עבודה זו נתמכה על ידי מענקי R01DE018138 מהמכונים הלאומיים לבריאות (PX), ובחלקו, על ידי תכנית אוניברסיטת וירג&#39;יניה הנשיאותית מחקר תמריץ (PRIP) 144602-3 (PX). אנו מודים לבני זוג. ליי חן, Yuetan Dou וXiaojing ואנג לסיוע בבנייה של מוטציות רחבות הגנום. אנו מודים גם למתקן ליבת ה-DNA באוניברסיטת וירג&#39;יניה לרצפי DNA.

1. עיצוב פריימר <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Primers תוכנן באמצעות תסריטים בבית המבוסס על ס רצף הגנום sanguinis SK36. שלושה זוגות של פריימרים, F1/R1, F2/R2, וF3/R3 מיועדים להגברה של רצף 1-kb במעלה הזרם של גן המטרה, התנגדות APHA-3 גן קידוד kanamycin (הק&quot;מ R) החלבון 3 ו 1 -KB רצף במורד זרם של גן המטרה, בהתאמה (איור 1). בין פריימרים אלה, F1 ו R3 תוכננו באמצעות ePrimer3 בסוויטת הבלטה של תוכניות <a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">(http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html)</a> כדי להגביר אזורי איגוף מעלה זרם או במורד זרם של היעד גן. פריימרים הגן ספציפיים, R1 וF3, נועדו מבוססים על רצפים של גן היעד 5 &#39;3 ו&#39;. פריימרים R1 וF3 מכילים רצפי מתאם 25-BP בסוף 5 &#39;שלהם שמשלימים לAPHA-3גן. את טמפרטורת ההיתוך של כל צבע יסוד נועדה להיות קרוב ככל האפשר עד 60 ° C כדי לאפשר שימוש במדי חישול טמפרטורה לכל תגובות PCR בפורמט 96-כן. </li><li style=";text-align:right;direction:rtl"> F1, R1, F3 ופריימרים R3 מסונתזים בצלחות 96-כן בהתבסס על מנת גנים. כל צלחת מכילה סוג אחד של פריימרים באותו סדר הגן. לדלל את האלפונים ב96-גם צלחת פריימר פועל לריכוז סופי של 10 מיקרומטר להגברת PCR באמצעות פיפטה רבה ערוצים. </li></ol> 2. הגברת תפוקה גבוהה PCR וטיהור <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כדי להגביר את התפוקה גבוהה 1-kb מעלה זרם או במורד זרם של היעד ס גני sanguinis, להרכיב תערובת קוקטייל PCR על קרח בצינור חרוטים 15-מ&quot;ל מכיל 1640 DDH 2 O μl, פידליטי 10xHigh μl PCR מאגר 250, 200 μl של תערובת 10 mM dNTP, 100 μl של 50 מ&quot;מ MgSO 4, 100 μl של 10 ng / μl ס הדנ&quot;א הגנומי sanguinis SK36 וμl פלטינום תקי DNA polyme 10rase איכות גבוהה והעברה 23 μl של התערובת לתוך כל באר על 96-גם צלחת PCR באמצעות פיפטה רבה ערוצים. העברת μl 1 מתוך כל F1 וR1 (או F3 ו R3) מתוך 10 מיקרומטר עבודת צלחות פריימר לצלחת PCR באמצעות פיפטה רבה ערוצים. לאטום את צלחת PCR ולבצע הגברה ב 94 מעלות צלזיוס במשך 1 דקות, ו 30 מחזורים של 94 מעלות צלזיוס למשך 30 שניות, 54 מעלות צלזיוס למשך 30 שניות ו 68 מעלות צלזיוס במשך 1.5 דקות. </li><li style=";text-align:right;direction:rtl"> הכן 1% agarose ג&#39;ל המכיל רומיד ethidium עם טעינת 48 בארות הולמת רב ​​פיפטה. מערבבי 4 מוצר PCR μl μl עם 1 של חיץ טעינת 5xDNA בצלחת 96-היטב ולטעון את הדגימות על agarose ג&#39;ל באמצעות פיפטה רב 10-μl. הפעל אלקטרופורזה ב135 V למשך 30 דקות. בדוק את הלהקה בג&#39;ל תחת מערכת ניתוח ותיעוד UVP. </li><li style=";text-align:right;direction:rtl"> לטהר את מוצרי ה-PCR על ידי ערכת PureLink 96 PCR טיהור באמצעות צנטריפוגה פי ההוראות של היצרן. למשחררי DNA, להוסיף 40 μl סטרילי DDH 2 O אל באר בinding צלחת. </li><li style=";text-align:right;direction:rtl"> באופן אקראי לקחת כמה amplicons מטוהר על הצלחת לבחון את ריכוזי DNA באמצעות ספקטרופוטומטר NanoDrop. התאם את הריכוז של amplicons על צלחת ל~ 10 ng / μl. </li><li style=";text-align:right;direction:rtl"> קלטת r פלסמיד המכיל ק&quot;מ מתעכלת באמצעות EcoR כתבנית PCR. הפלסמיד מעוכל מטוהר על ידי ערכת טיהור PCR QIAquick וDNA פלסמיד לינארי מותאם לריכוז ה-DNA סופי 10 ng / μl. להרכיב תערובת μl 25 לamplicon קלטת r הק&quot;מ כולל 16.4 DDH 2 O μl, פידליטי 10xHigh μl PCR מאגר 2.5, 2 μl של תערובת 10 mM dNTP, μl 1 מתוך Mg 50 מ&quot;מימ SO 4, μl 1 מתוך 10 מיקרומטר F2, μl 1 מתוך 10 מיקרומטר R2, ה-DNA 1 μl יניארי פלסמיד ונאמנות 0.1 μl פלטינום תקי פולימראז ה-DNA גבוהה. בצע הגברת PCR ב 94 מעלות צלזיוס במשך 1 דקות, ו 30 מחזורים של 94 מעלות צלזיוס למשך 30 שניות, 55 מעלות צלזיוס למשך 30 שניות ו 68 מעלות צלזיוס במשך דקות 1. בדוק את מוצר PCR ידי אלקטרופורזה ג&#39;ל על 1% agarose. פותפזורת של la amplicon הק&quot;מ r הקלטת מ 10 פרט PCR מטוהר על ידי ערכת טיהור PCR QIAquick. התאם את ריכוז amplicon עד 10 ng / μl. </li><li style=";text-align:right;direction:rtl"> כדי להשיג את amplicon PCR רקומביננטי הסופי ליניארי, שלוש amplicons PCR בשילוב עם כל μl 1 (בכמויות כמעט שווה-טוחן) בצלחת אחת PCR גם תבנית ה-PCR. רכיבי PCR אחרים מתווספים כולל 14.4 DDH 2 O μl, פידליטי 10xHigh μl PCR מאגר 2.5, 2 μl של תערובת 10 mM dNTP, μl 1 מתוך Mg 50 מ&quot;מימ SO 4, μl 1 מתוך 10 מיקרומטר F1, μl 1 מתוך 10 מיקרומטר R3, האיכות גבוהה 0.1 μl פלטינום תקי DNA פולימרז. הגברת PCR מתבצעת ב 94 מעלות צלזיוס למשך 2 דקות, 30 מחזורים של 94 מעלות צלזיוס למשך 30 שניות 55 מעלות צלזיוס למשך 30 שניות ו 68 מעלות צלזיוס במשך 3.5 דקות, ובסופו 68 המעלות צלזיוס במשך 4 דקות. </li><li style=";text-align:right;direction:rtl"> בחן PCR amplicons על agarose ג&#39;ל. לטהר ולכמת את amplicons PCR כפי שתואר לעיל. הקפא את amplicons PCR מורכב ב -20 ° C. </li></ol> 3. Comהכנת תאים petent <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> טוד יואיט המרק מוכן, חומציות מותאמת לשימוש 10 7.6 N NaOH, מחומם לרתיחה ולאחר מכן מקוררת לטמפרטורת חדר ועיקור באמצעות קלקר 0.22 מיקרומטר סינון 4. הוסף 300 סוס סרום μl חום מומת (ריכוז סופי של 2.5%) עד 11.7 מ&quot;ל טוד יואיט מרק בצינור חרוטים 15-מ&quot;ל כדי לפצות TH + בינוני HS. TH aliquot + HS הבינונית ל2 מ&quot;ל ו 10 מ&quot;ל בצינורות. </li><li style=";text-align:right;direction:rtl"> לחסן 5 μl של המנייה ס sanguinis SK36 קפוא ב -80 ° C לTH + בינוני 2 מ&quot;ל HS ודגירת תרבות הלילה עם המכסה בחוזקה על 37 מעלות צלזיוס, בליווי דוגר מראש 10 מ&quot;ל-TH + צינור HS. </li><li style=";text-align:right;direction:rtl"> אחרי הלילה, להעביר תרבות μl 50 לתוך 10 המ&quot;ל TH + HS ודגירת הצינור ב 37 מעלות צלזיוס במשך 3 שעות (מקביל לOD 660 של 0.07-0.08), תוך שימוש באופן מיידי לשינוי. </li></ol> 4. שינוי תא ובחירת אנטיביוטיקה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף 2 μl של 70 ng ס sanguinis SK36 compeפפטיד tence מגרה (CSP) וμl יניארי רקומביננטי PCR amplicon 2 (~ 50 ng) לאפנדורף צינורות על 96-גם בלוק ומראש החם ב 37 ° C. העברת 330 μl של 3 SK36 תרבות HR-מודגרות לכל צינור. לדגור על 37 מעלות צלזיוס במשך שעה 1. החלף DNA עם DDH 2 O סטרילית כשליטה. </li><li style=";text-align:right;direction:rtl"> הנח את הבלוק על קרח והתפשט 100 μl של כל שינוי על צלחת אגרה עירוי לב מוח (BHI) עם 500 מיקרוגרם / המ&quot;ל kanamycin. דגירת הצלחות על 37 מעלות צלזיוס למשך 2 ד בתנאי microaerobic. </li></ol> 5. אישור ואחסון מוטציה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> עבור כל מוטצית החלפה, באופן אקראי להרים 2 מושבות בודדות, לחסן את המושבה ל5 המ&quot;ל מכיל 500 מיקרוגרם BHI / kanamycin מ&quot;ל ודגירת בידוד microaerobically לילה בשעת 37 ° C. Cryopreserve כל תרבות בגליצרול 30% ב-80 ° C </li><li style=";text-align:right;direction:rtl"> כדי לבחון האם מכיל את החלפת גן המוטנטי הצפוי, לבצע מושבה PCR לכל F1 באמצעות מוטציה וR3אלפונים ב96-PCR גם צלחת. על תרבות הלילה 1-μl ממושבה בודדה משמשת כתבנית ה-DNA בתגובת 25-μl PCR הגברה. PCR מתבצע ב 94 מעלות צלזיוס למשך 5 דקות, 35 מחזורים של 94 מעלות צלזיוס למשך 30 שניות, 55 מעלות צלזיוס למשך 30 שניות ו 68 מעלות צלזיוס במשך 3.5 דקות, ובסופו 68 המעלות צלזיוס במשך 4 דקות. </li><li style=";text-align:right;direction:rtl"> לזהות במדויק מוטנטים-band הכפול או amplicon PCR המזהם, לבחון amplicon PCR ידי אלקטרופורזה במשך 4 שעות ב&gt; 12 סנטימטר ארוך 2% agarose ג&#39;ל עם כתמי רומיד ethidium. תחת תנאי אלקטרופורזה ג&#39;ל agarose זה, כל amplicons עם ≥ הבדל 100 נ&quot;ב באופן מובהק. כאשר להקות תוצאה מההגברה של קלטת r הק&quot;מ והגן פראי מהסוג צפויות לשינוי על פי &lt;100 נ&quot;ב, פריימר T1 הפנימי משמש כדי לקבוע האם גן פראי מסוג יכול להיות מזוהה על ידי PCR. </li><li style=";text-align:right;direction:rtl"> על מנת להמשיך ולאשר את המחיקה, את amplicons מטוהר על ידי ערכת טיהור PureLink 96 PCR ורצף באמצעות פריימר P1 בינקשר לקלטת r הק&quot;מ. שמור רק מוטנטים נכונים אושרו על ידי רצף. </li></ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

אין ניגודי האינטרסים הכריזו.

כדי למזער את ההשפעות האפשריות של קוטב החלפת הגן ממוקד אחד עם אנטיביוטיקת גן אקסוגני בגנים סמוכים, שני צעדים נלקחים תוך פריימר הראשוני בעיצוב. עבור רוב הגנים שנמחקו, פריימרים R1 ו F3 נועדו למחוק את אזור קידוד מ6 נ&quot;ב לאחר קודון התחילה ועד 30 נ&quot;ב לפני קודון העצירה. את 30 ז...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; שמות</strong</td&gt;<td<strong&gt; חברה</strong</td&gt;<td<strong&gt; קטלוג #</strong</td&gt;<td<strong&gt; תגובות (אופציונלי)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; פריימר F2</td&gt;<td&gt; משולבות טכנולוגיות ה-DNA</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; R2 פריימר</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; פריימר F2P</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; P1 פריימר</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; P2 פריימר</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; פריימר 5 &#39;end_R1_seq</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; פריימר 5 &#39;end_F3_seq</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; פריימר 5 &#39;end_R1p_seq</td&gt;<td&gt; שם</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; רצף: NH2-DLRGVPNPWGWIFGR-COOH</td&gt;</tr&gt;<tr&gt;<td&gt; פולימראז ה-DNA</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; 11304-102</td&gt;<td&gt; פלטינום תקי פולימראז ה-DNA נאמנות גבוהה</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; ניו אינגלנד Biolabs Inc</td&gt;<td&gt; R0101S</td&gt;<td&gt; אנזים הגבלה</td&gt;</tr&gt;<tr&gt;<td&gt; אגר</td&gt;<td&gt; אמריקאי Bioanalytical</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Agarose</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 237500</td&gt;<td&gt; עירוי לב המוח</td&gt;</tr&gt;<tr&gt;<td&gt; סוס סרום</td&gt;<td&gt; הפישר סיינטיפיק</td&gt;<td&gt; SH3007403</td&gt;<td&gt; סוס סרום</td&gt;</tr&gt;<tr&gt;<td&gt; ק&quot;מ</td&gt;<td&gt; הפישר סיינטיפיק</td&gt;<td&gt; BP906-5</td&gt;<td&gt; Kanamycin</td&gt;</tr&gt;<tr&gt;<td&gt; TH מרק</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 249240</td&gt;<td&gt; טוד יואיט מרק</td&gt;</tr&gt;<tr&gt;<td&gt; PureLink 96</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; K310096</td&gt;<td&gt; PureLink 96 ערכת טיהור PCR</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; Qiagen</td&gt;<td&gt; 28106</td&gt;<td&gt; ערכת טיהור PCR QIAquick</td&gt;</tr&gt;<tr&gt;<td&gt; סינון</td&gt;<td&gt; קורנינג</td&gt;<td&gt; 431117</td&gt;<td&gt; מסנן קלקר מיקרומטר 0.22</td&gt;</tr&gt;<tr&gt;<td&gt; Anoxomat מערכת</td&gt;<td&gt; מארט מיקרוביולוגיה bv</td&gt;<td&gt; Anoxomat Mark II</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; צנטריפוגה Benchtop</td&gt;<td&gt; Thermo Scientific</td&gt;<td&gt; 75004377</td&gt;<td&gt; Sorvall מקרא RT פלוס microplate הרוטור</td&gt;</tr&gt;<tr&gt;<td&gt; תיעוד ג&#39;ל</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc-זה 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; חממה</td&gt;<td&gt; הפישר סיינטיפיק</td&gt;<td&gt; 11-690-625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; של Labnet ג&#39;ל XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; של Labnet ג&#39;ל XL</td&gt;</tr&gt;<tr&gt;<td&gt; Microcentrifuge</td&gt;<td&gt; אפנדורף</td&gt;<td&gt; 22621408</td&gt;<td&gt; 5415 R microcentrifuge</td&gt;</tr&gt;<tr&gt;<td&gt; Pipettes רב</td&gt;<td&gt; Thermo Scientfic</td&gt;<td&gt; 4661040, 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; Cycler תרמית</td&gt;<td&gt; יישומי BioSystems בע&quot;מ</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR מערכת 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon mutagenesis ומחיקה של גן היחיד הם שתי שיטות שיושמו בנוקאאוט גן גנום רחב ב1,2 חיידקים. למרות mutagenesis transposon הוא פחות זמן רב, יקר פחות, ואינו דורש מידע הגנום הושלם, יש שתי חולשות בשיטה זו: (1) האפשרות של מוטציות שונות בספריית המוטציה המעורבת שנגד בוחרת מוטנטים עם תחרות ירד; ו (2) האפשרות של איון גן החלקי לפיו גנים לא לגמרי מאבדת את תפקודם לאחר החדרת transposon. ניתוח מחיקה של הגן יחיד עשוי לפצות על חסרונות הקשורים mutagenesis transposon. כדי לשפר את היעילות של מחיקה הגנום בודדה גן, אנו מנסים להקים טכניקת תפוקה גבוהה למחיקת גן יחידה הגנום באמצעות sanguinis Streptococcus כאורגניזם מודל. כל מחיקת גן לבנות בס sanguinis הגנום נועד מהווה 1-KB זרם של הגן הממוקד, גן APHA-3, חלבון התנגדות kanamycin קידוד, או במורד 1-KB של הגן הממוקד. שלושה זוגות של פריימרים F1/R1, F2/R2, וF3/R3, בהתאמה, מתוכננים ומסונתזים בפורמט צלחת 96-גם ל- amplifications PCR של שלושה המרכיבים האלה של כל מחיקה להקים. Primers R1 ו F3 מכילים רצפי 25-BP שמשלימים לאזורים של-3 APHA הגן בקצה 5 &#39;שלהם. הגברת PCR קנה מידה גדולה של-3 APHA הגן מתבצעת פעם אחת ליצירה כל מבני המחיקה בגן בודד. האמרגן של גן APHA-3 בתחילה הוצא כדי למזער את ההשפעה הפוטנציאלית של קוטב קלטת kanamycin. כדי ליצור מבני מחיקת הגן, הגברת תפוקה גבוהה PCR וטיהור מבוצעות בפורמט צלחת 96-כן. Amplicon PCR רקומביננטי יניארית לכל מחיקת גן יהיה מורכב באמצעות ארבע תגובות PCR באמצעות DNA פולימראז באיכות גבוהה. Expon הראשונישלב הצמיחה ential של ס &#39; sanguinis תרבית בטוד יואיט מרק בתוספת 2.5% סרום סוס מומת משמש כדי להגדיל את היכולת של שינוי מבני PCR-רקומביננטי. תחת תנאי זה, עד 20% של ס &#39; תאי sanguinis ניתן להפוך באמצעות ~ 50 ng של DNA. בהתבסס על גישה זו, 2048 מוטנטים עם מחיקת גן יחיד סופו של דבר התקבלו מ2270 הגנים בס sanguinis למעט 4 ORFs גנים כלולים כולו בתוך ORFs האחר בס sanguinis SK36 ו218 גנים חיוניים פוטנציאליים. הטכניקה ביצירת מבני מחיקת גן היא תפוקה גבוהה ויכולה להיות קל לשימוש במחיקות גן יחידות הגנום לכל חיידקי transformable.

After PCR amplification using primers F1 and R1, and F3 and R3, approximately 1-kb upstream and downstream of each S. sanguinis gene were obtained in 96-well format, respectively (Figure 2A). Under our PCR conditions and using designed primers, a specific product was amplified from S. sanguinis genomic DNA in each PCR reaction. This result indicated the primers were highly specific to the targets of S. sanguinis. Through PCR re-amplification using primers F1 and R3 and t...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

שיטה יעילה הגנום בודדה גן מוטציה כבר נקבעה באמצעות<em&gt; סטרפטוקוקוס sanguinis</em&gt; כאורגניזם מודל. שיטה זו השיגה דרך PCRs גבוה התפוקה רקומביננטי ותמורות.

מחיקות Gene הגנום ב<em&gt; סטרפטוקוקוס sanguinis</em&gt; על ידי תפוקה הגבוהה PCR

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

16.4K Views.  Virginia Commonwealth University. שיטה יעילה הגנום בודדה גן מוטציה כבר נקבעה באמצעות סטרפטוקוקוס sanguinis כאורגניזם מודל. שיטה זו השיגה דרך PCRs גבוה התפוקה רקומביננטי ותמורות.

Video: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

הגנום כולו ניתוח באמצעות שבב זיהוי איזופורם ספציפי מטרות ג&#39;ין

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

הגנום כולו מסך עבור מטרות מירנה שימוש יעד המשימה ספריית מזהה

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. elegans, gene function can be knocked down simply and efficiently by feeding worms with bacteria expressing a dsRNA corresponding to a specific gene 1. While the creation of libraries of RNAi clones covering most of the C. elegans genome 2,3 opened the way for true functional genomic studies (see for example 4-7), most established methods are laborious. Moy and colleagues have developed semi-automated protocols that facilitate genome-wide screens 8. The approach relies on microscopic imaging and image analysis. 
	Here we describe an alternative protocol for a high-throughput genome-wide screen, based on robotic handling of bacterial RNAi clones, quantitative analysis using the COPAS Biosort (Union Biometrica (UBI)), and an integrated software: the MBioLIMS (Laboratory Information Management System from Modul-Bio) a technology that provides increased throughput for data management and sample tracking. The method allows screens to be conducted on solid medium plates. This is particularly important for some studies, such as those addressing host-pathogen interactions in C. elegans, since certain microbes do not efficiently infect worms in liquid culture.
	We show how the method can be used to quantify the importance of genes in anti-fungal innate immunity in C. elegans. In this case, the approach relies on the use of a transgenic strain carrying an epidermal infection-inducible fluorescent reporter gene, with GFP under the control of the promoter of the antimicrobial peptide gene nlp 29 and a red fluorescent reporter that is expressed constitutively in the epidermis. The latter provides an internal control for the functional integrity of the epidermis and nonspecific transgene silencing9. When control worms are infected by the fungus they fluoresce green. Knocking down by RNAi a gene required for nlp 29 expression results in diminished fluorescence after infection. Currently, this protocol allows more than 3,000 RNAi clones to be tested and analyzed per week, opening the possibility of screening the entire genome in less than 2 months.

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

We describe a protocol using C. elegans and RNAi feeding libraries that allows automated measurement of multiple parameters such as fluorescence, size and opacity of individual worms in a population. We give one example of a screen to identify genes involved in anti-fungal innate immunity in C. elegans.

כמותיים אוטומטי תפוקה גבוהה הגנום כולו RNAi המסכים ג elegans</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

תהליך המפלצת הירוקה לדור של זני שמרי נשיאת מחיקות Gene מרובות

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

אפיון תאי גזע עוברי האנושי על ידי הפרט כמותי RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often depend on its interactions with other proteins. Here, we describe a protocol for the yeast protein-fragment complementation assay (PCA), a powerful method to detect direct and proximal associations between proteins in living cells. The interaction between two proteins, each fused to a dihydrofolate reductase (DHFR) protein fragment, translates into growth of yeast strains in presence of the drug methotrexate (MTX). Differential fitness, resulting from different amounts of reconstituted DHFR enzyme, can be quantified on high-density colony arrays, allowing to differentiate interacting from non-interacting bait-prey pairs. The high-throughput protocol presented here is performed using a robotic platform that parallelizes mating of bait and prey strains carrying complementary DHFR-fragment fusion proteins and the survival assay on MTX. This protocol allows to systematically test for thousands of protein-protein interactions (PPIs) involving bait proteins of interest and offers several advantages over other PPI detection assays, including the study of proteins expressed from their endogenous promoters without the need for modifying protein localization and for the assembly of complex reporter constructs.

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

Proteins interact with each other and these interactions determine in a large part their functions. Protein interaction partners can be identified at high-throughput in vivo using a yeast fitness assay based on the dihydrofolate reductase protein-fragment complementation assay (DHFR-PCA).

הקרנת הגנום כל חלבונים אינטראקציה ידי חלבון-בר השלמה Assay (PCA) בתאים חיים

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

הקרנת תפוקה גבוהה עבור כימית מאפננים של גני Post-תעתיק מוסדר

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic chromosome, synIII1, and one synthetic chromosome arm, synIXR2, have been constructed and their in vivo function validated in the absence of the corresponding wild type chromosomes. An important design feature of Sc2.0 chromosomes is the introduction of PCRTags, which are short, re-coded sequences within open reading frames (ORFs) that enable differentiation of synthetic chromosomes from their wild type counterparts. PCRTag primers anneal selectively to either synthetic or wild type chromosomes and the presence/absence of each type of DNA can be tested using a simple PCR assay. The standard readout of the PCRTag assay is to assess presence/absence of amplicons by agarose gel electrophoresis. However, with an average PCRTag amplicon density of one per 1.5 kb and a genome size of ~12 Mb, the completed Sc2.0 genome will encode roughly 8,000 PCRTags. To improve throughput, we have developed a real time PCR-based detection assay for PCRTag genotyping that we call qPCRTag analysis. The workflow specifies 500 nl reactions in a 1,536 multiwell plate, allowing us to test up to 768 PCRTags with both synthetic and wild type primer pairs in a single experiment.

Designer chromosomes of the Synthetic Yeast Genome project, Sc2.0, can be distinguished from their native counterparts using a PCR-based genotyping assay called PCRTagging, which has a presence/absence endpoint. Here we describe a high-throughput real time PCR detection method for PCRTag genotyping.

qPCRTag ניתוח - תפוקה גבוהה, בזמן אמת PCR Assay עבור Genotyping Sc2.0

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

מיפוי הגנום של תרופות-DNA בתאי אינטראקציות עם COSMIC (Crosslinking של מולקולות קטנות לבודד הכרומטין)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID-seq: מיפוי הגנום של אינטראקציות החלבון-DNA על ידי תפוקה גבוהה רצף של קטעי DNA-מפוגל אדנין

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...