Questo lavoro è stato supportato dal Aeronautics and Space Administration West Virginia Spazio di Grant Consorzio Nazionale (NASA WVSGC), Cystic Fibrosis Foundation (CFF-YU11G0) e NIH P20RR016477 e P20GM103434 all&#39;idea Network West Virginia per la Ricerca Biomedica Eccellenza. Ringraziamo Vonya M. Eisinger per l&#39;assistenza tecnica con questo lavoro.

1. Preparazione di ceppi batterici e biparental Coniugazione <ol><li> Seminare E. coli SM10/λpir/pFAC in 5 ml di Luria Broth (LB), completata con 15 mg / ml di gentamicina e posto in un incubatore agitazione durante la notte a 37 ° C. </li><li> Seminare P. aeruginosa ceppo PAO1 in 5 ml di LB, e posto in un incubatore agitazione per una notte a 42 ° C. </li><li> Misurare OD 600 di culture durante la notte e mescolare quantità uguali di PAO1 ed E. coli pFAC tale che il volume finale è compreso tra 1-1,4 ml. </li><li> Miscela centrifugare a 6000 xg per 5 min. </li><li> Nel frattempo, asciugare piastre LB per la coniugazione: lasciare aperte le piastre in termostato a 37 ° C per 10-15 minuti. </li><li> Rimuovere tutti ma 50 ml di surnatante dalla miscela di cellule. </li><li> Risospendere il pellet di cellule nei rimanenti 50 ml di surnatante e pipetta su una piastra LB secco in una gocciolina compatto. </li><li> Posizionare con cautela la piastra in una cappa aspirante a secco (IMPONella documentazione, Nota: Non lasciare che le cellule si sviluppa su piastra, questo diminuiranno in modo significativo l&#39;efficienza del coniugazione). </li><li> Una volta che la goccia è asciutto, capovolgere la piastra LB e incubare a 37 ° C per 4-6 ore. </li><li> Mentre la miscela cella è in incubazione, preparare grandi (150 OD x 15 mm), piastre PIA con 300 mg / ml di gentamicina. Prima dell&#39;uso, rimuovere l&#39;umidità residua ponendo in un incubatore a 37 ° C per 15-20 min. </li><li> Dopo l&#39;incubazione della miscela di cellule è completa, raccogliere le cellule utilizzando un&#39;ansa sterile inoculazione e in una provetta contenente 1 ml di LB e vortice, o pipetta, fino a completa dissoluzione. </li><li> Stendere le cellule in modo uniforme sulle grandi tavole PIA contengono 300 mg / ml di gentamicina. (IMPORTANTE: Per questo passaggio, è meglio aggiungere crescenti volumi della miscela di cellule per separare le piastre (ad es Tavola 1: 10 ml, Piatto 2: 50 microlitri, Tavola 3: 100 ml, Tavola 4: 500 microlitri, ecc) . </li><li> Incubare una notte a 37° C. </li></ol> 2. Rilevazione e isolamento delle colonie mucoidi <ol><li> Rimuovere le piastre da incubatrice ed esaminare per le colonie mucoidi. </li><li> Isolare una singola colonia mucoide e strisciare per l&#39;isolamento su piccoli piatti (100 OD x 10 mm) con PIA e 300 pg / ml di gentamicina. </li><li> Incubare una notte a 37 ° C. </li><li> Ripetere passo 2.2 sulla precedente cultura durante la notte. </li><li> Ripetere i passaggi 2,2-2,4 altre due volte per determinare la stabilità dell&#39;isolato mucoide. </li><li> Al termine del passo isolare finale, inoculare 4,5 ml di LB con una singola colonia mucoide e incubare in shaker notte a 37 ° C. </li><li> Il giorno dopo, etichetta 3 tubi microcentrifuga per ogni mutante mucoide. </li><li> Preparare due 1,25 ml aliquote di cultura durante la notte in 2 tubi per l&#39;estrazione del DNA genomico e identificazione del sito di inserzione del trasposone (vedi protocollo 3). </li><li> Inoltre, archiviare ogni mutante mucoid pipettando 1 ml di coltura durante la notte in un NECESSARIOely esageratamente marcato contenenti un volume uguale di latte scremato 10%. Conservare a -86 ° C. </li></ol> 3. gDNA restrizione Digestione e legatura <ol><li> Estrarre gDNA dal mutante mucoide utilizzando qualsiasi metodo preferito (ad es. Fenolo-cloroformio, colonnine, ecc). </li><li> Determinare la concentrazione della gDNA, digerire un totale di 2 mg con 1 ml di endonucleasi di restrizione SalI, 0,5 ml di albumina di siero bovino, 5 microlitri di tampone SalI enzima (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl 2 , 1 Dithiothrietol mM (DTT), pH 7,9 a temperatura ambiente), e il volume appropriato di dH 2 O per ottenere un volume totale di 50 microlitri. </li><li> Digerire il DNA notte a 37 ° C. (IMPORTANTE:. Funzione dell&#39;efficienza dell&#39;enzima di restrizione, può essere necessario aggiungere un ulteriore 1 microlitri al pernottamento digest e incubare a 37 ° C per 1-2 ore Questo è in aggiunta al pernottamento digest.) </li><li> Purificare il DigeDNA STED utilizzando qualsiasi metodo preferito (ad esempio agarosio purificazione gel, colonne di rotazione) ed eluire con 25 microlitri di tampone. </li><li> Legare il DNA digerito miscelando 11 ml di DNA purificato con una concentrazione preferita di ~ 10-20 ng / ml, 1,5 ml di tampone di ligazione (330 mM Tris-acetato pH 7,5, 660 mM acetato di potassio, 100 mM di acetato di magnesio, 5 mM DTT), 1,5 ml di 100 mM ATP e 1 ml DNA ligasi. </li><li> Incubare la miscela per 15 minuti a temperatura ambiente, e quindi inattivare l&#39;enzima incubando per 15 min a 70 ° C. (Nota: L&#39;incubazione la miscela a temperatura ambiente per più può aumentare il successo della legatura). </li></ol> 4. PCR inversa (IPCR) e analisi di sequenza <ol><li> Eseguire IPCR sul prodotto legatura utilizzando il seguente forward e reverse primer e le condizioni di ciclo termico: -Forward Primer (Gm3OUT): GGGCATACGGGAAGAAGTGA -Reverse Primer (Gm5OUT): GACTGCCCTGCTGCGTAACA Thermocycler Condizioni: 1. 94 ° C per 1 min. 2. 94 ° C per 1 min. 3. 58 ° C per 2 min. 4. 72 ° C per 2 min. 5. 72 ° C per 8 min. 6. 10 ° C attesa. Ripetere i passaggi 2-4 per 34 cicli. (NOTA: prodotti Amplified IPCR possono essere conservati a 4 ° C.) </li><li> Eseguire gel elettroforesi per confermare il successo di amplificazione IPCR. </li><li> Eseguire il sequenziamento del prodotto IPCR utilizzando i primer Gm3OUT e Gm5OUT. Il sito di inserzione e l&#39;orientamento di himar1 vengono mappate. </li></ol>

<ol>
	<li>Govan, J. R., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+pathogenesis+in+cystic+fibrosis:+mucoid+Pseudomonas+aeruginosa+and+Burkholderia+cepacia.">Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.</a> Microbiol. Rev. 60, 539-574 (1996).</li><li>Chitnis, C. E., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+the+alginate+biosynthetic+gene+cluster+of+Pseudomonas+aeruginosa+shows+evidence+of+an+operonic+structure.">Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure.</a> Mol. Microbiol. 8, 583-593 (1993).</li><li>Franklin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+AlgG+is+a+polymer+level+alginate+C5-mannuronan+epimerase.">Pseudomonas aeruginosa AlgG is a polymer level alginate C5-mannuronan epimerase.</a> J. Bacteriol. 176, 1821-1830 (1994).</li><li>Franklin, M. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+analysis+and+cellular+localization+of+the+AlgI,+AlgJ,+and+AlgF+proteins+required+for+O+acetylation+of+alginate+in+Pseudomonas+aeruginosa.">Mutant analysis and cellular localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of alginate in Pseudomonas aeruginosa.</a> J. Bacteriol. 184, 3000-3007 (2002).</li><li>Deretic, V., Gill, J. F., Chakrabarty, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+algD+coding+for+GDPmannose+dehydrogenase+is+transcriptionally+activated+in+mucoid+Pseudomonas+aeruginosa.">Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.</a> J. Bacteriol. 169, 351-358 (1987).</li><li>Mathee, K., McPherson, C. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+the+algT+(algU)-encoded+sigma22+for+expression+of+the+alginate+regulon+in+Pseudomonas+aeruginosa+and+localization+of+its+antagonist+proteins+MucA+and+MucB+(AlgN)..">Posttranslational control of the algT (algU)-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN)..</a> J. Bacteriol. 179, 3711-3720 (1997).</li><li>Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+in+cystic+fibrosis:+role+of+mucC+in+the+regulation+of+alginate+production+and+stress+sensitivity.">Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity.</a> Microbiology. 143, 3473-3480 (1997).</li><li>Martin, D. W., Holloway, B. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+locus+determining+the+mucoid+status+of+Pseudomonas+aeruginosa:+AlgU+shows+sequence+similarities+with+a+Bacillus+sigma+factor.">Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor.</a> J. Bacteriol. 175, 1153-1164 (1993).</li><li>Damron, F. H., Goldberg, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteolytic+regulation+of+alginate+overproduction+in+Pseudomonas+aeruginosa.">Proteolytic regulation of alginate overproduction in Pseudomonas aeruginosa.</a> Mol. Microbiol. 84 (4), 595-607 (2012).</li><li>Browne, P., Barret, M., O'Gara, F., Morrissey, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+prediction+of+the+Crc+regulon+identifies+genus-wide+and+species-specific+targets+of+catabolite+repression+control+in+Pseudomonas+bacteria.">Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria.</a> BMC Microbiol. 10, 300 (2010).</li><li>Damron, F. H., Qiu, D., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pseudomonas+aeruginosa+sensor+kinase+KinB+negatively+controls+alginate+production+through+AlgW-dependent+MucA+proteolysis.">The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis.</a> J. Bacteriol. 191, 2285-2295 (2009).</li><li>Damron, F. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pseudomonas+aeruginosa+regulon+controlled+by+the+sensor+kinase+KinB+and+sigma+factor+RpoN.">Analysis of the Pseudomonas aeruginosa regulon controlled by the sensor kinase KinB and sigma factor RpoN.</a> J. Bacteriol. 194, 1317-1330 (2012).</li><li>Qiu, D., Eisinger, V. M., Rowen, D. W., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+proteolysis+controls+mucoid+conversion+in+Pseudomonas+aeruginosa.">Regulated proteolysis controls mucoid conversion in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 104, 8107-8112 (2007).</li><li>Schurr, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Which+bacterial+biofilm+exopolysaccharide+is+preferred,+Psl+or+alginate.">Which bacterial biofilm exopolysaccharide is preferred, Psl or alginate.</a> J. Bacteriol. 195, 1623-1626 (2013).</li><li>Wong, S. M., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+footprinting+with+mariner-based+transposition+in+Pseudomonas+aeruginosa.">Genetic footprinting with mariner-based transposition in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 10191-10196 (2000).</li><li>Lampe, D. J., Akerley, B. J., Rubin, E. J., Mekalanos, J. J., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hyperactive+transposase+mutants+of+the+Himar1+mariner+transposon.">Hyperactive transposase mutants of the Himar1 mariner transposon.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 11428-11433 (1999).</li></ol>

L&#39;autore Hongwei D. Yu è il Chief Science Officer e co-fondatore di ProGenesis Technologies, LLC.

È importante notare che questo metodo può essere utilizzato in altre specie Pseudomonas con queste alterazioni: incubare P. fluorescens e P. putida a 30 ° C, e P. stutzeri a 42 ° C; P. stuzeri deve essere coltivato su piastre LB addizionato con 150 mg / ml di gentamicina, sul passo 1.11, pag cellule stutzeri devono essere trasferiti in 500 ml di LB invece di 1 ml. Inoltre, ci sono due passaggi critici per questo protocollo. In primo luogo, il ceppo ricev...

La capacità del opportunistica, patogeno Gram-negativo Pseudomonas aeruginosa produrre in eccesso alginato è un fattore importante nella sua capacità di stabilire un biofilm. La sovrapproduzione di alginato è un fenotipo spesso indicato come mucoidy. L&#39;isolamento di colonie mucoidi dal espettorati di individui affetti da fibrosi cistica (CF) è indicativo di una infezione cronica, ed è direttamente associata ad un declino generale della salute del paziente 1. Attualmente, resta inteso che la regolazione e la produzione di alginato in P. aeruginosa si verifica principalmente a due operoni. Il primo è l&#39;operone biosintetica alginato, che contiene 12 geni (algD - alg8 - alg44 - algK - Alge - algG - algX - algL - Algi - algJ - algF - Alga), che sono responsabili per la sintesi e l&#39;esportazione del polimero alginato di tutti periplasma al environme extracellularent 2-5. Il secondo operone è un cluster di geni che inizia con il fattore sigma alternativo algU / T e continuando con muca, mucB, e mucD. AlgU / T è un regolatore positivo, mentre mucAB-D sono classificati come regolatori negativi della produzione alginato 6-8. Inoltre, regolatori trascrizionali, come ALGB, AlgQ, ALGR, e RpoN, così come post-trascrizionale e modificazione post-traslazionale dal controllo repressione da cataboliti, l&#39;attività chinasi (KinB) e proteolisi intramembrane, hanno anche dimostrato di essere coinvolti in alginato regolamentazione 9-14. Il trasposone vettore mini-himar1 noto come pFAC è stato originariamente creato nel laboratorio Dr. Mekalanos &#39;presso la Harvard Medical School 15. Il plasmide pFAC consiste di un elemento trasponibile fiancheggiato da due ripetizioni invertite di 27 bps e una cassetta gentamicina resistenza nel mezzo (aacC1: 534 bp), un gene che codifica la hyperactive transposase mariner 16, e un gene codificante β-lattamasi (bla) (Figura 1). Informazioni di sequenza per l&#39;elemento trasponibile di pFAC è disponibile al numero di accesso GenBank: DQ366300 13. In pFAC, c&#39;è un sito di clonazione multipla (MCS) dietro il gene aacC1 che viene utilizzato per l&#39;identificazione del sito di inserzione cromosomico mediante PCR inversa. Uno dei principali vantaggi con l&#39;utilizzo del trasposone mini-himar1 è alcuna fattori dell&#39;ospite specifici sono necessari per il recepimento (mutagenesi). Inoltre, vi è grande abbondanza dei TA dinucleotidici siti di inserzione trovati in tutto il genoma del P. aeruginosa. Ad esempio, TA siti di inserzione dinucleotide si verifica 94.404 e 100.229 volte in PAO1 (6.264.404 bps, GenBank numero di accesso NC_002516.2) e PA14 (6.537.648 bps, il numero di accesso GenBank NC_008463) genomi, rispettivamente. A causa della abbondanza di TA dinucleotide nel genoma, mini-himar1 </em&gt; Trasposone può causare l&#39;alta densità e mutagenesi casuale, che è particolarmente adatto per l&#39;analisi di geni di virulenza e geni che sono altamente regolamentati. Teoricamente, il trasposone mini-himar1 può inserire in qualsiasi gene non essenziale all&#39;interno del genoma di P. aeruginosa. Questo fornisce circa 18 TA siti di inserzione per fase di lettura aperta nel genoma PAO1. Qui, descriviamo un protocollo con mini-himar1 trasposone-mediata mutagenesi per identificare nuovi regolatori di mucoidy in P. aeruginosa. Più specificamente, si biparentally coniugato il vettore pFAC contenente un trasposone mini-himar1 da E. coli SM10/λpir nel nonmucoid prototrofici ceppo PAO1. Dopo il trasposone è integrato nel genoma, il ceppo ricevente è in coltura su agar isolamento Pseudomonas (PIA) contenente triclosan che inibisce la crescita di E. coli. Così, una libreria di mutanti di <em&gt; P. aeruginosa può essere selezionato dalla crescita su PIA piastra integrata con gentamicina e la presenza del fenotipo mucoide. Nota, una vera trasposone-mediata contro un mutante integrazione avrà un fenotipo resistente e carbenicillina sensibile gentamicina. In questo studio, circa 80.000 mutanti inserimento di PAO1 sono stati isolati attraverso quattro coniugazioni separate. Abbiamo poi proiettato per isolati mucoidi, e determinato il sito di inserimento da enzimi di restrizione, la legatura e inversa PCR. Abbiamo eseguito analisi Southern blot utilizzando la cassetta di resistenza gentamicina come sonda per vedere il numero di inserimento per genoma. Abbiamo determinato che oltre il 90% dei mutanti ottenuti per coniugazione usando questo protocollo aveva solo una singola copia del himar1 nel genoma e visualizzato il fenotipo resistente e carbenicillina sensibile gentamicina. Un totale di 32 ceppi mucoidi sono stati identificati, 22 di loro sono stati mappati a diversi loci del P. aeruginosa PAO1cromosoma. Questo tasso di inserimento prevede una copertura adeguata per individuare alcuni nuovi regolatori di sovrapproduzione alginato.

<table border="0" cellpadding="0" cellspacing="0" width="780">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:267px;">Luria Broth</td>
			<td style="width:187px;">Difco</td>
			<td style="width:125px;">240230</td>
			<td style="width:203px;">via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pseudomonas isolation agar</td>
			<td>Difco</td>
			<td>292710</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Small Plates (100 O.D. x 10 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-13</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Large Plates (150 O.D. x 15 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-14</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycerol</td>
			<td>Fisher Scientific</td>
			<td>BP229-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Shaking Incubator</td>
			<td>New Brunswick Scientific</td>
			<td>Innova 4080</td>
			<td>shake at 200 rpm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cabinet Incubator</td>
			<td>VWR</td>
			<td>1540</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Microcentrifuge</td>
			<td>Sorvall</td>
			<td>75-003-287</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SmartSpec Plus Spectrophotometer</td>
			<td>Bio-Rad</td>
			<td>170-2525</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Diposable Inoculation Loops</td>
			<td>Fisher Scientific</td>
			<td>22-363-597</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1.5 mL Microcentrifuge Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-408-129</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">15 mL Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-539-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Skim Milk</td>
			<td>Difco</td>
			<td>DF0032-17-3</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNeasy Blood and Tissue (250)&#160;</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick PCR Purification Kit (250)</td>
			<td>Qiagen</td>
			<td>28106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAprep Spin Miniprep Kit (250)&#160;</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastLink II DNA Ligation Kit</td>
			<td>Epicentre Technologies</td>
			<td>LK6201H</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accu block Digital Dry Bath&#160;</td>
			<td>Labnet</td>
			<td>NC0205808</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sal1, restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0138L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EasyStart Micro 50</td>
			<td>Molecular BioProducts</td>
			<td>6020</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq DNA Polymerase</td>
			<td>New England BioLabs</td>
			<td>M0267L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iCycler, Thermocycler</td>
			<td>Bio-Rad</td>
			<td>170-8740</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LE agarose</td>
			<td>Genemate</td>
			<td>3120-500</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gentamycin Sulfate</td>
			<td>Fisher Scientific</td>
			<td>BP918-1</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
	</tbody>
</table>

identification of novel genes associated with alginate production in pseudomonas aeruginosa using mini-himar1 mariner transposon-mediated mutagenesis

Pseudomonas aeruginosa è un batterio Gram-negativo, batterio ambientale con versatili capacità metaboliche. P. aeruginosa è un batterio patogeno opportunista che stabilisce le infezioni polmonari croniche in pazienti con fibrosi cistica (CF). La sovrapproduzione di un polisaccaride capsulare chiamato alginato, noto anche come mucoidy, promuove la formazione di biofilm mucoide che sono più resistenti rispetto alle cellule planctoniche alla chemioterapia antibiotica e difese dell&#39;ospite. Inoltre, la conversione dal nonmucoid al fenotipo mucoide è un marcatore clinico per l&#39;insorgenza di infezione cronica in CF. Sovrapproduzione alginato di P. aeruginosa è un processo ergoniche che tassa pesantemente energia cellulare. Di conseguenza, la produzione di alginato è altamente regolamentato in P. aeruginosa. Per capire meglio regolamentazione alginato, si descrive un protocollo utilizzando il mini-himar1 trasposone mutagenesi per l&#39;identificazione di regolatore alginato romanzos in un ceppo PAO1 prototipo. La procedura si compone di due fasi fondamentali. In primo luogo, abbiamo trasferito il trasposone mini-himar1 (pFAC) dall&#39;host E. coli SM10/λpir in destinatario P. aeruginosa PAO1 via coniugazione biparental per creare una libreria di mutante inserimento ad alta densità, che sono stati selezionati su piastre di isolamento di Pseudomonas agar addizionato con gentamicina. In secondo luogo, abbiamo proiettato e isolate colonie mucoidi per mappare il sito di inserimento attraverso inversa PCR usando primer DNA puntano verso l&#39;esterno dal cassetto gentamicina e sequenziamento del DNA. Usando questo protocollo, abbiamo identificato due nuovi regolatori di alginato, MUCE (PA4033) e kinB (PA5484), in ceppo PAO1 con una wild-type Muca che codifica per il fattore anti-sigma Muca per il regolatore di alginato maestro AlgU (ALGT, σ 22) . Questo protocollo mutagenesi ad alta produttività può essere modificato per l&#39;identificazione di altri geni di virulenza legate causando variazione colony morfologia.

Come illustrato nella Figura 1, il mini-himar1 mariner trasposone vettore, pFAC, contiene due ripetizioni invertite 27 bp con siti di inserzione TA fiancheggianti la cassetta resistenza aacC1 gentamicina, con il suo promotore σ 70-dipendente, e un sito di clonazione multipla (MCS). Inoltre, il vettore pFAC contiene i geni che codificano la transposase altamente attiva himar1, β-lattamasi (bla), e l&#39;operone trasferimento tra. I siti di inserzi...

Watch this Scientific Journal Video about Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis at JoVE.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Qui si descrive un protocollo con il mini-himar1 mariner trasposone-mediata mutagenesi per generare una libreria mutante inserimento ad alta densità per schermo, isolare ed identificare i regolatori alginato romanzo nel prototipo Pseudomonas aeruginosa ceppo PAO1.

Identificazione di geni novelli associati con alginato di produzione in<em&gt; Pseudomonas aeruginosa</em&gt; Utilizzo Mini-<em&gt; Himar1</em&gt; Mutagenesi Mariner Transposon-mediata

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

identification-novel-genes-associated-with-alginate-production

Research

JoVE Journal

Immunology and Infection

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

12.2K Views.  Marshall University.  Qui si descrive un protocollo con il mini-himar1 mariner trasposone-mediata mutagenesi per generare una libreria mutante inserimento ad alta densità per schermo, isolare ed identificare i regolatori alginato romanzo nel prototipo Pseudomonas aeruginosa ceppo PAO1. 

Video: Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living surfaces. In this paper, we describe protocols for forming Pseudomonas aeruginosa biofilms on human airway epithelial cells (CFBE cells) grown in culture. In the first method (termed the Static Co-culture Biofilm Model), P. aeruginosa is incubated with CFBE cells grown as confluent monolayers on standard tissue culture plates. Although the bacterium is quite toxic to epithelial cells, the addition of arginine delays the destruction of the monolayer long enough for biofilms to form on the CFBE cells. The second method (termed the Flow Cell Co-culture Biofilm Model), involves adaptation of a biofilm flow cell apparatus, which is often used in biofilm research, to accommodate a glass coverslip supporting a confluent monolayer of CFBE cells. This monolayer is inoculated with P. aeruginosa and a peristaltic pump then flows fresh medium across the cells. In both systems, bacterial biofilms form within 6-8 hours after inoculation. Visualization of the biofilm is enhanced by the use of P. aeruginosa strains constitutively expressing green fluorescent protein (GFP). The Static and Flow Cell Co-culture Biofilm assays are model systems for early P. aeruginosa infection of the Cystic Fibrosis (CF) lung, and these techniques allow different aspects of P. aeruginosa biofilm formation and virulence to be studied, including biofilm cytotoxicity, measurement of biofilm CFU, and staining and visualizing the biofilm.

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

This paper describes different methods of growing Pseudomonas aeruginosa biofilms on cultured human airway epithelial cells. These protocols can be adapted to study different aspects of biofilm formation, including visualization of the biofilm, staining of the biofilm, measuring the colony forming units (CFU) of the biofilm, and studying biofilm cytotoxicity.

Co-coltura Modelli di Pseudomonas aeruginosa Biofilm Cresciuto in diretta cellule delle vie aeree umane

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living ...

Ricerca

Immunologia e infezioni

Transfection and Mutagenesis of Target Genes in Mosquito Cells by Locked Nucleic Acid-modified Oligonucleotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new infections each year. Despite decades of research, there is still no vaccine against malaria, highlighting the need for novel control strategies. One innovative approach is the use of genetically modified mosquitoes to effectively control malaria parasite transmission. Deliberate alterations of cell signaling pathways in the mosquito, via targeted mutagenesis, have been found to regulate parasite development 1. From these studies, we can begin to identify potential gene targets for transformation. Targeted mutagenesis has traditionally relied upon the homologous recombination between a target gene and a large DNA molecule. However, the construction and use of such complex DNA molecules for generation of stably transformed cell lines is costly, time consuming and often inefficient. Therefore, a strategy using locked nucleic acid-modified oligonucleotides (LNA-ONs) provides a useful alternative for introducing artificial single nucleotide substitutions into episomal and chromosomal DNA gene targets (reviewed in 2). LNA-ON-mediated targeted mutagenesis has been used to introduce point mutations into genes of interest in cultured cells of both yeast and mice 3,4. We show here that LNA-ONs can be used to introduce a single nucleotide change in a transfected episomal target that results in a switch from blue fluorescent protein (BFP) expression to green fluorescent protein (GFP) expression in both Anopheles gambiae and Anopheles stephensi cells. This conversion demonstrates for the first time that effective mutagenesis of target genes in mosquito cells can be mediated by LNA-ONs and suggests that this technique may be applicable to mutagenesis of chromosomal targets in vitro and in vivo.

Oligonucleotides can be used to site specifically substitute a single nucleotide of transfected target genes in both Anopheles gambiae and Anopheles stephensi cells.

Trasfezione e Mutagenesi di geni bersaglio in cellule Mosquito da Locked Nucleic Acid modificati Oligonucleotidi

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new ...

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological properties compared to free living microorganisms. Biofilms in nature are often difficult to investigate and reside under poorly defined conditions1. Using a transparent substratum it is possible to device a system where simple biofilms can be examined in a non-destructive way in real-time: here we demonstrate the assembly and operation of a flow cell model system, for in vitro 3D studies of microbial biofilms generating high reproducibility under well-defined conditions2,3.
The system consists of a flow cell that serves as growth chamber for the biofilm. The flow cell is supplied with nutrients and oxygen from a medium flask via a peristaltic pump and spent medium is collected in a waste container. This construction of the flow system allows a continuous supply of nutrients and administration of e.g. antibiotics with minimal disturbance of the cells grown in the flow chamber. Moreover, the flow conditions within the flow cell allow studies of biofilm exposed to shear stress. A bubble trapping device confines air bubbles from the tubing which otherwise could disrupt the biofilm structure in the flow cell.
The flow cell system is compatible with Confocal Laser Scanning Microscopy (CLSM) and can thereby provide highly detailed 3D information about developing microbial biofilms. Cells in the biofilm can be labeled with fluorescent probes or proteins compatible with CLSM analysis. This enables online visualization and allows investigation of niches in the developing biofilm. Microbial interrelationship, investigation of antimicrobial agents or the expression of specific genes, are of the many experimental setups that can be investigated in the flow cell system.

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Protocol describing the application of a flow cell system for growing and analyzing microbial biofilms for Confocal Laser Scanning Microscopy (CLSM).

Pseudomonas aeruginosa e biofilm Saccharomyces cerevisiae in celle di flusso

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological ...

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with leukemia, severe burn wounds, or organ transplants1. In patients at high-risk for developing PA bloodstream infections, the gastrointestinal (GI) tract is the main reservoir for colonization2, but the mechanisms by which PA transitions from an asymptomatic colonizing microbe to an invasive, and often deadly, pathogen are unclear. Previously, we performed in vivo transcription profiling experiments by recovering PA mRNA from bacterial cells residing in the cecums of colonized mice 3 in order to identify changes in bacterial gene expression during alterations to the host&#x2019;s immune status.
As with any transcription profiling experiment, the rate-limiting step is in the isolation of sufficient amounts of high quality mRNA. Given the abundance of enzymes, debris, food residues, and particulate matter in the GI tract, the challenge of RNA isolation is daunting. Here, we present a method for reliable and reproducible isolation of bacterial RNA recovered from the murine GI tract. This method utilizes a well-established murine model of PA GI colonization and neutropenia-induced dissemination4. Once GI colonization with PA is confirmed, mice are euthanized and cecal contents are recovered and flash frozen. RNA is then extracted using a combination of mechanical disruption, boiling, phenol/chloroform extractions, DNase treatment, and affinity chromatography. Quantity and purity are confirmed by spectrophotometry (Nanodrop Technologies) and bioanalyzer (Agilent Technologies) (Fig 1). This method of GI microbial RNA isolation can easily be adapted to other bacteria and fungi as well.

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

A reliable method for the RNA isolation of Pseudomonas aeruginosa recovered from murine cecums is described. The RNA recovered is of sufficient quantity and quality for subsequent qPCR, transcription profiling, and RNA Seq experiments. This technique can be adapted for RNA isolation of other intestinal microbes.

Isolamento del RNA Pseudomonas aeruginosa Colonizzare la Murine tratto gastrointestinale

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with ...

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

There is growing concern about the relevance of in vitro antimicrobial susceptibility tests when applied to isolates of P. aeruginosa from cystic fibrosis (CF) patients. Existing methods rely on single or a few isolates grown aerobically and planktonically. Predetermined cut-offs are used to define whether the bacteria are sensitive or resistant to any given antibiotic1. However, during chronic lung infections in CF, P. aeruginosa populations exist in biofilms and there is evidence that the environment is largely microaerophilic2. The stark difference in conditions between bacteria in the lung and those during diagnostic testing has called into question the reliability and even relevance of these tests3.
 Artificial sputum medium (ASM) is a culture medium containing the components of CF patient sputum, including amino acids, mucin and free DNA. P. aeruginosa growth in ASM mimics growth during CF infections, with the formation of self-aggregating biofilm structures and population divergence4,5,6. The aim of this study was to develop a microtitre-plate assay to study antimicrobial susceptibility of P. aeruginosa based on growth in ASM, which is applicable to both microaerophilic and aerobic conditions.
 An ASM assay was developed in a microtitre plate format. P. aeruginosa biofilms were allowed to develop for 3 days prior to incubation with antimicrobial agents at different concentrations for 24 hours. After biofilm disruption, cell viability was measured by staining with resazurin. This assay was used to ascertain the sessile cell minimum inhibitory concentration (SMIC) of tobramycin for 15 different P. aeruginosa isolates under aerobic and microaerophilic conditions and SMIC values were compared to those obtained with standard broth growth. Whilst there was some evidence for increased MIC values for isolates grown in ASM when compared to their planktonic counterparts, the biggest differences were found with bacteria tested in microaerophilic conditions, which showed a much increased resistance up to a &gt;128 fold, towards tobramycin in the ASM system when compared to assays carried out in aerobic conditions.
 The lack of association between current susceptibility testing methods and clinical outcome has questioned the validity of current methods3. Several in vitro models have been used previously to study P. aeruginosa biofilms7, 8. However, these methods rely on surface attached biofilms, whereas the ASM biofilms resemble those observed in the CF lung9 . In addition, reduced oxygen concentration in the mucus has been shown to alter the behavior of P. aeruginosa2 and affect antibiotic susceptibility10. Therefore using ASM under microaerophilic conditions may provide a more realistic environment in which to study antimicrobial susceptibility.

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

Current diagnostic antimicrobial susceptibility testing relies on the planktonic growth of isolates in nutrient rich, aerobic conditions. Here, we employ an alternative artificial sputum medium to study antimicrobial susceptibility of Pseudomonas aeruginosa biofilms under both aerobic and microaerophilic conditions more representative of the cystic fibrosis lung.

Uso di un terreno dell&#39;espettorato artificiale per testare l&#39;efficacia degli antibiotici contro<em&gt; Pseudomonas aeruginosa</em&gt; In condizioni più rilevanti al polmone Fibrosi Cistica

There  is growing concern about the relevance of in vitro antimicrobial  susceptibility tests when applied to isolates of P. aeruginosa from  cystic ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

Long Term cronica<em&gt; Pseudomonas aeruginosa</em&gt; Infezione delle vie aeree nei topi

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

Pseudomonas aeruginosa Induced Lung Injury Model

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. Here we have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa (P. aeruginosa or PA). Using this model, we were able to show lung inflammation at the early phase of injury. In addition, alveolar epithelial barrier leakiness was observed by analyzing bronchoalveolar lavage (BAL); and alveolar cell death was observed by Tunel assay using tissue prepared from injured lungs. At a later phase following injury, we observed cell proliferation required for the repair process. The injury was resolved 7 days from the initiation of P. aeruginosa injection. This model mimics the sequential course of lung inflammation, injury and repair during pneumonia. This clinically relevant animal model is suitable for studying pathology, mechanism of repair, following acute lung injury, and also can be used to test potential therapeutic agents for this disease.

Pseudomonas aeruginosa Induced Lung Injury Model

We have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa. This model mimics lung injury during pneumonia and is clinically relevant.

Pseudomonas aeruginosa Induced Lung Injury Modello

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. ...

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. typhimurium bacteria are quickly detected and phagocytized by macrophages, and contained in vesicles known as phagosomes in order to be degraded. Isolation of S. typhimurium-containing phagosomes have been widely used to study how S. typhimurium infection alters the process of phagosome maturation to prevent bacterial degradation. Classically, the isolation of bacteria-containing phagosomes has been performed by sucrose gradient centrifugation. However, this process is time-consuming, and requires specialized equipment and a certain degree of dexterity. Described here is a simple and quick method for the isolation of S. typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin-streptavidin-conjugated magnetic beads. Phagosomes obtained by this method can be suspended in any buffer of choice, allowing the utilization of isolated phagosomes for a broad range of assays, such as protein, metabolite, and lipid analysis. In summary, this method for the isolation of S. typhimurium-containing phagosomes is specific, efficient, rapid, requires minimum equipment, and is more versatile than the classical method of isolation by sucrose gradient-ultracentrifugation.

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

We describe here a simple and quick method for the isolation of Salmonella typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin and streptavidin.

Isolamento di Salmonella typhimurium-contenente fagosomi dai macrofagi

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Replica di ordinato, Nonredundant biblioteca del ceppo di Pseudomonas aeruginosa PA14 trasposone inserimento mutanti

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

Generazione di mutanti di eliminazione genica in-frame in Pseudomonas aeruginosa e test per l'attenuazione della virulenza in un semplice modello di infezione del mouse

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...