The OPPF-UK is funded by the Medical Research Council, UK (grant MR/K018779/1) and the Membrane Protein Laboratory by the Wellcome Trust (grant 099165/Z/12/Z).

1. Costruzione di vettori di espressione <ol><li> Usa PCR Infusion clonazione di costruire fino a 96 plasmidi di espressione in parallelo con i vettori pOPINE-3C-GFP e Popin-N-GFP che aggiungono sia scindibili fusioni GFP-His6 C-terminale o N-terminale alle sequenze 13 rispettivamente. Nota: La scelta del vettore è dettata dalla topologia della proteina poiché la GFP deve essere espresso nel citosol, quindi per una proteina con un citosolica N-terminale e C-terminale extracellulare useremo Popin-N-GFP e un extracellulare N-terminale e citosolica C-terminale in useremmo pOPINE-3C-GFP. Se i due termini sono citosolico useremmo pOPINE-3C-GFP meno che non vi sia ragione funzionale non per contrassegnare il C-terminale. </li><li> Amplificare le sequenze di DNA che codificano per le proteine ​​di membrana con primer che incorporano le seguenti estensioni indicate: pOPINE-3C-GFP (fondo Forward - AGGAGATATACCATG; Primer Reverse - CAGAACTTCCAGTTT) e Popin-N-GFP (fondo Forward - AAGTTCTGTTTCAGGGCCCG; Reverse Primer - ATGGTCTAGAAAGCTTTA). </li><li> Analizzare la reazione di PCR mediante elettroforesi su gel di agarosio. Una volta prodotti puliti di PCR sono stati ottenuti, aggiungere 5 U DpnI a ciascun bene (fare in 5 ml di tampone di reazione 1x DpnI). Purificare i prodotti PCR utilizzando sfere magnetiche in un formato a 96 pozzetti. Nota: DpnI viene aggiunto per rimuovere il modello vettoriale; questo passaggio non è necessario se il DNA genomico è usato come template. </li><li> Aggiungere 1 ml (100 ng) del corrispondente vettore linearizzato a ciascun pozzetto di una piastra PCR. </li><li> Usando una pipetta multicanale add x ml di purificato PCR inserire nei rispettivi pozzetti della piastra PCR. Assicurarsi che tutti i prodotti sono nell&#39;intervallo 10-250 ng. </li><li> Aggiungere (9-x) microlitri di acqua al pozzo e trasferire il tutto 10 microlitri di una provetta contenente secco-down in fusione reagente. Lasciare agire per 30 sec. </li><li> Mescolare contenuti brevemente pipettando su e giù. Trasferimentole reazioni di nuovo alla piastra PCR originale e la guarnizione. </li><li> Incubare per 30 minuti a 42 ° C in un termociclatore. </li><li> Trasferire immediatamente le reazioni in ghiaccio quando la reazione è completa e aggiungere 40 ml di TE (Tris 10 mM, pH 8,0, 1 mM EDTA). </li><li> Congelare immediatamente o trasformare in cellule competenti. Per la trasformazione, usare 3 ml di reazione diluito per 50 microlitri aliquota di alta competenza (&gt; 5 x 10 9 trasformanti / mg) competente E. coli. </li><li> Aggiungere 1 ml di LB agar integrato con 50 mg / ml carbenicillina per pozzetto di una piastra di coltura tissutale 24-bene (per la clonazione, preparare pozzetti per 2 x numero di costrutti). </li><li> A seguito di conseguenza, seguito piastra escrescenza out 25 ml e 25 ml di una diluizione 1: 5 della cultura sul agar contenente 24 pozzetti piastre di coltura dei tessuti. </li><li> Stendere le cellule inclinando leggermente la piastra. </li><li> Essiccare la piastra con il coperchio per 10-15 minuti a 37 ° C o in un flow cappa a temperatura ambiente. </li><li> Rimettere il coperchio e girare la piastra di testa in giù e incubare una notte a 37 ° C. </li><li> Scegli due colonie e mini-preparazione i vettori. </li><li> PCR verificare i costrutti utilizzando il costrutto specifico primer reverse e un primer forward vettore specifico (ad esempio pOPIN_FOR GAC CGA AAT TAA TAC GAC TCA CTA TAG GG). </li></ol> 2. Trasformazione di E. coli E Ceppi xpression Nota: Prima di eseguire questo protocollo, E. cellule competenti coli sono fatti, aliquotati e conservati congelati a -80 ° C, come descritto in precedenza 13. Espressione della proteina di membrana viene costantemente controllato in due ceppi, Lemo21 (DE3) e C41 (DE3) pLysS. Per facilitare l&#39;interpretazione dei risultati può essere utile includere un controllo positivo, ad esempio un plasmide che esprime GFP o una proteina di membrana fusa alla GFP noti per esprimere e un controllo negativo vettore vuoto. <ol><li> Scongelare la aliquotted E. coli su ghiaccio. Aggiungere 3 ml di mini-prepped plasmide di espressione per ogni aliquota di cellule competenti. </li><li> Incubare la miscela in ghiaccio per 30 min. </li><li> Heat-shock le cellule per 30 secondi a 42 ° C. </li><li> Consentono alle cellule di recuperare in ghiaccio per 2 minuti e poi aggiungere 300 ml di brodo di potere ad ogni provetta. </li><li> Incubare per 1 ora in un incubatore statico 37 ° C. </li><li> Preparare il LB Agar in una piastra di coltura tissutale a 24 pozzetti, integrata con 50 mg / ml e carbenicillina 35 mg / ml cloramfenicolo. Aggiungere ramnosio ad una concentrazione finale di 0,25 mM ai pozzetti contenenti Lemo21 (DE3). Nota: Se il prodotto è probabile che sia tossico i pozzetti contenenti C41 (DE3) pLysS può essere integrato con 1% (w / v) di glucosio. </li><li> Trasferire 30 ml di cellule dal mix di trasformazione sulle piastre LB Agar. Stendere e asciugare la piastra come descritto in 1,13-1,15. </li></ol> 3. Preparazione di colture starter Overnight Nota: preparare sempre le culture durante la notte il giorno dopo la trasformazione mai da una vecchia piastra di trasformazione. <ol><li> Aggiungere 0,7 ml di potenza brodo a ciascun pozzetto di una piastra a 96 pozzetti profondi ben integrato con 50 mg / ml carbenicillina e 35 ug / ml di cloramfenicolo. Aggiungere ramnosio ai pozzetti contenenti Lemo21 (DE3) ad una concentrazione finale di 0,25 mM. Facoltativamente, integrare C41 (DE3) pLysS con 1% (w / v) di glucosio; vedi sopra (2.6 nota). </li><li> Scegli una colonia dalle piastre di trasformazione durante la notte in ogni pozzetto. Sigillare il blocco con un sigillo gas-permeabile. </li><li> Agitare il blocco a 250 rpm in un incubatore con un grande lancio (es orbita 25 mm) o a 600 rpm in un incubatore con una piccola laterale (es un&#39;orbita 4,3 millimetri) a 37 ° C durante la notte. </li></ol> 4. La crescita e induzione delle Culture <ol><li> Aggiungere 3 ml di brodo di potenza integrato con 50 mg / ml e carbenicillina 35 mg / ml di cloramfenicolo ogni well di 24 pozzetti profondo bene. Aggiungere L-ramnosio (e glucosio), come descritto nella sezione 3.1. Utilizzare 3 ml di coltura per permettere la raccolta in duplicato e per consentire una certa evaporazione dell&#39;acqua attraverso la tenuta permeabile ai gas. </li><li> Impostare le culture di espressione con l&#39;aggiunta di 150 ml di Lemo21 (DE3) o C41 (DE3) pLysS culture durante la notte in ogni pozzetto dei blocchi 24 e profondo bene. </li><li> Agitare i blocchi a 37 ° C finché la OD media a 595 nm è ~ 0,5 attraverso la piastra. </li><li> Indurre l&#39;espressione aggiungendo IPTG alle culture ad una concentrazione finale di 1,0 mM IPTG. </li><li> Far crescere le culture durante la notte (18-20 h) con agitazione a 20 ° C. </li></ol> 5. Analisi di Expression da In-gel fluorescenza <ol><li> Raccolto in duplice copia. Trasferire 1 ml della cultura da ogni pozzetto in una, fondo conico, blocco quadrato ben 96 ben profondo bene. Nota: Harvest in duplice copia in caso di rottura del blocco o per consentire la sperimentazione della correntdetersivo ve se lo si desidera. </li><li> Sigillare i blocchi e raccogliere le cellule per centrifugazione a 6.000 xg per 10 min. </li><li> Capovolgere il blocco e decantare la media. Toccare il blocco delicatamente su un tovagliolo di carta per drenare supporti rimanenti. </li><li> Sigillare le piastre e conservare a -80 ° C per un minimo di 20 min. Facoltativamente, lasciare l&#39;esperimento a questo punto e il blocco trasformati quando conveniente. </li><li> De-gelo i pellets per 20 minuti a temperatura ambiente. </li><li> Utilizzare una pipetta multicanale o un agitatore orbitale (1000 rpm per 10 min) a 4 ° C per risospendere completamente le cellule in 200 microlitri di tampone di lisi (50 mM NaH 2 PO 4, NaCl 300 mM imidazolo 10 mM 1% v / v Tween 20, regolare il pH a 8,0 con NaOH). </li><li> Aggiungere 20 ml di soluzione DLPI (20 microlitri DNaseI (4.000 unità / ml), 20 mg, lisozima e 20 microlitri cocktail inibitore di proteasi in un volume finale di 2 ml di acqua). Incubare per 10 minuti con agitazione (~ 1000 rpm) a 4 ° C. </li><li&gt; Aggiungi 25 ml di 10% n -Dodecyl β-D-maltoside (DDM). </li><li> Incubare per 60 minuti con agitazione (~ 1000 rpm) a 4 ° C. </li><li> Centrifugare il blocco profondo bene a 6.000 xg per 30 min a 4 ° C. </li><li> Trasferire 10 ml di lisato eliminato per una piastra di microtitolazione e aggiungere 10 ml di tampone di SDS PAGE gel loading (Tris 100 mM, pH 6,8, 4% w / v SDS, 0,2% w / v blu di bromofenolo, 10% v / v β -mercaptoethanol, e il 20% v / v glicerolo). ATTENZIONE! Non bollire CAMPIONE. </li><li> Carico 10 microlitri di campione dal punto 5.11 / pozzetto su SDS PAGE gel (s) e funzionano a 100-120 V (tensione costante) in una camera fredda finché il fronte del colorante raggiunge il fondo (2-2,5 ore). </li><li> Posizionare il gel su un imager (ad esempio con un filtro blu-luce per rilevare le proteine ​​GFP fusione). Il tempo di esposizione è scelta in modo che le bande più brillanti non sono saturi. </li></ol> 6. Scale-up di colture cellulari <ol><li> Trasformare una aliquota di competenza <em&gt; E. coli come descritto nella sezione 2. </li><li> Scegli una colonia in 10 ml di brodo di potenza (integrato come descritto nella sezione 3) e crescere durante la notte a 37 ° C. </li><li> Diluire 5 ml di coltura durante la notte in 500 ml di brodo di alimentazione. </li><li> Grow con agitazione a 250 rpm a 37 ° C finché la densità ottica a 595 nm è ~ 0,5. </li><li> Indurre l&#39;espressione aggiungendo IPTG ad una concentrazione finale di 1,0 mM. </li><li> Crescere una notte con agitazione a 250 rpm a 20 ° C. </li><li> Celle di raccolta per centrifugazione a 5.000 xg per 15 min. </li><li> Surnatante Rifiuta. Pellet cellulari possono essere conservati a -80 ° C. </li></ol> 7. Preparazione di Membrane <ol><li> Cellule Scongelare (se necessario) a temperatura ambiente e risospendere in 1x PBS pH 7,5 ad un volume di 5 ml per grammo di pellet cellulare; Aumentare il volume, se necessario, fino a quando la viscosità si riduce ad una consistenza liquida. Aggiungere MgCl 2 alla concentrazione finale di 1 mM, DNAsi I a concentrazione finale di 10 mg / ml e unopre-confezionati proteasi tablet inibitore per 20 g di pellet. Rottura celle aperte con un disgregatore cella refrigerata ad una pressione di 30 kpsi. </li><li> Agglomerare le cellule intatte e detriti a 30.000 g per 15 minuti a 4 ° C. Trasferire il surnatante in un tubo ultra-centrifugazione. </li><li> Raccogliere la frazione totale membrana riducendo la velocità del supernatante in un ultra-centrifugare a 200.000 xg per 1 ora a 4 ° C. </li><li> Scartare il surnatante. </li><li> Risospendere il pellet membrana ghiacciate 10 ml PBS pH 7.5 utilizzando un omogeneizzatore cellulare. 1 ml membrane risospese sono necessari per ogni detersivo. Facoltativamente, in questa fase, flash congelare la sospensione della membrana in azoto liquido e conservare a -80 ° C. </li></ol> 8. solubilizzazione e Analisi della Frazione Membrane <ol><li> Scongelare frazione di membrana (se necessario), e per ogni detersivo da utilizzare per solubilizzazione, aliquote di 900 ml di sospensione di membrana in un 1,5 ml polyallomer micro-centrifugotubo ge. </li><li> Aggiungere 100 pl di ciascun detergente preparata di fresco (10% w / v soluzioni di DDM, DM, Cymal-6 e LDAO) ad una concentrazione finale di 1% al tubo 1,5 ml specificato. Per solubilizzazione di proteine ​​di membrana eucariotica emisuccinato colesterolo (concentrazione finale 0,2%) può essere aggiunto ai detergenti. </li><li> Incubare le miscele a 4 ° C per 1 ora con blanda agitazione. </li><li> Pellet detergente frazione insolubile con un banco superiore ultra-centrifuga, assicurando tubi sono almeno mezzo pieno, a 150.000 g a 4 ° C per 45 min e mantenere surnatante. Nota: L&#39;efficacia di detersivo solubilizzazione può essere stimata utilizzando un lettore di piastre a fluorescenza misurando la fluorescenza GFP delle membrane solubilizzate con il detersivo frazione insolubile risospese nello stesso volume di PBS. </li><li> Analizzare il mono-dispersità del diverso detersivo: complessi di proteine ​​di membrana mediante cromatografia fluorescenza rilevati dimensioni esclusione (FSEC). </li><li> Per l&#39;analisi FSEC, equilibrare una colonna esclusione dimensioni con una vasta gamma di frazionamento, ad esempio 5.000 a 5.000.000 nel peso molecolare, con tampone di corsa (20 mM Tris pH 7,5, 150 mM NaCl, 0,03% DDM) ad una portata di 0,3 ml / min . Utilizzare questo buffer per tutti i campioni, cioè non è cambiato per ogni detersivo testato. </li><li> Iniettare 100 ul di membrane solubilizzate sulla colonna ad una velocità di flusso di 0,3 ml / min. Monitorare profilo eluizione utilizzando ottiche fluorescenza (eccitazione a 488 nm ed emissione a 512 nm). Se un monitor linea fluorescenza non è disponibile, raccogliere le frazioni e leggere la fluorescenza in un lettore di piastre. </li><li> Importa volume di eluizione e dati intensità di fluorescenza in un foglio di calcolo per la visualizzazione grafica. </li><li> Analizzare restante materiale della membrana solubilizzato da in-gel di fluorescenza come descritto nel capitolo 5. </li></ol>

<ol>
	<li>Wallin, E., von Heijne, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+integral+membrane+proteins+from+eubacterial,+archaean,+and+eukaryotic+organisms.">Genome-wide analysis of integral membrane proteins from eubacterial, archaean, and eukaryotic organisms.</a> Protein Sci. 7 (4), 1029-1038 (1998).</li><li>Fagerberg, L., Jonasson, K., von Heijne, G., Uhlen, M., Berglund, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prediction+of+the+human+membrane+proteome.">Prediction of the human membrane proteome.</a> Proteomics. 10 (6), 1141-1149 (2010).</li><li>Okada, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-Ray+diffraction+analysis+of+three-dimensional+crystals+of+bovine+rhodopsin+obtained+from+mixed+micelles.">X-Ray diffraction analysis of three-dimensional crystals of bovine rhodopsin obtained from mixed micelles.</a> J Struct Biol. 130 (1), 73-80 (2000).</li><li>Palczewski, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+rhodopsin:+A+G+protein-coupled+receptor.">Crystal structure of rhodopsin: A G protein-coupled receptor.</a> Science. 289 (5480), 739-745 (2000).</li><li>Miroux, B., Walker, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Over-production+of+proteins+in+Escherichia+coli:+mutant+hosts+that+allow+synthesis+of+some+membrane+proteins+and+globular+proteins+at+high+levels.">Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels.</a> J Mol Biol. 260 (3), 289-298 (1996).</li><li>Wagner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tuning+Escherichia+coli+for+membrane+protein+overexpression.">Tuning Escherichia coli for membrane protein overexpression.</a> Proc Natl Acad Sci U S A. 105 (38), 14371-14376 (2008).</li><li>Schlegel, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+membrane+protein+overexpression+in+the+Escherichia+coli+strain+Lemo21(DE3).">Optimizing membrane protein overexpression in the Escherichia coli strain Lemo21(DE3).</a> J Mol Biol. 423 (4), 648-659 (2012).</li><li>Chun, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+partner+toolchest+for+the+stabilization+and+crystallization+of+G+protein-coupled+receptors.">Fusion partner toolchest for the stabilization and crystallization of G protein-coupled receptors.</a> Structure. 20 (6), 967-976 (2012).</li><li>Drew, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP-based+optimization+scheme+for+the+overexpression+and+purification+of+eukaryotic+membrane+proteins+in+Saccharomyces+cerevisiae.">GFP-based optimization scheme for the overexpression and purification of eukaryotic membrane proteins in Saccharomyces cerevisiae.</a> Nat Protoc. 3 (5), 784-798 (2008).</li><li>Drew, D. E., von Heijne, G., Nordlund, P., de Gier, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Green+fluorescent+protein+as+an+indicator+to+monitor+membrane+protein+overexpression+in+Escherichia+coli.">Green fluorescent protein as an indicator to monitor membrane protein overexpression in Escherichia coli.</a> FEBS Lett. 507 (2), 220-224 (2001).</li><li>Kawate, T., Gouaux, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence-detection+size-exclusion+chromatography+for+precrystallization+screening+of+integral+membrane+proteins.">Fluorescence-detection size-exclusion chromatography for precrystallization screening of integral membrane proteins.</a> Structure. 14 (4), 673-681 (2006).</li><li>Newstead, S., Kim, H., von Heijne, G., Iwata, S., Drew, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+fluorescent-based+optimization+of+eukaryotic+membrane+protein+overexpression+and+purification+in+Saccharomyces+cerevisiae.">High-throughput fluorescent-based optimization of eukaryotic membrane protein overexpression and purification in Saccharomyces cerevisiae.</a> Proc Natl Acad Sci U S A. 104 (35), 13936-13941 (2007).</li><li>Busso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+protein+complexes+using+multiple+Escherichia+coli+protein+co-expression+systems:+a+benchmarking+study.">Expression of protein complexes using multiple Escherichia coli protein co-expression systems: a benchmarking study.</a> J Struct Biol. 175 (2), 159-170 (2011).</li><li>Sonoda, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Benchmarking+membrane+protein+detergent+stability+for+improving+throughput+of+high-resolution+X-ray+structures.">Benchmarking membrane protein detergent stability for improving throughput of high-resolution X-ray structures.</a> Structure. 19 (1), 17-25 (2011).</li><li>Low, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+analytical+gel+filtration+screening+of+integral+membrane+proteins+for+structural+studies.">High-throughput analytical gel filtration screening of integral membrane proteins for structural studies.</a> Biochim Biophys Acta. 1830 (6), 3497-3508 (2013).</li></ol>

The authors have nothing to disclose.

Nel protocollo descritto in questo articolo, la legatura clonazione indipendente in un vettore GFP giornalista è combinato con il rilevamento della fluorescenza per lo screening rapidamente l&#39;espressione relativa di più proteine ​​di membrana in E. coli. Vettori possono essere realizzati in quattro giorni lavorativi con schermatura espressione primaria prendere un&#39;altra settimana. In-gel fluorescenza lisati detergenti di cellule intere viene utilizzato per classificare espressione colpisce per ulteriori analisi in uno schermo secondario. La schermata espressione primaria come presentato non richiede attrezzature specialistiche parte un incubatore agitatore adatto per la coltivazione delle cellule in blocchi e profonde. Tutti manipolazione liquidi coinvolge 96 pozzetti piastre SBS può essere effettuata con pipette multicanale. Il protocollo può essere facilmente modificato per includere altri ceppi di E. coli cresciute in diverse condizioni di espressione (ad esempio temperatura bassa). Nel caso del LEMO21 (DE3) titolando il livello di ramnosio (da 0 a 2,0 mm)aggiunta di modulare la velocità di trascrizione può aumentare il livello di espressione di alcune proteine ​​di membrana 7. Detergenti diversi da DDM potrebbero essere utilizzati per l&#39;estrazione nella schermata principale se i detergenti più severe possono solubilizzare le proteine ​​dai corpi di inclusione e quindi dare falsi positivi. Chiaramente, la più elaborata schermata iniziale diventa, più in termini di tempo dell&#39;esperimento. Lo schermo secondario prevede la preparazione di una frazione di membrana totale dai colpi di espressione identificati nella schermata principale. Questa è una fase critica come sarà confermare la localizzazione delle proteine ​​di fusione della membrana del E. coli. Successiva estrazione della proteina di fusione GFP in detergenti diversi è monitorato da fluorescenza rilevata dimensioni esclusione cromatografia di materiale solubilizzato per valutare la mono-dispersità dei complessi proteici detergente. Questo è un altro aspetto critico poiché identifica il detergente più appropriato persolubilizzazione delle proteine ​​di membrana per la successiva lavorazione a valle. Tuttavia, l&#39;esperienza mostra che ulteriore ottimizzazione della scelta del detersivo (s), potrebbe essere necessario durante la purificazione e cristallizzazione. La prova di un comportamento uniforme nei diversi detergenti, tra cui quelli con una dimensione relativamente piccola micelle (es LDAO) sembra essere un buon indicatore di una propensione a formare bene diffrazione dei cristalli, almeno per le proteine ​​di membrana procariote 14. A questo proposito il profilo indicato per la proteina di membrana in Figura 2B appare molto favorevole. Il principale vantaggio di utilizzare un reporter GFP è che dà una rapida lettura di espressione in campioni non-purificata. Uno svantaggio è che la proteina di fusione GFP deve essere rimosso durante la purificazione della proteina per la cristallizzazione. Nel caso dei vettori utilizzati qui, un sito proteasi rhinovirus 3C consente di clivaggio della GFP. In alternativa, esso è semplicedi ri-clone proteine ​​candidate, individuate nella schermata, in vettori che aggiungono solo un polyhistidine o altro tag affinità per successiva purificazione. Questo presuppone che la fusione di GFP non è necessaria per l&#39;espressione. La principale alternativa all&#39;utilizzo di fusione GFP per il rilevamento di espressione della proteina di membrana e la solubilizzazione è solo aggiungere un tag istidina. Tuttavia questo approccio richiede generalmente a partire da una frazione di membrana 15 che per la valutazione delle molte varianti diverrebbe molto tempo. In sintesi, lo scopo principale del protocollo descritto in questo articolo è consentire un gran numero di sequenza della proteina di membrana varianti essere rapidamente valutati in termini di espressione e detergente solubilizzazione e priorità per un&#39;analisi più approfondita.

È stato stimato che le proteine ​​di membrana rappresentano circa il 20-30% dei geni codificati in tutti i genomi sequenziati 1, tra il genoma umano 2. Dato il loro ruolo critico in molti processi biologici, ad esempio il trasporto di metaboliti, produzione di energia e come bersagli farmacologici, c&#39;è forte interesse nel determinare la loro struttura tridimensionale. Tuttavia, rispetto alle proteine ​​solubili, proteine ​​di membrana sono molto sottorappresentate nel Protein Data Bank. In realtà, le 99.624 strutture rilasciati nel PDB ( <a href="http://www.rcsb.org/pdb/">http://www.rcsb.org/pdb/</a> ) solo 471 ( <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> ) sono classificate come proteine ​​di membrana. Questo riflette le difficoltà tecniche di lavoro con proteine ​​di membrana che sono naturalmente espressi a livelli relativamente bassi; rodopsina è una delle poche eccezioni 3,4. Over-espressione di versione ricombinantes in cellule eterologhe si traduce spesso in misfolding e poveri mirati alla membrana che limita il livello globale della produzione. Selezionando il miglior detersivo per l&#39;estrazione e la solubilizzazione di una proteina di membrana espressa volta successiva purificazione rende difficile e richiede un&#39;attenta ottimizzazione. Escherichia coli rimane l&#39;espressione ospite più comunemente usata per le proteine ​​di membrana pari al 72% ( <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> ) di strutture finora risolto che sono quasi esclusivamente da fonti batteriche. Specific E. ceppi coli, C41 (DE3) e C43 (DE3), sono stati isolati, che non portano alla sovra-espressione di proteine ​​di membrana e quindi evitare gli effetti di tossicità osservati per altre BL21 ceppi 5,6. Ottimizzazione del livello di espressione ricombinante proteina di membrana sembra essere critica per ottimizzare il livello di produzione di 6,7. <p class=&quot;Jove_content&quot;&gt; In molti casi, la produzione di successo di proteine ​​di membrana per la determinazione di questa struttura è necessaria la valutazione di più versioni, tra cui amino- e delezioni carbossi-terminale, più ortologhi per sfruttare variazione di sequenza naturale e diverse proteine ​​di fusione 6-8. Pertanto, un metodo per lo screening di espressione di proteine ​​di membrana multipli in parallelo è essenziale. Un approccio comunemente utilizzato è di fondere la proteina a proteina fluorescente verde (GFP) espressione permette di tenere traccia senza la necessità di purificare la proteina. In questo modo, informazioni sul livello di espressione, la stabilità e il comportamento in detergenti diversi può essere valutata con piccole quantità di un-purificato materiale 9-12. In questo articolo descriviamo un protocollo semplificato per la clonazione e l&#39;espressione screening delle proteine ​​di membrana in E. coli con la fusione di GFP come reporter di produzione e la successiva caratterizzazione di detersivo: proteine ​​compLexes (Figura 1).

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Name of Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
		</tr>
		<tr>
			<td>pOPIN-N-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>pOPINE-3C-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>C41(DE3)pLysS</td>
			<td>Lucigen (http://lucigen.com/</td>
			<td>60444-1</td>
		</tr>
		<tr>
			<td>LEMO21(DE3)</td>
			<td>New England Biolabs</td>
			<td>C2528H</td>
		</tr>
		<tr>
			<td>In-Fusion HD EcoDry Cloning System, 96 Rxns</td>
			<td>Clontech/Takara</td>
			<td>639688</td>
		</tr>
		<tr>
			<td>Power broth</td>
			<td>Molecular Dimensions (http://www.moleculardimensions.com/)</td>
			<td>MD12-106-1</td>
		</tr>
		<tr>
			<td>Protease Inhibitor tablets</td>
			<td>Roche</td>
			<td>11697498001</td>
		</tr>
		<tr>
			<td>cOmplete, Mini, EDTA-Free; Protease Inhibitor Cocktail&#160;</td>
			<td>Roche</td>
			<td>11836170001</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma-Aldrich</td>
			<td>83650</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P8849</td>
		</tr>
		<tr>
			<td>DNAse 1</td>
			<td>Sigma-Aldrich</td>
			<td>DN25</td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td>L7651</td>
		</tr>
		<tr>
			<td>Cholesterol hemisuccinate</td>
			<td>Sigma-Aldrich</td>
			<td>C6512</td>
		</tr>
		<tr>
			<td>CYMAL-6 ( 6-Cyclohexyl-1-Hexyl-&#946;-D-Maltoside)</td>
			<td>Anatrace</td>
			<td>C326</td>
		</tr>
		<tr>
			<td>DDM ( n-Dodecyl &#223;-maltoside )</td>
			<td>Generon</td>
			<td>D97002</td>
		</tr>
		<tr>
			<td>DM (n-Decyl &#223;-maltoside)</td>
			<td>Generon</td>
			<td>D99003</td>
		</tr>
		<tr>
			<td>LDAO ( N,N-Dimethyl-n-dodecylamine N-oxide)</td>
			<td>Generon</td>
			<td>D71111</td>
		</tr>
		<tr>
			<td>E1 ClipTip Eq384 8 channel 1-30 ul&#160;</td>
			<td>Thermo Scientific&#160;</td>
			<td>4672030</td>
		</tr>
		<tr>
			<td>Rainin Pipette Pipet-Lite XLS 6ch 100-1200&#181;L LTS Spacer</td>
			<td>Anachem</td>
			<td>LA6-300XLS</td>
		</tr>
		<tr>
			<td>Rainin Pipette Light XLS+ 8ch 2-20&#181;L LTS</td>
			<td>Anachem</td>
			<td>L8-20XLSPLUS</td>
		</tr>
		<tr>
			<td>Pipette Pipet-Lite XLS 8ch 100-1200&#181;L LTS Tip</td>
			<td>Anachem</td>
			<td>L8-1200XLS</td>
		</tr>
		<tr>
			<td>24 well V bottom deep well blocks</td>
			<td>Porvair sciences</td>
			<td>360115</td>
		</tr>
		<tr>
			<td>BenchMark Fluorescent Protein Standard</td>
			<td>Life Technologies</td>
			<td>LC5928</td>
		</tr>
		<tr>
			<td>NuPAGE Novex 10% Bis-Tris Midi Protein Gels, 26 well</td>
			<td>Life Technologies</td>
			<td>WG1203BOX</td>
		</tr>
		<tr>
			<td>XCell4 SureLock Midi-Cell</td>
			<td>Life Technologies</td>
			<td>WR0100</td>
		</tr>
		<tr>
			<td>Vibramax 100</td>
			<td>Heidolph</td>
			<td>544-21200-00</td>
		</tr>
		<tr>
			<td>Tension rollers attachment</td>
			<td>Heidolph</td>
			<td>549-81000-00</td>
		</tr>
		<tr>
			<td>ptima L-100 Ultracentrifuge running 45-Ti rotor</td>
			<td>Beckman Coulter</td>
			<td>393253</td>
		</tr>
		<tr>
			<td>Optima Max-XP ultracentrifuge running TLA-55 rotor</td>
			<td>Beckman Coulter</td>
			<td>393315</td>
		</tr>
		<tr>
			<td>Floor standing centrifuge, Avanti J-26S XPI running JA-17 and JS-5.3 rotors&#160;</td>
			<td>Beckman Coulter</td>
			<td>B14535</td>
		</tr>
		<tr>
			<td>Prominence UFLC with RF-20A Fluorescence detector</td>
			<td>Shimadzu</td>
			<td></td>
		</tr>
		<tr>
			<td>Sepharose 6 10/300 GL size exclusion column</td>
			<td>GE Healthcare</td>
			<td>17-5172-01&#160;</td>
		</tr>
		<tr>
			<td>SSI5R-HS SHEL LAB Floor Model Shaking Incubator, 5 Cu.Ft. (144 L), 30-850 RPMs</td>
			<td>Shel Lab&#160;</td>
			<td>SSI5R-HS</td>
		</tr>
		<tr>
			<td>Innova44R incubator</td>
			<td>New Brunswick /Eppendorf</td>
			<td>Innova44R</td>
		</tr>
		<tr>
			<td>TS SERIES 0.75KW DISRUPTER 230V 50HZ 1PH (40KPSI)</td>
			<td>Constant systems</td>
			<td>PL083016</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma</td>
			<td>83650</td>
		</tr>
	</tbody>
</table>

green fluorescent protein-based expression screening of membrane proteins in escherichia coli

La produzione di proteine ​​di membrana ricombinanti per studi strutturali e funzionali rimane tecnicamente impegnativo a causa dei bassi livelli di espressione e l&#39;instabilità intrinseca di molte proteine ​​di membrana volta solubilizzazione nei detergenti. Un protocollo è descritto, che combina la legatura clonazione indipendente di proteine ​​di membrana come fusioni GFP con espressione in Escherichia coli rilevati da GFP fluorescenza. Questo consente la costruzione e l&#39;espressione di screening di proteine ​​di membrana multiple / varianti per identificare i candidati idonei per un ulteriore investimento di tempo e fatica. Il reporter GFP è utilizzato in una schermata primaria di espressione visualizzando fluorescenza GFP seguente SDS elettroforesi su gel di poliacrilammide (SDS-PAGE). Le proteine ​​di membrana che mostrano sia un livello di espressione alto con degradazione minima, come indicato dall&#39;assenza di GFP libera, sono selezionati per uno schermo secondario. Questi costrutti sono in scala e una frazione di membrana totale preparati e solubilizzanod in quattro detergenti diversi. Dopo ultracentrifugazione per rimuovere il materiale detergente-insolubili, lisati sono analizzati per il rilevamento della fluorescenza cromatografia esclusione dimensione (FSEC). Il monitoraggio del profilo di esclusione dimensioni di GFP fluorescenza fornisce informazioni sulla mono-dispersità e l&#39;integrità delle proteine ​​di membrana nei detergenti diversi. Proteine: combinazioni detergenti che eluiscono con un picco simmetrico con poca o nessuna connessione GFP e aggregazione minima sono candidati per la successiva purificazione. Utilizzando la metodologia sopra, l&#39;espressione eterologa in E. coli di SED (forma, l&#39;allungamento, la divisione, e la sporulazione) proteine ​​da 47 diverse specie di batteri è stata analizzata. Queste proteine ​​hanno tipicamente dieci domini transmembrana e sono essenziali per la divisione cellulare. I risultati mostrano che la produzione dei SED ortologhi in E. coli era altamente variabile rispetto ai livelli di espressione e l&#39;integrità delle proteine ​​di fusione GFP. La i esperimentodentified un sottoinsieme per ulteriori indagini.

La famiglia SEDS di proteine ​​(forma, allungamento, divisione, e sporulazione) è essenziale per la divisione cellulare batterica. Queste proteine ​​integrali hanno tipicamente dieci domini transmembrana con entrambi i termini amminici e carbossilici all&#39;interno della cellula. Per esemplificare il protocollo sopra descritto, 47 SED ortologhi sono stati clonati nel vettore pOPINE-3C-eGFP. Un piccolo schermo espressione scala dei costrutti è stata effettuata in due E ceppi .coli, Lemo21 (DE3) coltivate in presenza di 0,25 mM ramnosio per bloccare l&#39;espressione leaky e C41 (DE3) pLysS, che vengono abitualmente utilizzati per l&#39;espressione di membrana proteine ​​5-8. Detergente solubilizzati lisati di culture indotte sono stati analizzati mediante elettroforesi SDS-poliacrilammide. Uso in gel di fluorescenza per visualizzare proteine ​​di fusione GFP espresse mostrato che tra i due ceppi 38 dei 47 SED costrutti sono stati prodotti. È interessante notare che ci sono differenze tra i due ceppi di espressione. Dei 38 espresso costrutti, solo 18 sono stati prodotti in entrambi i ceppi, 14 espresse solo in Lemo21 (DE3) e 6 solo in C41 (DE3) pLysS. Nel complesso, ci fu un tasso di successo più elevato per il Lemo21 (DE3) rispetto al pLysS C41 (DE3) (38 vs 24). Tuttavia l&#39;osservazione che alcune proteine ​​sembravano essere ceppo specifico che lo screening sia utile. Dati rappresentativi per 24 dei 47 SEDs costrutti sono mostrati in Figura 1. L&#39;intensità delle bande dà un&#39;indicazione del livello di espressione, per esempio la proteina di fusione in C4 bene in figura 1A e 1B si esprime bene in entrambi i ceppi tuttavia l&#39;ulteriore bande con peso molecolare inferiore suggeriscono che la proteina è parzialmente degradata. In molti corsie c&#39;è una banda che corrisponde in dimensioni per GFP solo. Una valutazione qualitativa dell&#39;integrità della proteina può essere effettuata da guardando l&#39;intensità della proteina di fusione rispetto al GFP libero;ad esempio, G4 e H4 sono completamente suddivisi per GFP gratuita in C41 (DE3) pLysS (Figura 1B), mentre nel Lemo21 (DE3) vi è una certa proteina intatta (Figura 1A). Per 14 dei 38 proteine ​​espresse l&#39;intensità della banda GFP libera è simile a quella della proteina di fusione, per 21 l&#39;intensità della banda GFP libera è maggiore di quella della proteina di fusione e una minoranza delle proteine ​​di fusione (3 / 38 espresso) ad es F6 e G6 in Figura 1A hanno relativamente poco GFP libera rispetto alla proteina di fusione. Due dei costrutti che esprimono bene nelle B5 schermata principale (fasce ad alta intensità per GFP gratuitamente e proteine ​​di fusione) e G6 (poco gratuito GFP) sono stati espressi e una frazione di membrana totale preparato da 500 ml coltura cellulare. Membrane risospese sono state divise in aliquote e analizzati mediante cromatografia ad esclusione sterica fluorescenza rilevato (FSEC). I profili FSEC sono presentati in Figure rispettivamente e 2A e 2B mostrano che le due proteine ​​SED comportano in modo diverso nelle quattro detergenti testati. In un caso (Figura 2A: campione B5) la proteina dato solo un picco simmetrico con poco aggregazione in DDM che sarebbe quindi il detersivo di scelta per la successiva purificazione. Per contro l&#39;altra proteina di fusione (Figura 2B: campione G6) ha un profilo simile in tutti i detersivi testati. <img alt="Figura 1" src="/files/ftp_upload/52357/52357fig1highres.jpg" width="700px" /> Figura 1: Schema di flusso di lavoro per lo screening espressione della proteina di membrana in E. coli con un reporter GFP. <img alt="Figura 2" src="/files/ftp_upload/52357/52357fig2highres.jpg" /> Figura 2: schermata primaria di espressione della proteina di membrana utilizzando in-gel fluorescenza. </strong&gt; lisati detergenti di E. coli sono stati analizzati mediante SDS-PAGE e gel ripreso con illuminazione blu Epi e 530/28 filtro. I risultati sono mostrati per 24 costrutti (etichettati A4-H6 base alla loro posizione in una piastra a 96 pozzetti). Sono indicate le posizioni delle bande per GFP libero e proteine ​​di fusione GFP. (A) Proteine ​​espresse in Lemo21 (DE3). (B) Proteine ​​espresse in C41 (DE3) pLysS. <img alt="Figura 3" src="/files/ftp_upload/52357/52357fig3highres.jpg" /> Figura 3:. Schermo secondario di espressione della proteina di membrana mediante cromatografia di esclusione dimensioni fluorescenza rilevato (FSEC) frazioni di membrana totali sono stati estratti in quattro diversi detergenti e le proteine ​​di membrana solubilizzate analizzato mediante cromatografia di esclusione dimensioni utilizzando un sistema FPLC accoppiato ad un rivelatore a fluorescenza. Profili FSEC per (A) B5 proteina di membrana e (B) </strong&gt; proteine ​​di membrana G6. La posizione dei picchi corrispondenti alle proteine ​​aggregate, solubilizzato proteina GFP fusione e la GFP liberi sono indicati. I detergenti testati sono indicati qui di seguito i profili.

Watch this Scientific Journal Video about Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli at JoVE.com

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Un approccio semplificato per lo screening per l&#39;espressione di proteine ​​di membrana ricombinanti in Escherichia coli basato sulla fusione di proteina fluorescente verde è presentato.

Green Fluorescent Protein-base Espressione Proiezione di proteine ​​di membrana in<em&gt; Escherichia coli</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

green-fluorescent-protein-based-expression-screening-membrane

Research

JoVE Journal

Biology

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

32.6K Views.  Research Complex at Harwell.  Un approccio semplificato per lo screening per l'espressione di proteine ​​di membrana ricombinanti in Escherichia coli basato sulla fusione di proteina fluorescente verde è presentato. 

Video: Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

La colorazione delle proteine ​​in gel con Coomassie G-250, senza solventi organici acido acetico e

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

Ricerca

Biologia

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme acid stresses including passage through the mammalian stomach where the pH can fall to as low as pH 1 - 22. To enable such a broad range of acidic pH survival, E. coli possesses four different inducible amino acid decarboxylases that decarboxylate their substrate amino acids in a proton-dependent manner thus raising the internal pH. The decarboxylases include the glutamic acid decarboxylases GadA and GadB3, the arginine decarboxylase AdiA4, the lysine decarboxylase LdcI5, 6 and the ornithine decarboxylase SpeF7. All of these enzymes utilize pyridoxal-5'-phospate as a co-factor8 and function together with inner-membrane substrate-product antiporters that remove decarboxylation products to the external medium in exchange for fresh substrate2. In the case of LdcI, the lysine-cadaverine antiporter is called CadB. Recently, we determined the X-ray crystal structure of LdcI to 2.0 &#197;, and we discovered a novel small-molecule bound to LdcI the stringent response regulator guanosine 5'-diphosphate,3'-diphosphate (ppGpp) 14. The stringent response occurs when exponentially growing cells experience nutrient deprivation or one of a number of other stresses9. As a result, cells produce ppGpp which leads to a signaling cascade culminating in the shift from exponential growth to stationary phase growth10. We have demonstrated that ppGpp is a specific inhibitor of LdcI 14. Here we describe the lysine decarboxylase assay, modified from the assay developed by Phan et al.11, that we have used to determine the activity of LdcI and the effect of pppGpp/ppGpp on that activity. The LdcI decarboxylation reaction removes the &alpha;-carboxy group of L-lysine and produces carbon dioxide and the polyamine cadaverine (1,5-diaminopentane)5. L-lysine and cadaverine can be reacted with 2,4,6-trinitrobenzensulfonic acid (TNBS) at high pH to generate N,N'-bistrinitrophenylcadaverine (TNP-cadaverine) and N,N&#8242;-bistrinitrophenyllysine (TNP-lysine), respectively11. The TNP-cadaverine can be separated from the TNP-lysine as the former is soluble in organic solvents such as toluene while the latter is not (See Figure 1). The linear range of the assay was determined empirically using purified cadaverine.

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

The activity of the inducible lysine decarboxylase is monitored by reacting the substrate L-lysine and the product cadaverine with 2,4,6-trinitrobenzensulfonic acid to form adducts that have differential solubility in toluene.

Un test per misurare l&#39;attività di Escherichia coli Inducibile Lisina Decarboxyase

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme ...

Crystallization of Membrane Proteins in Lipidic Mesophases

Membrane proteins perform critical functions in living cells related to signal transduction, transport and energy transformations, and, as such, are implicated in a multitude of malfunctions and diseases. However, a structural and functional understanding of membrane proteins is strongly lagging behind that of their soluble partners, mainly, due to difficulties associated with their solubilization and generation of diffraction quality crystals. Crystallization in lipidic mesophases (also known as in meso or LCP crystallization) is a promising technique which was successfully applied to obtain high resolution structures of microbial rhodopsins, photosynthetic proteins, outer membrane beta barrels and G protein-coupled receptors. In meso crystallization takes advantage of a native-like membrane environment and typically produces crystals with lower solvent content and better ordering as compared to traditional crystallization from detergent solutions. The method is not difficult, but requires an understanding of lipid phase behavior and practice in handling viscous mesophase materials. Here we demonstrate a simple and efficient way of making LCP and reconstituting a membrane protein in the lipid bilayer of LCP using a syringe mixer, followed by dispensing nanoliter portions of LCP into an assay or crystallization plate, conducting pre-crystallization assays and harvesting crystals from the LCP matrix. These protocols provide a basic guide for approaching in meso crystallization trials; however, as with any crystallization experiment, extensive screening and optimization are required, and a successful outcome is not necessarily guaranteed.

The protocols describe the essential steps for obtaining diffraction quality crystals of a membrane protein starting from reconstitution of the protein in a lipidic cubic phase (LCP), finding initial conditions with LCP-FRAP pre-crystallization assays, setting up LCP crystallization trials and harvesting crystals.

Cristallizzazione delle proteine ​​di membrana lipidica in Mesophases

Membrane proteins perform critical functions in living cells related to signal transduction, transport and energy transformations, and, as such, are ...

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted into fuel alcohols1. The potential for enzymatic hydrolysis of cellulosic biomass to provide renewable energy has intensified efforts to engineer cellulases for economical fuel production2. Of particular interest are fungal cellulases3-8, which are already being used industrially for foods and textiles processing.
Identifying active variants among a library of mutant cellulases is critical to the engineering process; active mutants can be further tested for improved properties and/or subjected to additional mutagenesis. Efficient engineering of fungal cellulases has been hampered by a lack of genetic tools for native organisms and by difficulties in expressing the enzymes in heterologous hosts. Recently, Morikawa and coworkers developed a method for expressing in E. coli the catalytic domains of endoglucanases from H. jecorina3,9, an important industrial fungus with the capacity to secrete cellulases in large quantities. Functional E. coli expression has also been reported for cellulases from other fungi, including Macrophomina phaseolina10 and Phanerochaete chrysosporium11-12. 
We present a method for high throughput screening of fungal endoglucanase activity in E. coli. (Fig 1) This method uses the common microbial dye Congo Red (CR) to visualize enzymatic degradation of carboxymethyl cellulose (CMC) by cells growing on solid medium. The activity assay requires inexpensive reagents, minimal manipulation, and gives unambiguous results as zones of degradation (&#x201C;halos&#x201D;) at the colony site. Although a quantitative measure of enzymatic activity cannot be determined by this method, we have found that halo size correlates with total enzymatic activity in the cell. Further characterization of individual positive clones will determine , relative protein fitness. 
Traditional bacterial whole cell CMC/CR activity assays13 involve pouring agar containing CMC onto colonies, which is subject to cross-contamination, or incubating cultures in CMC agar wells, which is less amenable to large-scale experimentation. Here we report an improved protocol that modifies existing wash methods14 for cellulase activity: cells grown on CMC agar plates are removed prior to CR staining. Our protocol significantly reduces cross-contamination and is highly scalable, allowing the rapid screening of thousands of clones. In addition to H. jecorina enzymes, we have expressed and screened endoglucanase variants from the Thermoascus aurantiacus and Penicillium decumbens (shown in Figure 2), suggesting that this protocol is applicable to enzymes from a range of organisms.

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

We describe a low cost, high throughput method to screen for fungal endoglucanase activity in E. coli. The method relies on a simple visual readout of substrate degradation, does not require enzyme purification, and is highly scalable. This allows for the rapid screening of large libraries of enzyme variants.

Throughput Screening elevati di attività Endoglucanase fungine in Escherichia coli</em

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through macromolecular X-ray crystallography (MX). An essential ingredient of MX is a steady supply of ideally diffraction-quality crystals. The in meso or lipidic cubic phase (LCP) method for crystallizing membrane proteins is one of several methods available for crystallizing membrane proteins. It makes use of a bicontinuous mesophase in which to grow crystals. As a method, it has had some spectacular successes of late and has attracted much attention with many research groups now interested in using it. One of the challenges associated with the method is that the hosting mesophase is extremely viscous and sticky, reminiscent of a thick toothpaste. Thus, dispensing it manually in a reproducible manner in small volumes into crystallization wells requires skill, patience and a steady hand. A protocol for doing just that was developed in the Membrane Structural &amp; Functional Biology (MS&amp;FB) Group1-3. JoVE video articles describing the method are available1,4. 
The manual approach for setting up in meso trials has distinct advantages with specialty applications, such as crystal optimization and derivatization. It does however suffer from being a low throughput method. Here, we demonstrate a protocol for performing in meso crystallization trials robotically. A robot offers the advantages of speed, accuracy, precision, miniaturization and being able to work continuously for extended periods under what could be regarded as hostile conditions such as in the dark, in a reducing atmosphere or at low or high temperatures. An in meso robot, when used properly, can greatly improve the productivity of membrane protein structure and function research by facilitating crystallization which is one of the slow steps in the overall structure determination pipeline. 
In this video article, we demonstrate the use of three commercially available robots that can dispense the viscous and sticky mesophase integral to in meso crystallogenesis. The first robot was developed in the MS&amp;FB Group5,6. The other two have recently become available and are included here for completeness.	
An overview of the protocol covered in this article is presented in Figure 1. All manipulations were performed at room temperature (~20 &deg;C) under ambient conditions.

Herein is described a robotic approach to high-throughput crystallization of membrane proteins in lipidic mesophases for use in structure determination using macromolecular X-ray crystallography. Three robots capable of handling the viscous and sticky protein-laden mesophase integral to the method are introduced.

L&#39;utilizzo di un robot per High-throughput cristallizzazione delle proteine ​​di membrana in mesofasi lipidici

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Intravital Microscopy for Imaging Subcellular Structures in Live Mice Expressing Fluorescent Proteins

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, we use the salivary glands of live mice since they provide several advantages. First, they can be easily exposed to enable access to the optics, and stabilized to facilitate the reduction of the motion artifacts due to heartbeat and respiration. This significantly facilitates imaging and tracking small subcellular structures. Second, most of the cell populations of the salivary glands are accessible from the surface of the organ. This permits the use of confocal microscopy that has a higher spatial resolution than other techniques that have been used for in vivo imaging, such as two-photon microscopy. Finally, salivary glands can be easily manipulated pharmacologically and genetically, thus providing a robust system to investigate biological processes at a molecular level.
In this study we focus on a protocol designed to follow the kinetics of the exocytosis of secretory granules in acinar cells and the dynamics of the apical plasma membrane where the secretory granules fuse upon stimulation of the beta-adrenergic receptors. Specifically, we used a transgenic mouse that co-expresses cytosolic GFP and a membrane-targeted peptide fused with the fluorescent protein tandem-Tomato. However, the procedures that we used to stabilize and image the salivary glands can be extended to other mouse models and coupled to other approaches to label in vivo cellular components, enabling the visualization of various subcellular structures, such as endosomes, lysosomes, mitochondria, and the actin cytoskeleton.

Intravital microscopy is a powerful tool that enables imaging various biological processes in live animals. In this article, we present a detailed method for imaging the dynamics of subcellular structures, such as the secretory granules, in the salivary glands of live mice.

Intravitale Microscopia per le strutture Imaging subcellulari in topi vivi Esprimere proteine ​​fluorescenti

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, ...

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Electroporation has become a widely used method for rapidly and efficiently introducing foreign DNA into a wide range of cells. Electrotransformation has become the method of choice for introducing DNA into prokaryotes that are not naturally competent. Electroporation is a rapid, efficient, and streamlined transformation method that, in addition to purified DNA and competent bacteria, requires commercially available gene pulse controller and cuvettes. In contrast to the pulsing step, preparation of electrocompetent cells is time consuming and labor intensive involving repeated rounds of centrifugation and washes in decreasing volumes of sterile, cold water, or non-ionic buffers of large volumes of cultures grown to mid-logarithmic phase of growth. Time and effort can be saved by purchasing electrocompetent cells from commercial sources, but the selection is limited to commonly employed E. coli laboratory strains. We are hereby disseminating a rapid and efficient method for preparing electrocompetent E. coli, which has been in use by bacteriology laboratories for some time, can be adapted to V. cholerae and other prokaryotes. While we cannot ascertain whom to credit for developing the original technique, we are hereby making it available to the scientific community.

Rapid Protocol for Preparation of Electrocompetent Escherichia coli and Vibrio cholerae

Electroporation is a commonly employed method for introducing DNA into bacteria in a process known as transformation. Traditional protocols for the preparation of electrocompetent cells are time consuming and labor intensive. This article describes an alternate, rapid, and efficient method for the preparation of electrocompetent cells presently employed by some laboratories.

Rapid Protocollo per la preparazione di elettrocompetenti<em&gt; Escherichia coli</em&gt; E<em&gt; Vibrio cholerae</em

Electroporation has become a widely used method for rapidly and efficiently introducing foreign DNA into a wide range of cells. Electrotransformation has ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

Protocolli per l&#39;implementazione di un<em&gt; Escherichia coli</em&gt; Sulla base TX-TL cellulare-Free Expression System per la biologia sintetica

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

Rilevamento dal vivo<em&gt; Escherichia coli</em&gt; O157: H7 Celle di PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. However, purifying proteins is sometimes challenging since many proteins are expressed in an insoluble form. When working with difficult or multiple targets it is therefore recommended to use high throughput (HTP) protein expression screening on a small scale (1-4&#160;ml cultures) to quickly identify conditions for soluble expression. To cope with the various structural genomics programs of the lab, a quantitative (within a range of 0.1-100 mg/L culture of recombinant protein) and HTP protein expression screening protocol was implemented and validated on thousands of proteins. The protocols were automated with the use of a liquid handling robot but can also be performed manually without specialized equipment.
Disulfide-rich venom proteins are gaining increasing recognition for their potential as therapeutic drug leads. They can be highly potent and selective, but their complex disulfide bond networks make them challenging to produce. As a member of the FP7 European Venomics project (<a href="http://www.venomics.eu">www.venomics.eu</a>), our challenge is to develop successful production strategies with the aim of producing thousands of novel venom proteins for functional characterization. Aided by the redox properties of disulfide bond isomerase DsbC, we adapted our HTP production pipeline for the expression of oxidized, functional venom peptides in the E. coli cytoplasm. The protocols are also applicable to the production of diverse disulfide-rich proteins. Here we demonstrate our pipeline applied to the production of animal venom proteins. With the protocols described herein it is likely that soluble disulfide-rich proteins will be obtained in as little as a week. Even from a small scale, there is the potential to use the purified proteins for validating the oxidation state by mass spectrometry, for characterization in pilot studies, or for sensitive micro-assays.

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

A protocol for the quantitative, high throughput expression screening and analytical purification of fusion proteins from small-scale Escherichia coli cultures is described and applied to the expression of disulfide-rich animal venom protein targets.

High Throughput Screening espressione quantitativa e purificazione Applicata al ricombinante Disulfide ricchi di Venom proteine ​​prodotte in<em&gt; E. coli</em

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. ...

Green Fluorescent Protein-base Espressione Proiezione di proteine ​​di membrana in

Green Fluorescent Protein-base Espressione Proiezione di proteine di membrana in