This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

1. HFF coltura cellulare e Ad-infezione <ol><li> Propagare virus Ad5 WT in monostrati di cellule HEK-293 e titolo come fluorescenti unità formanti (FFU) sulle cellule HFF come descritto in precedenza 8. </li><li> Crescere fibroblasti Foreskin umana (HFF) in 10 ml di DMEM / 10% siero fetale bovino (FBS) in sterile cultura 100 mm piatti a 37 ° C e 5% di CO 2 in un incubatore umidificato. Determinare il numero di cellulare utilizzando una camera Neubauer contando cellule nei quattro set di 16 quadrati. Il numero di cellule per ml si ottiene calcolando il numero medio di cellule nei quattro set di 16 quadri e moltiplicando questo numero per 10 4. Per ogni volta dopo l&#39;infezione inclusa nella fase 1.3, utilizzare 1 x 10 7 cellule HFF. </li><li> Mock-infettare o infettare le cellule HFF con il tipo di adenovirus 5 (AD5) wild-type (WT) (H5pg4100 8) a 100 mm piastre di coltura dei tessuti utilizzando 1 ml di Ad5 in DMEM al piatto con un MOI di 30 focus Forming Unit, o FFU , per cella. Incubare per 2 ore a ahumidified coltura cellulare incubatore a 37 ° C e 5% CO 2, dondolo accuratamente i piatti ogni 15 minuti per assicurare una distribuzione omogenea del virus inoculo sulle celle. Trascorso questo tempo, rimuovere il supporto e aggiungere DMEM fresco supplementato con 10% FBS e incubare per 16, 24 o 36 ore in un incubatore umidificato coltura cellulare a 37 ° C e 5% CO 2. Passare al punto 2.1. </li></ol> 2. Preparazione di frazioni sub-nucleare arricchito con Adenovirus RC <ol><li> Raccolto Ad5-infetti o cellule HFF mock-infettati con scrapper cellule e raccogliere le cellule in provette sterili. Determinare il numero di cellulare come al punto 1.2. Utilizzare 1 x 10 7 cellule per ogni tempo di post-infezione specificato al punto 1.3. </li><li> Centrifugare le cellule a 220 xg, 4 ° C per 5 min. </li><li> Risospendere il pellet di cellule in PBS freddo (137 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO 4 e 1,8 mm KH 2 PO 4). Pellet Washs 3 volte utilizzando 5 ml di PBS ghiacciato a lavaggio. A tal fine, centrifugare le cellule a 220 xg, 4 ° C per 5 minuti, decantare e scartare il surnatante (SN), e risospendere il pellet cellulare delicatamente pipettando. </li><li> Per interrompere la membrana plasmatica, risospendere il pellet cellulare in 700 μ l di tampone ipotonico ghiacciata (10 mM HEPES pH 7.9, KCl 10 mM, MgCl 1,5 mm 2, DTT 0,5 mM, 20 μ g / ml phenylmethylsulfonyl fluoruro (PMSF) , una miscela di cisteina, serina, treonina e inibitori della proteasi aspartil compresi 10 μ g / ml inibitore della tripsina pancreatica bovina, 10 μ g / ml pepstatina A e 10 μ g / ml N-acetil-L-leucil-L-leucil-L -argininal) e lasciare che le cellule si gonfiano in ghiaccio per 3 ore. </li><li> Lyse le cellule utilizzando un omogeneizzatore con larghi Un pestello tipo teflon. Eseguire 80 Dounce ictus e campioni di monitoraggio ogni 20 colpi, mediante microscopia a campo chiaro per garantire che tutte le cellule sono state lisato, ma che i nuclei hanno not stato danneggiato o rotto. </li><li> Centrifugare l&#39;omogeneizzato cellulare a 300 xg, 4 ° C per 5 minuti. Conservare il SN come frazione citoplasmatica a -20 ° C in una provetta da centrifuga. </li><li> Per rimuovere i detriti cellulari dai nuclei, risospendere il pellet in 750 μ l di soluzione 1 (S1) (0,25 M di saccarosio, 10 mM MgCl 2 20 mcg / ml PMSF, una miscela di cisteina, serina, inibitori treonina e aspartil proteasi di cui 10 μ g / ml inibitore della tripsina pancreatica bovina, 10 μ g / ml pepstatina A e 10 μ g / ml N-acetil-L-leucil-L-leucil-L-argininal) e strato sopra un volume uguale di soluzione 2 (S2) (0,35 M di saccarosio, 0,5 mM MgCl 2, 20 μ g / ml PMSF, una miscela di cisteina, serina, inibitori treonina e aspartil proteasi di cui 10 μ g / ml inibitore della tripsina pancreatica bovina, 10 μ g / ml pepstatina A e 10 μ g / ml N-acetil-L-leucil-L-leucil-L-argininal). Centrifuge a 1.400 xg, 4 ° C per 5 minuti. </li><li> Eliminare il SN con una micropipetta. Evitare di disturbare il pellet. </li><li> Risospendere il pellet contenente nuclei isolati in 750 μ l di S2. </li><li> Per isolare le frazioni subnucleari arricchiti con adenovirus RC (RCF), ultrasuoni risospeso nuclei con un bagno ad ultrasuoni, per mezzo di due 5 min impulsi, o fino a quando tutti i nuclei vengono lisati come osservato in microscopia in campo chiaro. Utilizzare ghiaccio in bagno a ultrasuoni come necessario per mantenere i campioni pari o inferiore a 4 ° C. </li><li> Strato nuclei sonicati su un volume uguale di soluzione di 3 (S3) (0,88 M di saccarosio, 0,5 mM MgCl 2) e centrifugare a 3000 xg, a 4 ° C per 10 min. Conservare il surnatante 1,5 ml come frazione nucleoplasmic (NPL) a -70 ° C. Risospendere il pellet in 700 μ l di S2 e negozio come RCF a -70 ° C. </li></ol> 3. Western Blot analisi di RCF NOTA: Per l&#39;analisi Western Blot NPL e RCF frazioni set oltre 640 μ l per Npl e 300 μ l per RCF dal volume totale ottenuto al punto 2.11. <ol><li> Mescolare 15 μ l di ogni frazione subnucleare in 2x tampone Laemmli (4% SDS, 20% glicerolo, 10% 2-mercaptoetanolo, 0,004% blu di bromofenolo, 0,125 M Tris HCl pH 6.8) e far bollire a 95 ° C per 5 min. Caricare i campioni in un elettroforesi 10% di sodio dodecil solfato-poliacrilammide gel (SDS-PAGE) e gel proteine ​​separati denaturazione per 1,5 ore, a 20 milliampere (mA). </li><li> Trasferimento proteine ​​da elettroblotting per 1,5 ore a 400 mA su di polivinile (PVDF) membrane. </li><li> Bloccare membrana per 2 ore a temperatura ambiente usando latte in polvere 3% senza grassi in PBS. </li><li> Incubare O / N a 4 ° C con anticorpo primario contro E2A DNA-binding proteina virale (B6-8 9) ad una diluizione 1: 500 in latte in polvere PBS / 0,3% senza grassi. </li><li> Membrana Lavare 3 volte con PBS / Tween 20 0,1% per 10 min. </li><li> Incubare la membrana con topo anti IgG un secondariotibody accoppiato alla perossidasi di rafano (HRP) ad una diluizione 1: 10.000 in PBS per 2 ore a temperatura ambiente. </li><li> Lavare la membrana 3 volte con PBS / Tween 20 0,1% per 10 min. </li><li> Sviluppare la membrana utilizzando chemiluminescenza e pellicole radiografiche. </li></ol> 4. virale rilevamento del DNA a RCF NOTA: per l&#39;isolamento del DNA da entrambe le frazioni Npl e RCF, utilizzare 210 μ l per Npl e 100 μ l per RCF del volume totale ottenuto nel passaggio 2.11. <ol><li> Incubare frazioni sub-nucleari per 1 ora a 55 ° C con 1 mg / ml di proteinasi K e 0,5% Tween 20. </li><li> Inattivare proteinasi K incubando i campioni per 10 min a 95 ° C. </li><li> Centrifugare i campioni a 20.000 xg, a temperatura ambiente per 2 min. </li><li> Raccogliere la SN. Precipitare il DNA con 1/10 volume di 3M acetato di sodio e un volume di isopropanolo, O / N a 4 ° C. </li><li> Centrifugare i campioni a 20.000 xg, a temperatura ambiente per 10 min. </li><li> Gettare la u SNcantare una micropipetta. Lavare il pellet con 70% etanolo e centrifugare a 20.000 xg, a 4 ° C per 5 min. </li><li> Risospendere il DNA in 10 μ l di 10 mM Tris-HCl pH 7.4 </li><li> Quantificare DNA utilizzando uno spettrofotometro misurando la densità ottica (OD) a 260 nm. </li><li> Per amplificare DNA virale, utilizzare 100 ng di DNA da ogni frazione subnucleare in una reazione standard di PCR utilizzando DNA polimerasi Taq in 25 μ l di volume di reazione con primers che permettono l&#39;amplificazione di una regione all&#39;interno del maggiore unità Dopo la trascrizione, dal nucleotide 7273 al nucleotide 7353 (81 pb) (Fw: GAGCGAGGTGTGGGTGAGC; Ap: GGATGCGACGACACTGACTTCA). Utilizzare le seguenti condizioni ciclo: denaturazione iniziale per 3 min a 95 ° C, seguiti da 20 cicli di amplificazione (1 min a 95 ° C, ricottura per 1 min a 62 ° C ed estensione per 30 sec a 72 ° C) e una fase di estensione finale per 3 min a 72 ° C. </li><li> Eseguire il prodotto di PCR in 2% gel di agarosio, a 90 V. Macchia con etidiobromuro a 0,5 μ g / ml concentrazione finale e visualizzare il DNA per corroborare l&#39;arricchimento del DNA virale nel RCF. Maneggiare il bromuro di etidio con estrema cautela e assicurarsi sempre di indossare i guanti, come questo composto è un potente mutageno. Smaltire bromuro di etidio secondo le linee guida istituzionali. </li></ol> 5. Fine virale mRNA rilevamento in RCF NOTA: Per l&#39;RNA isolamento da entrambe le frazioni Npl e RCF, utilizzare 640 μ l per Npl e 300 μ l per RCF dal volume totale ottenuto al punto 2.11. <ol><li> Isolare RNA da frazioni subnucleari utilizzando Trizol accordo con le istruzioni del produttore. Risospendere l&#39;RNA a 50 μ l di DEPC (diethilpyrocarbonate) acqua -treated. </li><li> Quantificare l&#39;RNA utilizzando uno spettrofotometro per misurare la densità ottica a 260 nm (circa 3 μ g si ottengono). Conservare l&#39;RNA a 50 ng / μ l aliquote a -70 ° C. </li><li> Controllare RNA purificatoper l&#39;assenza di contaminazione DNA eseguendo un controllo di reazione PCR in assenza di trascrittasi inversa (RT), utilizzando 5 ng di RNA totale e le condizioni del ciclo descritto al punto 4.9. <ol><li> Se la contaminazione del DNA è assente non amplicone dovrebbe essere prodotto. Se la contaminazione del DNA è presente, incubare i campioni con 10 U DNasi I, 10 U di RNasi inibitore, 0,1 M Tris-HCl pH 8,3, 0,5 M KCl e 15 mM MgCl 2 per 30 minuti a 37 ° C. Procedere alla ri-isolare l&#39;RNA come al punto 5.1. </li></ol></li><li> Per analizzare mRNA virale associato alla RCF, amplificare i 100 ng di RNA da ogni frazione subnucleare mediante RT-PCR utilizzando primer disegnati per rilevare adenovirale mRNA tardi da diverse famiglie di geni (Tabella 1). <ol><li> Per la trascrizione inversa (RT), utilizzare 100 ng di RNA, da ogni frazione subnucleare in una reazione standard di RT utilizzando M-MuLV RT enzima in 20 μ l di volume di reazione per 1 ora a 42 ° C e 10 min a 70 ° C. </li><li> Per l&#39;amplificazione, usare 1μ l di cDNA in reazioni di PCR, come al punto 4.9. Utilizzare le seguenti condizioni del ciclo: denaturazione iniziale per 3 minuti a 95 ° C, seguita da 25 cicli di amplificazione (1 min a 95 ° C, ricottura per 1 min alla temperatura indicata nella tabella 1 e l&#39;estensione per 30 sec a 72 ° C) e una passo estensione finale per 3 minuti a 72 ° C. </li></ol></li><li> Eseguire i prodotti di RT-PCR in 2% gel di agarosio, a 90 V. gel macchia con etidio bromuro a 0,5 μ g / ml concentrazione finale e visualizzare per corroborare virale tardi mRNA associazione al RCF. Maneggiare il bromuro di etidio come indicato al punto 4.10. </li></ol> 6. immunofluorescenza Visualizzazione di RCF NOTA: Carry-questa procedura sotto una cappa a flusso laminare per evitare la contaminazione dei campioni con le particelle di polvere, e filtrare tutte le soluzioni prima dell&#39;uso. <ol><li> Spot 5 μ l della frazione RCF ottenuto nel passaggio 2.10 terribilectly su un vetrino rivestito silano. </li><li> Lasciate che la macchia asciugare per circa 5 minuti a temperatura ambiente. </li><li> Reidratare lentamente e indirettamente pipettaggio 500 μ l di PBS in una goccia accanto al posto RCF e lasciando fluire inclinando il vetrino. Scaricare l&#39;eccesso di PBS dal lato. </li><li> Block coprendo il campione con 500 μ l di PBS / 5% di albumina sierica bovina (BSA) per 2 ore a temperatura ambiente. </li><li> Lavare il vetrino 3 volte da delicatamente e indirettamente pipettando 500 l μ di PBS sul campione. Inclinare il vetrino per drenare l&#39;eccesso di PBS. </li><li> Incubare il campione con l&#39;anticorpo primario contro E2A virale DNA-binding protein (B6-8 9) ad una diluizione 1: 500 in PBS per 2 ore a temperatura ambiente. Coprire il campione macchiato con 20 μ l di soluzione di anticorpo e incubare in una camera umida per evitare l&#39;essiccamento. </li><li> Lavare il campione 3 volte con PBS / 0,02% di Tween 20 da delicatamente e indirettamente pipettando 500 μ l di PBS sul campione. Inclinare il vetrino per scaricare l&#39;exsoluzione di lavaggio processo. </li><li> Incubare i campioni con topo anti IgG anticorpo secondario accoppiato ad un fluoroforo che viene eccitato a 488 nm in una diluizione 1: 2000 in PBS, per 1 ora a 4 ° C. Coprire il campione macchiato con 20 μ l di soluzione di anticorpo e incubare in una camera umida per evitare l&#39;essiccamento. </li><li> Lavare il campione 3 volte con PBS / 0,02% di Tween 20 da delicatamente e indirettamente pipettando 500 μ l di PBS sul campione. Inclinare il vetrino per lo scarico della soluzione di lavaggio in eccesso. </li><li> Coprire il campione individuato sul vetrino con un coprioggetto utilizzando 2 μ l PBS / 10% di glicerolo come mezzo di montaggio. Sigillare con smalto trasparente e conservare al -20 ºC. </li><li> Analizzare i campioni utilizzando un microscopio a fluorescenza, con un obiettivo 63x e 1.4 Aperture numerico (NA) alla lunghezza d&#39;onda di 488 nm. </li></ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of th...

Adenovirus contengono un genoma a doppio filamento di DNA che si replica nel nucleo della cellula infetta. Quando il DNA virale entra nel nucleo, localizza adiacente PML corpi nucleari 1. A seguito di espressione genica virale precoce, l&#39;architettura nucleare è drammaticamente riorganizzato, inducendo la formazione di microambienti virali, chiamato Compartimenti replicazione virale (RC) 2. Dal adenovirus (Ad) RC sono i siti dove la replicazione virale e l&#39;espressione del genoma di geni virali in ritardo si svolgono, forniscono un ambiente per l&#39;assunzione di tutti i fattori virali e cellulari necessari che partecipano a questi processi. È interessante notare che una varietà di proteine ​​cellulari responsabili per la risposta antivirale cellulare, come risposta al danno del DNA, la risposta immunitaria innata e soppressione del tumore sono co-scelto di questi siti virali 2. Mozzi normativi Quindi, Annuncio RC può essere considerato che promuovono la replicazione virale efficiente, in concomitanza regolazione delrisposta antivirale cellulare, indicando che queste strutture sono la chiave per la comprensione delle interazioni delle cellule virus-ospite. Tuttavia, i meccanismi molecolari della formazione di RC, la loro composizione e le attività connesse sono poco conosciute. Adenovirale RC, nonché RC da altri virus DNA che si replicano nel nucleo non sono associati alle membrane, in contrasto con RC citoplasmatica 3. Inoltre, queste strutture virus indotta sono suscettibili di essere composto interamente di proteine ​​e acidi nucleici. RC formata in cellule infettate con virus a RNA (di solito chiamato fabbriche virali) sono stati isolati, approfittando della loro localizzazione citoplasmatica e lo status di membrana, che ha facilitato il loro morfologica dettagliata, caratterizzazione funzionale e biochimico 4. A nostra conoscenza, RC virale nucleare non sono stati isolati, forse a causa della complessità dell&#39;architettura nucleare e assenza di m intranucleariembranes che potrebbero agevolare il loro isolamento. Il loro studio si è basata invece su immunofluorescenza, FISH e microscopia elettronica a trasmissione. Tuttavia, nonostante le complicazioni inerenti a isolare strutture subnucleari, altri domini nucleari come nucleoli ed Enti Cajal sono stati isolati prima di 5,6. Poiché nucleoli e RC sono entrambi composti di proteine ​​e acidi nucleici, e hanno un diametro compreso tra 0,5 - 5 micron, abbiamo ipotizzato che RC dovrebbe anche essere suscettibili di isolamento. Pertanto, al fine di caratterizzare più precisamente la composizione molecolare e funzioni associate RC, abbiamo stabilito un nuovo metodo per isolare frazioni subnucleari arricchite con telecomando. A tal fine, abbiamo preparato sub-nucleare frazioni utilizzando gradienti di velocità e cuscini saccarosio simili a procedure utilizzate per isolare nucleoli 7 o altri domini nucleari 6 e stabilito un sistema non cellulare che permette lo studio della composizione molecolare e le attività connesse diRC. Questa tecnica dovrebbe quindi avanzare la comprensione delle interazioni delle cellule virus e ospite e rappresenta un potente strumento che dovrebbe anche facilitare l&#39;analisi dettagliata di RC da altri virus che si replicano nel nucleo e indurre la formazione di compartimenti replica di dimensioni simili a quelle costituite in adenovirus- cellule infettate, come, herpesvirus, papillomavirus o poliomavirus.

<table border="0">
	<tbody>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>12100-046</td>
			<td>Warm in 37 &#186;C water bath before use</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Gibco</td>
			<td>12484-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose, Ultra Pure</td>
			<td>Research Organics</td>
			<td>0928S</td>
			<td>Prepare a 2.55 M stock solution and store at 4 &#186;C</td>
		</tr>
		<tr>
			<td>Dounce homogenizer</td>
			<td>Kontess Glass Company</td>
			<td>884900-0000</td>
			<td></td>
		</tr>
		<tr>
			<td>Branson 1800 Ultrasonic Bath</td>
			<td>Branson</td>
			<td>Z769533&#160;SIGMA</td>
			<td>Turn on 15 min before use.</td>
		</tr>
		<tr>
			<td>Peroxidase AffiniPure F(ab&#39;)&#8322; Fragment Goat Anti-Mouse IgG (H+L)</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-036-003</td>
			<td>Use at a 1:10,000 dilution in PBS/0.03% non-fat milk</td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td>
			<td>Life Technologies</td>
			<td>A-21121</td>
			<td>Use at a 1:2,000 dilution in PBS</td>
		</tr>
		<tr>
			<td>Silane-Prep Slides</td>
			<td>Sigma</td>
			<td>S4651-72EA</td>
			<td>Open in a laminar flow cabinet</td>
		</tr>
		<tr>
			<td>SuperSignal West Pico Chemiluminescent Substrate</td>
			<td>Pierce ThermoScientific</td>
			<td>34080</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

Poiché compartimenti di replicazione virale (RC) sono strutture virale indotta subnucleari composte da proteine ​​e acidi nucleici, in modo simile ad altri domini nucleari, hanno dimostrato di essere suscettibili di isolamento dai gradienti di velocità basati su caratteristiche biochimiche. Passaggi critici nel protocollo di frazionamento sono illustrati nella Figura 1. Ad ogni passo i campioni devono essere monitorati mediante microscopia in campo chiaro per garantire l&#39;integ...

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

Isolamento di frazioni sub-nucleare virale replica Vano-arricchite da Adenovirus-infetti cellule normali umane

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Research

JoVE Journal

Immunology and Infection

8.7K Views.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

Video: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

Isolamento di varianti di virus RNA Fidelity e caratterizzazione di frequenza Virus Mutation

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Ricerca

Immunologia e infezioni

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Estrazione di DNA virale da nucleocapsidi

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

Creazione di un liquido coperto Cultura polarizzata Airway epiteliali umane Calu-3 celle per studio cellulare risposta dell&#39;ospite agli agenti patogeni delle vie respiratorie<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Isolation of Myeloid Dendritic Cells and Epithelial Cells from Human Thymus

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen presenting cell (APC) types found in a normal thymus and it is well established that they play distinct roles during thymic selection. These cells are localized in distinct microenvironments in the thymus and each APC type makes up only a minor population of cells. To further understand the biology of these cell types, characterization of these cell populations is highly desirable but due to their low frequency, isolation of any of these cell types requires an efficient and reproducible procedure. This protocol details a method to obtain cells suitable for characterization of diverse cellular properties. Thymic tissue is mechanically disrupted and after different steps of enzymatic digestion, the resulting cell suspension is enriched using a Percoll density centrifugation step. For isolation of myeloid DC (CD11c+), cells from the low-density fraction (LDF) are immunoselected by magnetic cell sorting. Enrichment of TEC populations (mTEC, cTEC) is achieved by depletion of hematopoietic (CD45hi) cells from the low-density Percoll cell fraction allowing their subsequent isolation via fluorescence activated cell sorting (FACS) using specific cell markers. The isolated cells can be used for different downstream applications.

This protocol details a method to isolate antigen presenting cells from human thymus via different steps of enzymatic digestion of the tissue followed by density centrifugation of the single cell suspension and finally magnetic and/or FACS sorting of the cell populations of interest.

Isolamento di cellule dendritiche mieloidi e cellule epiteliali di timo umano

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these glycoprotein &#8216;spikes&#8217; is often technically challenging but important for understanding viral pathogenesis and in drug design. Here, a protocol is presented for viral spike structure determination through computational averaging of electron cryo-tomography data. Electron cryo-tomography is a technique in electron microscopy used to derive three-dimensional tomographic volume reconstructions, or tomograms, of pleomorphic biological specimens such as membrane viruses in a near-native, frozen-hydrated state. These tomograms reveal structures of interest in three dimensions, albeit at low resolution. Computational averaging of sub-volumes, or sub-tomograms, is necessary to obtain higher resolution detail of repeating structural motifs, such as viral glycoprotein spikes. A detailed computational approach for aligning and averaging sub-tomograms using the Jsubtomo software package is outlined. This approach enables visualization of the structure of viral glycoprotein spikes to a resolution in the range of 20-40 &#197; and study of the study of higher order spike-to-spike interactions on the virion membrane. Typical results are presented for Bunyamwera virus, an enveloped virus from the family Bunyaviridae. This family is a structurally diverse group of pathogens posing a threat to human and animal health.

An approach is presented for determining structures of viral membrane glycoprotein complexes using a combination of electron cryo-tomography and sub-tomogram averaging with the computational package Jsubtomo.

Della media di Viral Busta Glicoproteina Spikes da Electron Cryotomography Ricostruzioni con Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Isolation of Leukocytes from the Human Maternal-fetal Interface

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua parietalis). This interface is the anatomical site of contact between maternal and fetal tissues; therefore, it is an immunological site of action during pregnancy. Infiltrating leukocytes at the maternal-fetal interface play a central role in implantation, pregnancy maintenance, and timing of delivery. Therefore, phenotypic and functional characterizations of these leukocytes will provide insight into the mechanisms that lead to&#160;pregnancy disorders. Several protocols have been described in order to isolate infiltrating leukocytes from the decidua basalis and decidua parietalis; however, the lack of consistency in the reagents, enzymes, and times of incubation makes it difficult to compare these results. Described herein is&#160;a novel approach that combines the use of gentle mechanical and enzymatic dissociation techniques to preserve the viability and integrity of extracellular and intracellular markers in leukocytes isolated from the human tissues at the maternal-fetal interface. Aside from immunophenotyping, cell culture, and cell sorting, the future applications of this protocol are numerous and varied. Following this protocol, the isolated leukocytes can be used to determine DNA methylation, expression of target genes, in vitro leukocyte functionality (i.e., phagocytosis, cytotoxicity, T-cell proliferation, and plasticity, etc.), and the production of reactive oxygen species at the maternal-fetal interface. Additionally, using the described protocol, this laboratory has been able to describe new and rare leukocytes at the maternal-fetal interface.

Described herein is a protocol to isolate and further study the infiltrating leukocytes of the decidua basalis and decidua parietalis - the human maternal-fetal interface. This protocol maintains the integrity of cell surface markers and yields enough viable cells for downstream applications as proven by flow cytometry analysis.

L&#39;isolamento dei leucociti di Human Interface materno-fetale

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua ...

Isolation of Sertoli Cells and Peritubular Cells from Rat Testes

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of puberty - more than ten years after the establishment of systemic immune tolerance. Spermatogenic cells express a number of proteins that may be seen as non-self by the immune system. The testis must then be able to establish tolerance to these neo-antigens on the one hand but still be able to protect itself from infections and tumor development on the other hand. Therefore the testis is one of a few immune privileged sites in the body that tolerate foreign antigens without evoking a detrimental inflammatory immune response. Sertoli cells play a key role for the maintenance of this immune privileged environment of the testis and also prolong survival of cotransplanted cells in a foreign environment. Therefore primary Sertoli cells are an important tool for studying the immune privilege of the testis that cannot be easily replaced by established cell lines or other cellular models. Here we present a detailed and comprehensive protocol for the isolation of Sertoli cells - and peritubular cells if desired - from rat testes within a single day.

Primary Sertoli cells are required for studying testis-immune privilege, signal transduction during inflammation or infection, and utilization of their immunoprotective properties. Here we describe an enzyme-based protocol for the isolation of highly purified primary Sertoli cells and peritubular cells from rat testes.

Isolamento delle cellule di Sertoli e peritubulari cellule da Rat testicoli

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the person-to-person route or indirectly through environmental surfaces or food, contaminated fomites and inanimate surfaces are important vehicles for the spread of the virus during norovirus outbreaks.
We developed and evaluated a protocol using macrofoam swabs for the detection and typing of human noroviruses from hard surfaces. Compared with fiber-tipped swabs or antistatic wipes, macrofoam swabs allow virus recovery (range 1.2-33.6%) from toilet seat surfaces of up to 700 cm2. The protocol includes steps for the extraction of the virus from the swabs and further concentration of the viral RNA using spin columns. In total, 127 (58.5%) of 217 swab samples that had been collected from surfaces in cruise ships and long-term care facilities where norovirus gastroenteritis had been reported tested positive for GII norovirus by RT-qPCR. Of these 29 (22.8%) could be successfully genotyped. In conclusion, detection of norovirus on environmental surfaces using the protocol we developed may assist in determining the level of environmental contamination during outbreaks as well as detection of virus when clinical samples are not available; it may also facilitate monitoring of effectiveness of remediation strategies.

A macrofoam based sampling methodology was developed and evaluated for the detection and quantification of norovirus on environmental hard surfaces.

Tampone Metodo di campionamento per la rilevazione di Norovirus umana sulle superfici

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

Isolation of Dendritic Cells from the Human Female Reproductive Tract for Phenotypical and Functional Studies

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low numbers of DCs present per tissue. Yet, as the phenotype and function of DCs is modified by the tissue environment, it is necessary to analyze tissue resident DC populations, since blood derived DCs incompletely reflect the complexities of DCs in tissues. Here we present a protocol to isolate DCs from the human female reproductive tract (FRT) using hysterectomy specimens that allows both phenotypical and functional analyses. The protocol consists of tissue digestion to generate a single cell mixed cell suspension, followed by positive magnetic bead selection. Our tissue digestion protocol does not cleave surface markers, which allows phenotypical and functional analysis of DCs in the steady state, without overnight incubation or cell activation. This protocol can be adapted for the isolation of other immune cell types or isolation of DCs from other tissues.

We describe here a method to isolate and purify dendritic cells from different anatomical compartments in the human female reproductive tract for the evaluation of their phenotypical and functional characteristics. This method can be adapted to isolate other immune cells or dendritic cells from other mucosal tissues.

Isolamento di cellule dendritiche dal tratto riproduttivo femminile umano per studi fenotipici e funzionali

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor response to insulin, local hypoxia, and inflammation. By stimulating the differentiation of functional white adipocytes from progenitors, radical hypertrophy of the adipocyte population can be prevented and, consequently, the metabolic health of adipose tissue can be improved along with a reduction of inflammation. Also, by stimulating a differentiation of beige/brown adipocytes, the total body energy expenditure can be increased, resulting in weight loss. This approach could prevent the development of obesity co-morbidities such as type 2 diabetes and cardiovascular disease.
This paper describes the isolation, expansion, and differentiation of white and beige adipocytes from a subset of human adipose tissue endothelial cells that co-express the CD31 and CD34 markers. The method is relatively cheap and is not labor-intensive. It requires access to human adipose tissue and the subcutaneous depot is suitable for sampling. For this protocol, fresh adipose tissue samples from morbidly obese subjects [body mass index (BMI) &#62;35] are collected during bariatric surgery procedures. Using a sequential immunoseparation from the stromal vascular fraction, enough cells are produced from as little as 2&#8211;3 g of fat. These cells can be expanded in culture over 10&#8211;14 days, can be cryopreserved, and retain their adipogenic properties with passaging up to passage 5&#8211;6. The cells are treated for 14 days with an adipogenic cocktail using a combination of human insulin and the PPAR&#947; agonist-rosiglitazone.
This methodology can be used for obtaining proof of concept experiments on molecular mechanisms that drive adipogenic responses in adipose endothelial cells, or for screening new drugs that can enhance the adipogenic response directed either towards white or beige/brown adipocyte differentiation. Using small subcutaneous biopsies, this methodology can be used to screen out non-responder subjects for clinical trials aimed to stimulate beige/brown and white adipocytes for the treatment of obesity and co-morbidities.

The differentiation of white and beige adipocytes from adipose tissue vascular progenitors bears potential for metabolic improvement in obesity. We describe protocols for a CD34+CD31+ endothelial cell isolation from human fat and for a subsequent in vitro expansion and differentiation into white and beige adipocytes. Several downstream applications are discussed.

Isolamento, espansione e adipogenico induzione di CD34 + CD31 + cellule endoteliali dal tessuto adiposo umano omentale e sottocutaneo

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...