정교한 접근 과정에 불필요 한 복잡성과 재정 부담이 발생할 수 있습니다. 이러한 이유로, nPCR 틱 테스트에서 중추적인 기법으로 시간 시험을 성장 했다.

Lyme 질병 (LD), 북반구에서 가장 널리 퍼진 벡터 품 어진 감염 이며 그 발생률1증가 하 고. 이 쇠 약 질병은 라임 borreliosis (파운드) 복잡 한 (흔히 보렐 리아 burgdorferi sensu lato, 또는 s.l.), 역사적으로 지배적인 북미 병원 체, B. 구성의 spirocheteal 병원 균에 의해 발생 burgdorferi sensu stricto (s.s), B. afzelii 및 B. garinii, 유럽 및 아시아에 걸쳐 널리 고 신흥 임상 관련성2,3종의. 이 박테리아는 감염된 Ixodes 틱2. 의 바이트를 통해 인 간에 게 전달 주요 북미 벡터는 I. scapularis 그리고 I. pacificus, 항구 박테리아4전송 하이 속 내의 여러 종 발견 되었습니다. 인간에서는, B. burgdorferi 피부, 관절, 심장, 신 경계, 내 분 비 땀 샘, 위장, 그리고 내부 장기5,6,7에 영향을 미치는 multisystem 증상을 일으킬 수 있습니다. 8,,910. 질병 통제 및 예방 센터는 현재 미국11,12에서 매년 30만 이상의 새로운 인간의 경우를 견적 한다. 연구와 치료 후 증상이 계속 권장된 항생제 처방을 받은 환자의 60% 10% 사이 아무 데도 그 때 질병 진단 및 초기 단계에서 치료 예 후를 유리한 자주 동안 제안 정지, 현상에서 게시물 치료 Lyme 질병 증후군 (PTLDS)13,,1415되 나. 또한, 임상 개입에 지연 진드기 바이트의 인식, 초기 질병의 일반적인 프레 젠 테이 션 및 감염의 발병에서 사용 될 때 전통적인 혈 청 학 기반 진단의 낮은 감도의 부족으로 인해 발생할 수 있습니다. 신속 하 고 적절 하 게 치료 하지 않으면 합병증16,17를 점점 더 쇠 약에서 증명할 수 있는 증상 진행을 수 있습니다. Lyme 질병 예방은 따라서 리스크 관리의 초석입니다. 이 성장 위협에 대처 하기 위해 전략 틱, 병원 체 보급을 나타내는 강력한 감시 조치를 포함 하 고 관심사의 지리적 영역을 식별.
이 문서에서는 감염 된 진드기를 식별 하는 분자 검사 도구로 중첩된 연쇄 반응 (nPCR)의 유틸리티를 보여줍니다. 특이성을 높이기 위해 두 보렐 리아 유전자 병렬 증폭에 사용 됩니다. Flagellin B (군살) 편18의 주요 필 라 멘 트 단백질 인코딩하고 외부 표면 단백질 A (OspA)의 단백 제품 틱 midgut 중재 동안 단일 선형 염색체에 있는 유전자 식민, 플라스 미드로 인코딩된19,20. 워크플로 구성 틱 컬렉션, DNA 추출, 그리고 보렐 리아를 검출 하는 PCR의 초기 라운드-특정 loci. 이후 PCR 작고, 내부 증폭 조각을 생성 하 새 템플릿으로 첫 번째 반응의 제품을 사용 합니다. 진드기는으로 간주 긍정적인 보렐 리아 burgdorferi 때 두 보렐 리아 유전자에서 내부 amplicons agarose 젤 전기 이동 법에 의해 검출 될 수 있다.
NPCR 기술 그리고 FlaB 및 OspA 유전자 대상, 널리 사용 된 생태 감시 및 초기 1990 년대21,,2223 이후 라임 spirochete의 임상 탐지 ,2425. 분자 프로토콜 개발, 이전 틱 subjecting 본질적인 내용을 안티-보렐 리아 면역 형광 검사 (면) 얼룩, 미생물 문화, 또는 조합을26평가 됐다. 이러한 접근 한계, 느린 성장 및 보렐 리아27, 항 체 성능 문제 및 IF 처리21라이브 틱의 요구의 까다로운 성격 등에서 고통. PCR 감염된 벡터의 빠른, 민감한, 그리고 특정 식별 제공 하기 위해 연속적으로 채택 되었다. 그것은 그렇지 않으면 될 하지 테스트21,22 적합 죽은 및 보관 된 틱 등 다양 한 견본 유형에 문화권 직접 응용 프로그램을 포함 한 전통적인 방법론 표시 된 개선 제안 . 중첩 된 실험적인 디자인 더 증폭25,28의 두 연속 라운드에서 유전자 특정 뇌관의 두 가지 세트를 채용 하 여 고전 PCR의 민감도와 특이성 향상.
실험 성공 비판적 amplicon 디자인과 전략적 유전자 선택에 따라 달라 집니다. 보렐 리아 burgdorferi의 존재를 정확 하 게 예측 하려면 뇌관 보렐 리아 속에 또한 회귀 열 나 선상 세균을 cross-reacting 없이 관련 병원 체를 탐지 해야 합니다. 군살, 경우이 특이성 유전자, 보다는 오히려 공유 하는 다양 한 박테리아 (그림 1)24,29 에 의해 상대적으로 보존된 측면에 서 시퀀스의 변수 내부 영역을 대상으로 이루어집니다. , 30.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56471/56471fig1.jpg"> 그림 1: nPCR, 같이 사용 하 여의 개념 보렐 리아 FlaB 유전자를 대상으로. 유전자의 5'과 3' 테르미니가이 지역 라임을 일으키는 병원 체의 특정 평가 대 한 부적 절 한 렌더링 보렐 리아 burgdorferi s.l. 넘어 생물에 공통 됩니다. 덜 보존 인테리어 시퀀스를 사용 하 여 뇌관 대상으로, PCR의 2 라운드 최종, 내부 amplicon 검색 실행 됩니다. <a href="//cloudflare.jove.com/files/ftp_upload/56471/56471fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
그들의 차별 능력의 시험에서 인테리어 FlaB 뇌관 80 개 이상의 다른 Borrelia 격리와 평가 되었고만 그 라임 병24와 관련 된 식별을 발견. NPCR의 낮은 검출 한계 문서화 되었습니다에서 624 사이의 순수한 문화에서 1031 박테리아 비록 감도 amplicon blotting 남쪽과 radiolabelled 교배 시키기에 의해 더욱 향상 시킬 수 있습니다 또는 chemiluminescent 프로브입니다. 커플링 기술 단일 spirochete31검출 임계값을 줄일 수 있습니다. 직접 비교 하 여 기존의 unprobed 단일 라운드 PCR 104 나 선상 세균31의 최소의 존재를 보고 발견 됐다. 그러나 그것은,, 복잡 한 환경 및 임상 샘플 없는 DNA 및 잠재적인 억제 물질의 압도적인 존재 때문에 작업할 때 분석 결과 감도 낮은 것 이다 주목 해야한다. 이러한 과제는 크게 nPCR의 사용에 의해 피할 수 있습니다.
지난 수십 년간에서 분자 기술 발전에 불구 하 고 nPCR 현대 감시 노력에 주식 기법을 남아 있습니다. 주의 디자인 및 실행이이 프로토콜의 경우 틱 벡터에 병원 체의 존재를 캡처, 적응력, 강력 하 고 비교적 간단 접근 이다.

<table><tbody><tr><td>LabGard Class II, Type A2 biological safety cabinet</td><td>Nuaire</td><td>ES AIR NU-543&amp;nbsp;</td><td></td></tr><tr><td>Razor blades</td><td>VWR</td><td>55411-050</td><td>0.22 mm thickness</td></tr><tr><td>Microfuge Tubes (Microtubes 1.5 mL)</td><td>Axygen</td><td>311-08-051</td><td></td></tr><tr><td>AquaGenomic&amp;nbsp;</td><td>MultiTarget Pharmaceuticals</td><td>2030</td><td>DNA extraction reagent</td></tr><tr><td>Microtube Pestle</td><td>Diamed</td><td>DIATEC610-1551</td><td>Designed for 1.5 ml tubes</td></tr><tr><td>Water bath - Isotemp 202</td><td>Fishse Scientific</td><td>15-462-2</td><td></td></tr><tr><td>Vortex</td><td>Labnet</td><td>S0100 CAN</td><td></td></tr><tr><td>Spectrafuge 24D Digital Microcentrifuge</td><td>Labnet</td><td>C2400</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma-Aldrich</td><td>190764</td><td></td></tr><tr><td>BIS-TRIS</td><td>Sigma-Aldrich</td><td>B9754</td><td></td></tr><tr><td>Primer Synthesis</td><td>Sigma-Aldrich</td><td>OLIGO</td><td></td></tr><tr><td>PCR Cabinet</td><td>Misonix</td><td>PCR6-482</td><td></td></tr><tr><td>PCR tube with attached flat caps 0.2mL</td><td>VWR</td><td>20170-012</td><td></td></tr><tr><td>GoTaq Green Master Mix 2x</td><td>Promega</td><td>M7123</td><td></td></tr><tr><td>Nuclease-free water</td><td>Promega</td><td>M7123</td><td>The water comes with the GTG</td></tr><tr><td>Spectrafuge Mini</td><td>Labnet</td><td>C1301</td><td></td></tr><tr><td>SYBR Safe DNA Stain 10,000X Concentration</td><td>EDVOTEK</td><td>608</td><td></td></tr><tr><td>Froggarose LE (Molecular Biology Grade Agarose)</td><td>FroggaBio</td><td>A87-500G</td><td></td></tr><tr><td>GD 100 bp DNA Ladder</td><td>FroggaBio</td><td>DM001-R500&amp;nbsp;</td><td></td></tr><tr><td>Electrophoresis power pack&amp;nbsp;</td><td>VWR</td><td>VWR 105</td><td>EC Apparatus Corporation</td></tr><tr><td>Fluor-S MultiImager&amp;nbsp;</td><td>BioRad</td><td>170-7700 (Serial number 433B0154)</td><td></td></tr><tr><td>Quantity One 1-D Analysis Software (V. 4.5.2)</td><td>BioRad</td><td>1709600</td><td></td></tr></tbody></table>

detecting the lyme disease spirochete, borrelia burgdorferi, in ticks using nested pcr

Lyme 질병 나 선상 세균 감염된 Ixodes 의 진드기에 물린 상처를 통해 인 간에 게 전송의 보렐 리아 burgdorferi sensu lato 가족에 의해 발생 한 심각한 벡터 품 어진 감염 이다. 북미 지역에서 1 차 etiological 대리인 보렐 리아 burgdorferi sensu stricto 이다. 지리적 위험 지역 확장, 그것은 진드기 감염 속도 측정 임상, 수 의사, 그리고 일반 대 중에 결과 전달할 수 있는 강력한 감시 프로그램을 지 원하는 것이 좋습니다. 중첩 된 중 합 효소 연쇄 반응 (nPCR)의 분자 기술을 오래이 목적을 위해 사용 되었습니다 그리고 그것 진드기와 야생 동물에 보렐 리아 의 검출에 중앙, 저렴 한, 그리고 강력한 접근 남아 있다.
이 문서에서는 감염된 표본 식별을 DNA 추출 틱 nPCR의 응용 프로그램을 보여 줍니다. 두 개의 독립적인 B. burgdorferi 대상, 유전자 인코딩 Flagellin B (군살) 및 외부 표면 단백질 A (OspA), 이 기법으로 광범위 하 게 사용 되어 왔습니다. 프로토콜 관련 틱 컬렉션, DNA 추출, 그리고 두 Borrelia의 각을 검출 하는 PCR의 초기 라운드-특정 loci. 이후 연쇄 반응 (PCR) 작고, 내부 증폭 조각을 생성 하 새 템플릿으로 첫 번째 반응의 제품을 사용 합니다. 중첩 된 접근 특이성 및 기존의 PCR의 민감도 향상 시킵니다. 틱 때 두 보렐 리아 유전자에서 내부 amplicons agarose 젤 전기 이동 법에 의해 검출 될 수 있다 병원 체에 대 한 긍정적으로 간주 됩니다.

nPCR 복잡 한 환경 샘플 조사를 받고 있을 때 특히 특이성 및 병원 체 검출의 감도 증가 하는 우아한 접근 이다. 그림 1에서 같이, 보렐 리아 FlaB 로커 스 (및 OspA, 사진 안)의 전략적 영역을 대상으로 하는 PCR의 2 라운드 짧은 내부의 세대를 통해 보렐 리아 burgdorferi 박테리아의 존재를 보고할 수 있습니다. amplicons입니다. 젤 전기 이동 법으로 해결 하는 경우 각 틱에서 FlaB 와 OspA 반응 제품 시각적으로 득점 고 컨트롤에 대 한 비교. 그림 2를 독특한 견본 식별자 각 젤 상단의 제공 되며 노 템플릿과 졸 컨트롤 표시 됩니다 맨 왼쪽 및 오른쪽, 각각, 사다리에 인접 한.
강력한 amplicon 밴드 선택 실험 샘플에서 명확 하 게 볼 수 있습니다 그리고 그들은 쉽게 과잉 뇌관 및 잔여 DNA (그림 2)에서 고유. 명시 된 실험 설계 원칙에 따라, 진드기가 여겨진다 긍정적인 보렐 리아 때 부정적인 컨트롤 설명 없음 증폭, 및 내부 amplicons FlaB 와 OspA 뇌관에서 생산 됩니다에 병렬에 대 한. 이 경우에, T907, T604, 및 T606 표본 라임 병원 체 (그림 2)에 대 한 감시 기준을 만났다. By contrast, T923 OspA, 결과는 여러 가지 이유가 있다에 대 한 긍정적인만 했다: A) 원래 틱 보렐 리아에 대 한 부정적인 했지만 외부 또는 내부 OspA PCR 준비 가짜로 오염 된 서식 파일 DNA (참고 시 약의 전신 오염 부정적인 컨트롤을 통해 밖으로 지배 되었다), B) 진드기 수행 라임 보렐 리아, 하지만 낮은 템플릿 금액 또는 실험 오류 방지 FlaB또는 C의 증폭) 유기 체는 그 보존된 OspA 시퀀스를 포함 하지만 Flagellin 부족 또는 뇌관을 anneal 하 FlaB 의 대상된 지역에서 부족 정체성을 했다. 실제로, OspA 시퀀스 유사 생물, 식물 및 동물28등의 다양 한 지적 되었습니다. 대화 상황, 더 증폭 Flagellin 유전자, 하지만 하지 OspA 유전자 보존, 관련된 보렐 리아 종족을 나타낼 수 있습니다. 실제로,이 프로토콜 FlaB 뇌관, 시나리오 'A'가 가장 가능성이 설명 제안 하는 것 보다 더 많은 OspA 단일 긍정적인 결과 생성 합니다. 그러나 논쟁 적인 견본의 추가 실험 분석, 없이, 아니다 단일 긍정적인 결과의 소스를 확인할 수 없습니다. 가짜로 이전 반응에 도입 된 어떤 오염 물질 보관 된 DNA에 존재 하지 않을 것 이다 이후 그들의 진정한 상태를 조정 하 모호 샘플에 수행 하는 기술 복제의 수를 증가 도움이 됩니다. 그러나, 이러한 뇌관으로 후속 반응 결정적인 결과 제공 하지, 다른 Borrelia loci PCR에 의해 조사 될 수 있습니다. 이 반응에서 생성 된 Amplicons 또한 시퀀싱 하 고 격리 id를 할당 하 고 스트레인 분기의 정도 추정 하 중 비교 수 있습니다. Sapi와 동료 인간의 임상 샘플35를 사용 하 여이 워크플로의 예를 제공 합니다.
모든 요인을 고려, 개요 프로토콜 및 해석 조건을 각각 0.0063%와 0.17%의 거짓 긍정과 거짓 부정적인 요금을 생성 견적 되었다.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56471/56471fig2.jpg"> 그림 2 :의 보렐 리아 burgdorferi nPCR의 의해 개별 틱 군살 그리고 OspA. 각 눈금에 할당 된 코드는 젤의 위쪽에 표시 되 고 정체성 각 표본에서 OspA FlaB 의 탐지를 보고 맞춤. 레인 (오른쪽 차선)는 실험실 환경 오염을 잡으려고 졸 컨트롤 이미지 대표 노-템플릿 컨트롤의 왼쪽에서 B를 받을 수 있습니다. <a href="//cloudflare.jove.com/files/ftp_upload/56471/56471fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR at JoVE.com

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

중첩 된 PCR 틱 보렐 리아 burgdorferi, Lyme 질병의 원인이 되는 에이전트에 대 한 조사를 DNA 추출에 적용 될 수 있는 민감한, 특정, 그리고 간단한 기술입니다. 초기 PCR 실험 유전자 특정 뇌관을 사용 하 여 내부 뇌관을 사용 하 여 후속 반응에 대 한 템플릿 되 긴 amplicons 생성.

중첩된 한 PCR를 사용 하 여 틱에서 라임 질병 스피로, 보렐 리아 Burgdorferi, 감지

Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to ...

detecting-lyme-disease-spirochete-borrelia-burgdorferi-ticks-using

Research

JoVE Journal

Biology

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

18.0K 조회수.  Mount Allison University. 중첩 된 PCR 틱 보렐 리아 burgdorferi, Lyme 질병의 원인이 되는 에이전트에 대 한 조사를 DNA 추출에 적용 될 수 있는 민감한, 특정, 그리고 간단한 기술입니다. 초기 PCR 실험 유전자 특정 뇌관을 사용 하 여 내부 뇌관을 사용 하 여 후속 반응에 대 한 템플릿 되 긴 amplicons 생성.

비디오: Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Methods for Rapid Transfer and Localization of Lyme Disease Pathogens Within the Tick Gut

Lyme disease is caused by infection with the spirochete pathogen Borrelia burgdorferi, which is maintained in nature by a tick-rodent infection cycle 1. A tick-borne murine model 2 has been developed to study Lyme disease in the laboratory. While na&iacute;ve ticks can be infected with B. burgdorferi by feeding them on infected mice, the molting process takes several weeks to months to complete. Therefore, development of more rapid and efficient tick infection techniques, such as a microinjection-based procedure, is an important tool for the study of Lyme disease 3,4. The procedure requires only hours to generate infected ticks and allows control over the delivery of equal quantities of spirochetes in a cohort of ticks. This is particularly important as the generation of B. burgdorferi infected ticks by the natural feeding process using mice fails to ensure 100% infection rate and potentially results in variation of pathogen burden amongst fed ticks. Furthermore, microinjection can be used to infect ticks with B. burgdorferi isolates in cases where an attenuated strain is unable to establish infection in mice and thus can not be naturally acquired by ticks 5. This technique can also be used to deliver a variety of other biological materials into ticks, for example, specific antibodies or double stranded RNA 6. In this article, we will demonstrate the microinjection of nymphal ticks with in vitro-grown B. burgdorferi. We will also describe a method for localization of Lyme disease pathogens in the tick gut using confocal immunofluorescence microscopy.

Lyme disease research studies often require generation of ticks infected with the pathogen Borrelia burgdorferi, a process that typically takes several weeks. Here we demonstrate a microinjection-based tick infection procedure that can be accomplished within hours. We also demonstrate an immunofluorescence method for in situ localization of B. burgdorferi within ticks.

틱 굿 내에서 빠른 전송과 라임 질병 병원균의 현지화을위한 방법

Lyme disease is caused by infection with the spirochete pathogen Borrelia burgdorferi, which is maintained in nature by a tick-rodent infection cycle 1.  ...

연구

면역학 및 감염병학

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Here, we present a protocol to spatially and temporally assess the presence of viable microbiota in tick guts using a modified whole-mount in situ hybridization approach.

제자리에 전체 산 교 잡에 의해 틱 용기에 Microbiota의 시각화

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these ...

유전학

Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription polymerase chain reaction (nested RT-PCR) was developed to detect the conserved region of the nucleoprotein (N) gene of lyssaviruses. The method applies reverse transcription (RT) using viral RNA as template and oligo (dT)15 and random hexamers as primers to synthesize the viral complementary DNA (cDNA). Then, the viral cDNA is used as a template to amplify an 845 bp N gene fragment in first-round PCR using outer primers, followed by second-round nested PCR to amplify the final 371 bp fragment using inner primers. This method can detect different genetic clades of rabies viruses (RABV). The validation, using 9,624 brain specimens from eight domestic animal species in 10 years of clinical rabies diagnoses and surveillance in China, showed that the method has 100% sensitivity and 99.97% specificity in comparison with the direct fluorescent antibody test (FAT), the gold standard method recommended by the World Health Organization (WHO) and the World Organization for Animal Health (OIE). In addition, the method could also specifically amplify the targeted N gene fragment of 15 other approved and two novel lyssavirus species in the 10th Report of the International Committee on Taxonomy of Viruses (ICTV) as evaluated by a mimic detection of synthesized N gene plasmids of all lyssaviruses. The method provides a convenient alternative to FAT for rabies diagnosis and has been approved as a National Standard (GB/T36789-2018) of China.

A pan-lyssavirus nested reverse transcription polymerase chain reaction has been developed to detect specifically all known lyssaviruses. Validation using rabies brain samples of different animal species showed that this method has a sensitivity and specificity equivalent to the gold standard fluorescent antibody test and could be used for routine rabies diagnosis.

Lyssaviruses 검출을 위한 보편적 중첩 역방향 전사 중 합 효소 연쇄 반응의 평가

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription ...

Feeding of Ticks on Animals for Transmission and Xenodiagnosis in Lyme Disease Research

Transmission of the etiologic agent of Lyme disease, Borrelia burgdorferi, occurs by the attachment and blood feeding of Ixodes species ticks on mammalian hosts. In nature, this zoonotic bacterial pathogen may use a variety of reservoir hosts, but the white-footed mouse (Peromyscus leucopus) is the primary reservoir for larval and nymphal ticks in North America. Humans are incidental hosts most frequently infected with B. burgdorferi by the bite of ticks in the nymphal stage. B. burgdorferi adapts to its hosts throughout the enzootic cycle, so the ability to explore the functions of these spirochetes and their effects on mammalian hosts requires the use of tick feeding. In addition, the technique of xenodiagnosis (using the natural vector for detection and recovery of an infectious agent) has been useful in studies of cryptic infection. In order to obtain nymphal ticks that harbor B. burgdorferi, ticks are fed live spirochetes in culture through capillary tubes. Two animal models, mice and nonhuman primates, are most commonly used for Lyme disease studies involving tick feeding. We demonstrate the methods by which these ticks can be fed upon, and recovered from animals for either infection or xenodiagnosis.

Lyme disease is the most commonly-reported vector-borne disease in North America. The causative agent, Borrelia burgdorferi is a spirochete bacterium transmitted by Ixodid ticks. Transmission and detection of infection in animal models is optimized by the use of tick feeding, which we describe here.

라임 병 연구의 변속기 및 Xenodiagnosis에 대한 동물에 진드기의 먹이

Transmission of the etiologic agent of Lyme disease, Borrelia burgdorferi, occurs by the  attachment and blood feeding of Ixodes species ticks on ...

Essential Components of Borreliella (Borrelia) burgdorferi In Vitro Transcription Assays

Borreliella burgdorferi is a bacterial pathogen with limited metabolic and genomic repertoires. B. burgdorferi transits extracellularly between vertebrates and ticks and dramatically remodels its transcriptional profile to survive in disparate environments during infection. A focus of B. burgdorferi studies is to clearly understand how the bacteria responds to its environment through transcriptional changes. In vitro transcription assays allow for the basic mechanisms of transcriptional regulation to be biochemically dissected. Here, we present a detailed protocol describing B. burgdorferi RNA polymerase purification and storage, sigma factor purification, DNA template generation, and in vitro transcription assays. The protocol describes the use of RNA polymerase purified from B. burgdorferi 5A4 RpoC-His (5A4-RpoC). 5A4-RpoC is a previously published strain harboring a 10XHis-tag on the rpoC gene encoding the largest subunit of the RNA polymerase. In vitro transcription assays consist of the RNA polymerase purified from strain 5A4-RpoC, a recombinant version of the housekeeping sigma factor RpoD, and a PCR-generated double-stranded DNA template. While the protein purification techniques and approaches to assembling in vitro transcription assays are conceptually well understood and relatively common, handling considerations for RNA polymerases often differ from organism to organism. The protocol presented here is designed for enzymatic studies on the B. burgdorferi RNA polymerase. The method can be adapted to test the role of transcription factors, promoters, and post-translational modifications on the activity of the RNA polymerase.

Essential Components of Borreliella Borrelia burgdorferi In Vitro Transcription Assays

In vitro transcription assays can decipher the mechanisms of transcriptional regulation in Borreliella burgdorferi. This protocol describes the steps to purify B. burgdorferi RNA polymerase and perform in vitro transcription reactions. Experimental approaches using in vitro transcription assays require reliable purification and storage of active RNA polymerase.

Borreliella (Borrelia) burgdorferi의 필수 성분 In Vitro Transcription Assays

Borreliella burgdorferi is a bacterial pathogen with limited metabolic and genomic repertoires. B. burgdorferi transits extracellularly between ...

Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

Introducing foreign DNA into the spirochete Borrelia burgdorferi has been almost exclusively accomplished by transformation using electroporation. This process has notably lower efficiencies in the Lyme disease spirochete relative to other, better-characterized Gram-negative bacteria. The rate of success of transformation is highly dependent upon having concentrated amounts of high-quality DNA from specific backgrounds and is subject to significant strain-to-strain variability. Alternative means for introducing foreign DNA (i.e., shuttle vectors, fluorescent reporters, and antibiotic-resistance markers) into B. burgdorferi could be an important addition to the armamentarium of useful tools for the genetic manipulation of the Lyme disease spirochete. Bacteriophage have been well-recognized as natural mechanisms for the movement of DNA among bacteria in a process called transduction. In this study, a method has been developed for using the ubiquitous borrelial phage &#966;BB-1 to transduce DNA between B. burgdorferi cells of both the same and different genetic backgrounds. The transduced DNA includes both borrelial DNA and heterologous DNA in the form of small shuttle vectors. This demonstration suggests a potential use of phage-mediated transduction as a complement to electroporation for the genetic manipulation of the Lyme disease spirochete. This report describes methods for the induction and purification of phage &#966;BB-1 from B. burgdorferi, the use of this phage in transduction assays, and the selection and screening of potential transductants.

Phage-Mediated Genetic Manipulation of the Lyme Disease Spirochete Borrelia burgdorferi

The ability of bacteriophage to move DNA between bacterial cells makes them effective tools for the genetic manipulation of their bacterial hosts. Presented here is a methodology for inducing, recovering, and using &#966;BB-1, a bacteriophage of Borrelia burgdorferi, to transduce heterologous DNA between different strains of the Lyme disease spirochete.

라임병 스피로체테 보렐리아 부르그도르페리의 파지 매개 유전자 조작

Introducing foreign DNA into the spirochete Borrelia burgdorferi has been almost exclusively accomplished by transformation using electroporation. This ...

혈청 내 Borrelia 특이적 IgG 및 IgM에 대한 다중 면역분석

Simultaneous Detection of Different Antibody Classes in a Multiplexed Serological Test

To monitor the progression of infectious diseases, it is useful to assess immunoreactivity against various antigenic determinants, and measure different antibody isotypes because they appear at different stages of the host immune response. With Lyme borreliosis, the pathogenic agent can be one of the multiple members of the Borrelia species. Therefore, correct sample classification requires evaluating the immunoreactivity against different antigens of different Borrelia species. Additionally, anti-pathogen IgG and IgM responses can have different elicitation time courses during disease progression. Here we demonstrate the development of a two-reporter multiplex immunoassay that has utility in identifying Borrelia-specific immune response in human serum samples by simultaneously evaluating both IgG and IgM immunoreactivity against different bacterial antigens in the same reaction well. This dual-reporter approach retains the analytical performance of single-reporter methods while conserving time and resources and reducing sample size requirements. This assay allows essentially double the serological information to be generated from a blood sample in half the time.

저자 스포트라이트: Extending the Scope of Multiplex Immunoassay for Lyme Borreliosis Diagnostics and Pathogen Research (라임 보렐리오증 진단 및 병원체 연구를 위한 멀티플렉스 면역분석의 범위 확장) 

A three-channel dual-reporter fluorescence flow analysis system was used to develop a bead-based multiplex immunoassay that simultaneously evaluates serum samples for IgG and IgM elicited against multiple antigens of different Borrelia species that cause Lyme borreliosis in Europe and North America.

다중 혈청학적 검사에서 다양한 항체 등급의 동시 검출

To monitor the progression of infectious diseases, it is useful to assess immunoreactivity against various antigenic determinants, and measure different ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective and widely available vaccines are lacking for a majority of these diseases, necessitating the development of novel disease mitigation strategies. To this end, a promising avenue of disease control involves targeting the vector microbiome, the community of microbes inhabiting the vector. The vector microbiome plays a pivotal role in pathogen dynamics, and manipulations of the microbiome have led to reduced vector abundance or pathogen transmission for a handful of vector-borne diseases. However, translating these findings into disease control applications requires a thorough understanding of vector microbial ecology, historically limited by insufficient technology in this field. The advent of next-generation sequencing approaches has enabled rapid, highly parallel sequencing of diverse microbial communities. Targeting the highly-conserved 16S rRNA gene has facilitated characterizations of microbes present within vectors under varying ecological and experimental conditions. This technique involves amplification of the 16S rRNA gene, sample barcoding via PCR, loading samples onto a flow cell for sequencing, and bioinformatics approaches to match sequence data with phylogenetic information. Species or genus-level identification for a high number of replicates can typically be achieved through this approach, thus circumventing challenges of low detection, resolution, and output from traditional culturing, microscopy, or histological staining techniques. Therefore, this method is well-suited for characterizing vector microbes under diverse conditions but cannot currently provide information on microbial function, location within the vector, or response to antibiotic treatment. Overall, 16S next-generation sequencing is a powerful technique for better understanding the identity and role of vector microbes in disease dynamics.

Here we present a next-generation sequencing protocol for 16S rRNA sequencing which enables identification and characterization of microbial communities within vectors. This method involves DNA extraction, amplification and barcoding of samples through PCR, sequencing on a flow-cell, and bioinformatics to match sequence data to phylogenetic information.

다음-세대 16S rRNA Amplicon 시퀀싱에 의해 틱 미생물 특성

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...

중첩된 한 PCR를 사용 하 여 틱에서 라임 질병 스피로, 보렐 리아 Burgdorferi, 감지

요약

더 많은 비디오 탐색

틱 굿 내에서 빠른 전송과 라임 질병 병원균의 현지화을위한 방법

제자리에 전체 산 교 잡에 의해 틱 용기에 Microbiota의 시각화

Lyssaviruses 검출을 위한 보편적 중첩 역방향 전사 중 합 효소 연쇄 반응의 평가

라임 병 연구의 변속기 및 Xenodiagnosis에 대한 동물에 진드기의 먹이

Borreliella (Borrelia) burgdorferi의 필수 성분 In Vitro Transcription Assays

라임병 스피로체테 보렐리아 부르그도르페리의 파지 매개 유전자 조작

다중 혈청학적 검사에서 다양한 항체 등급의 동시 검출

다중 혈청학적 검사에서 다양한 항체 등급의 동시 검출

다중 혈청학적 검사에서 다양한 항체 등급의 동시 검출

다음-세대 16S rRNA Amplicon 시퀀싱에 의해 틱 미생물 특성