Clinical and Translational Science Award program of NCATS UL1 TR0000427 and KL2 TR000428 (Cengiz P), UL1TR000427 to the UW ICTR from NIH/NCATS and funds from Waisman Center (Cengiz P), K08 NS088563-01A1 from NINDS (Cengiz P) and NIH P30 HD03352 (Waisman Center), NIH/NINDS 1K08NS078113 (Ferrazzano P). We would like to thank Albee Messing, PhD, for providing us the GFAP knockout mice.

NOTA: Questo studio è stato condotto in conformità con la raccomandazione della Guida per la cura e l&#39;uso di animali da laboratorio del National Institute of Health. Il protocollo animale è stato approvato dalla University of Wisconsin-Madison, Institutional Animal Care e del Comitato Usa. Primaria protocollo cultura astrociti che viene qui presentata è adottato dai protocolli presentati da Zhang Y 19 et al. E Cengiz P 20 et al., Con alcune modifiche. 1. ippocampale dissezione e la cultura astrociti <ol><li> Preparare tutti i reagenti e materiali necessari, tra cui forbici chirurgiche, una pinza sottile liscia, pinze punta piatti, tovaglioli di carta, il sacchetto dei rifiuti, il 70% di etanolo e 2 piatti dissezione (3,5 centimetri di diametro) sul ghiaccio riempito con 2 Soluzione di ml Hank salina bilanciata (HBSS) ogni . Assicurarsi che il apparecchi chirurgici sono sterili (autoclave) prima procedura e usare tutti gli altri materiali (astrociti placcatura media: siero DMEM + 5% di cavallo +1% di penicillina-streptomicina, siero di cavallo, HBSS, 0,25% tripsina, vetrini, piastre di Petri, 15/50 mL, fiasche T25, etc.) come pre-sterile. </li><li> Delicatamente tenere e spruzzare la testa e il collo del cucciolo del mouse con il 70% di etanolo e decapitare con le forbici sterili affilate [Figura 1 (1)]. </li><li> Eseguire un&#39;incisione mediana da posteriore ad anteriore cranio con piccole forbici lungo il cuoio capelluto per esporre il cervello [Figura 1 (2-3)]. </li><li> Tagliare il cranio con cura dal collo al naso con piccole forbici. Poi tagliare cranio anteriore ai bulbi olfattivi e inferiore al cervelletto per scollegare il cranio dalla base del cranio. </li><li> Fai una piccola incisione alla base del cranio e tagliare lungo la linea mediana. Utilizzare sterili pinze a punta piatta a staccarsi il cranio. Rimuovere il tronco cerebrale con l&#39;aiuto di una pinza curve. Rimuovere il cervello dal cranio e posto in primo piatto dissezione [Figura 1 (4-9)] 21. </li><li> Utilizzando una pinza curva, capovolgere il cervello in modo che la superficie ventrale del cervello è rivolto verso l&#39;alto e poi separare entrambi gli emisferi con una lama chirurgica sterile tagliente [Figura 1 (10,11)] </li><li> Staccare gli emisferi cerebrali e rimuovere con attenzione il tessuto mesencefalo e del talamo sporgenti con una sterile pinze curve piatte a rivelare l&#39;ippocampo, una piccola struttura a forma di cavalluccio marino nel lobo temporale mediale [Figura 1 (12-14)]. </li><li> Rimuovere entrambi i lobi dell&#39;ippocampo [Figura 1 (15,16)] e sezionare con attenzione le meningi dai lobi tirando con le belle pinze. Questo passaggio consente di evitare la contaminazione della cultura finale astrociti dalle cellule meningee e fibroblasti. </li><li> Trasferire i lobi dell&#39;ippocampo preparati nel secondo piatto pieno di HBSS e riportarlo sul ghiaccio [Figura 1 (17,18)]. Pool sia dell&#39;ippocampo lobi da un singolo mouse (P0 - P2) per la preparazione di Ipponaculture Campal astrociti. Questo dà la giusta densità astrociti. Tritare lobi dell&#39;ippocampo usando una lama affilata chirurgico sterile (circa 4 volte). </li><li> Aspirare HBSS da piatto con una punta sterile, collegato a un mL pipetta 1 e aggiungere 3 ml di 0,25% tripsina, mescolare, trasferire in un tubo conico sterili 15 ml e incubare il tessuto a 37 ° C per 20 minuti agitando delicatamente. </li><li> tubo Centrifugare a 300 xg per 5 min. Aspirare il surnatante con cura utilizzando una pipetta di vetro sterile, collegato a una linea di vuoto. Aggiungere 10 ml astrociti placcatura medio e triturare (20 - 30 volte) utilizzando un incendio lucidato pipetta di vetro fino a pezzi di tessuto omogeneizzare. </li><li> tubo Centrifugare a 300 xg per 5 min. Aspirare il surnatante e aggiungere 2 ml di mezzi astrociti placcatura preriscaldata fresco. Passare cellule attraverso un filtro a maglia 70 micron (colino cella) in un nuovo tubo da 50 ml. </li><li> intera sospensione cellulare piastra su un pallone di coltura T25 sterile Poly-D-lisina / laminina rivestito contenente 3 mL dimezzi astrociti placcatura, poi incubare il pallone a 37 ° C in un incubatore CO 2 5%. </li><li> Aspirare tutta la media al giorno- I n-vitro (DIV) 1, DIV 3 e DIV 7, e sostituirlo con 2 ml di mezzi freschi astrociti placcatura. Osservare la progressione e la confluenza astrocitari sotto microscopio ottico ogni volta che durante la sostituzione del supporto astrociti placcatura. NOTA: A DIV 1, tutti gli astrociti vitali sono attaccati alla superficie del pallone di coltura e le cellule morte o morenti che includono i neuroni sono galleggianti nel supernatante. A DIV 3, le cellule attaccate iniziano a dividersi per formare lo strato di cellule astrociti. In assenza di condizioni favorevoli, cultura è quasi privo di crescita neuronale. A DIV 7, strato astrociti è circa 80 - 90% confluenti e pochi microglia e cellule precursori degli oligodendrociti sono presenti sulla parte superiore dello strato di astrociti. </li><li> Aspirare il mezzo di placcatura dal pallone, aggiungere 2 ml di preriscaldata astrociti placcatura mezzo fresco, sciacquare unND rimuovere di nuovo a DIV 11, quando gli astrociti sono confluenti e pronti per sub coltura. </li><li> Aggiungere 2 ml di 0,25% tripsina, delicatamente ruotare il pallone un paio di volte e aspirare tripsina usando una pipetta di vetro sterile. </li><li> Aggiungere 2 ml di 0,25% tripsina e lasciare che il pallone sedersi nella cappa coltura di tessuti per 4-5 minuti a temperatura ambiente. </li><li> Rimuovere la tripsina e mantenere il matraccio a 37 ° C in un incubatore CO 2 5% per 10 min. Aggiungere 5 ml preriscaldata astrociti placcatura medio e staccare lo strato di astrociti toccando il pallone contro il palmo della mano (3 - 4 volte), seguito da dolce triturazione per ottenere completo distacco e raccogliere i astrociti in un tubo da 15 ml. </li><li> provetta da centrifuga a 300 xg per 5 minuti, aspirare il surnatante e aggiungere 1 ml di media astrociti fresco placcatura. </li><li> Aggiungere 10 ml di sospensione cellulare per un emocitometro e contare le cellule nella grande area centrale reticolata (1 mm 2) usando un microscopio a contrasto di fase invertita (obiettivo 10X). Multiply da 10 4 per stimare il numero di cellule per ml. Un pallone T25 produrrà ~ 1 x 10 6 cellule totali dissociato. Seed ~ 1 x 10 5 cellule in 2 ml astrociti medio placcatura in 12 mm di diametro Poly-D-lisina coprioggetto vetro preverniciato nel pozzo di un piatto della cultura 24 pozzetti. </li><li> Incubare a 37 ° C in un incubatore CO 2 5%. Eseguire OGD / Reox a DIV 12 - 14 (sezione 2). </li><li> Trattare le colture di astrociti in DIV 3 con 5 mM estere metilico (LME) cloridrato L-leucina fino DIV 11 se si desiderano culture ippocampali privi di microglia. Dopo LME incubazione, culture soggetti a agitazione (300 rpm per 1 ora) per rimuovere la contaminazione microglia. NOTA: LME è un agente citotossico microglia che è stato ampiamente utilizzato come metodo per eliminare proliferanti microglia 22. </li></ol> 2. OGD / Trattamento Reox <ol><li> supporti Aspirare dal vetrino contenenti cultura astrociti aderente (DIV 12 - 14) e risciacquare 3 volteruotando delicatamente la cultura piatto 24 pozzetti tenendo il vetrino un paio di volte con 1 mL di soluzione isotonica OGD (pH 7,4) contenente (in mm): 0 di glucosio, 21 NaHCO 3, 120 NaCl, 5,36 KCl, 0,33 Na 2 HPO 4, 0.44 KH 2 PO 4, 1.27 CaCl 2, e 0,81 MgSO 4. </li><li> Aggiungere 0,2 mL di soluzione OGD per bene per coprire il vetrino e incubare per 2 ore in un incubatore ipossico contenente il 94% N 2, 1% O 2 e il 5% di CO 2. Mescolare delicatamente con un agitatore orbitale (50 rpm) per i primi 30 min di ipossia per facilitare lo scambio di gas. </li><li> Incubare le cellule di controllo normossiche per 2 h in 5% CO 2 e aria atmosferica in un buffer identica alla soluzione OGD eccetto per l&#39;aggiunta di 5,5 mM di glucosio. </li><li> Per Reox, aspirare la soluzione OGD e aggiungere 2 ml di astrociti placcatura media. Incubare in 5% CO 2 e aria atmosferica a 37 ° C per 5 ore. </li></ol> 3. Immunocytochemical colorazione &lt;/ P&gt; <ol><li> Aspirare il terreno di coltura usando una pipetta di vetro sterile, collegato a una linea di vuoto e sciacquare rapidamente vetrino una volta con l&#39;aggiunta di 1 ml di 0,1 M Tris Buffered Saline (TBS) (154 mM NaCl, 16 mm Trizma Base, 84 mM Tris-HCl, pH 7,4) al pozzo. Aspirare e aggiungere 2 ml di 4% paraformaldeide (PFA) in 1x tampone fosfato (PBS). Incubare per 15 minuti a RT. </li><li> Aspirare e aggiungere 1 ml di 0,1 M TBS, poi posto su un agitatore a dondolo per 2 minuti. Ripetere 3 volte. Aggiungere 1 mL soluzione bloccante (10% siero di capra, 10 mg / ml BSA, 0,025% Triton X-100 in 0,1 M TBS) e incubare per 30 min a 37 ° C su un agitatore dondolo. </li><li> Aspirare soluzione bloccante e aggiungere monoclonale primario del mouse anticorpo anti-GFAP (0,2 mL di una diluizione 1: 500 in soluzione bloccante) e policlonali di coniglio anti-S100B (1: 500) o policlonale di coniglio anti-HIF1α (1: 200) per 60 min a 37 ° C su un agitatore dondolo. </li><li> In alternativa, alcuni astrociti vengono incubate con policlonale di coniglio anti-Iba1 (1: 200) e mon il mouseoclonal anti-MAP2 di accedere alla cultura purezza. </li><li> Aspirare anticorpo primario e risciacquare vetrino con l&#39;aggiunta di 1 ml di 0,1 M TBS e mettendo su un agitatore a dondolo per 2 minuti e poi aspirare. Ripetere due volte. </li><li> Aggiungere 0,2 ml di una diluizione 1: 200 di capra anti-coniglio secondaria 488-coniugati e anti-topo anticorpi 568 coniugati nel bloccare soluzione per 60 min a 37 ° C su un agitatore dondolo. </li><li> Aspirare anticorpo secondario e risciacquare vetrino con l&#39;aggiunta di 1 ml di 0,1 M TBS e posto su un agitatore a dondolo per 2 minuti e poi aspirare. Ripetere due volte. </li><li> Rimuovere vetrino da ben asciutta e mettendo su una diapositiva posizionato su una slide-asciugatrice. Monte vetrino su una nuova diapositiva invertendo su una sola goccia di Vectashield hardset mezzo di montaggio con DAPI (1,5 ng / mL). </li><li> coprioggetto di immagine su un microscopio confocale utilizzando 20X obiettivo olio secco o 60X. Acquisire le immagini (512 x 512) per DAPI (405 nm ex / 450 nm em) e fluorocromo 488 tagged anticorpi GFAP (488 nm ex / 515 nmem). Mantenere parametri di acquisizione costanti all&#39;interno del 20X e 60X gruppi. </li></ol> 4. determinazione del sesso Usando PCR <ol><li> Calore pup punta o ritagli di barretta a 95 ° C per 45 min a 50 mM NaOH e neutralizzare con pari volume di 1 M Tris, pH 6,8. </li><li> Aggiungere 1 ml di soluzione di DNA estratto da 19 ml della seguente miscela: 5 pmoli di primer per i geni Myog e Sry, tampone di reazione 1x, 0,2 millimetri ogni deossinucleotide e 8 U Taq polimerasi. </li><li> Utilizzare primer sequenze; Sry 5&#39;TCATGAGACTGCCAACCACAG3 &#39;, 5&#39;CATGACCACCACCACCACCAA3&#39; e Myog 5&#39;TTACGTCCATCGTGGACAGC3 &#39;, 5&#39;TGGGCTGGGTGTTAGTCTTA3&#39; 23. </li><li> Eseguire il seguente protocollo PCR: 95 ° C per 3 min quindi 30 cicli di denaturazione a 95 ° C per 15 s, ricottura a 58 ° C per 15 s, e l&#39;allungamento a 72 ° C per 1 min. Dopo questi 30 cicli, la reazione si conclude con un finale C elongazione 72 ° per 1 min. </li><li> PC separatoR prodotti elettroforesi su gel di agarosio etidio bromuro contenente 2% e visualizzare sotto illuminazione UV. (Figura 2A.) ATTENZIONE! Etidio bromuro è un potenziale cancerogeno e deve essere maneggiata con cura e smaltito correttamente come da regolamento dell&#39;istituzione. </li></ol>

<ol>
	<li>Powell, E. M., Geller, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+astrocyte-mediated+cues+in+neuronal+guidance+and+process+extension.">Dissection of astrocyte-mediated cues in neuronal guidance and process extension.</a> Glia. 26, 73-83 (1999).</li><li>Koehler, R. C., Roman, R. J., Harder, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytes+and+the+regulation+of+cerebral+blood+flow.">Astrocytes and the regulation of cerebral blood flow.</a> Trends in neurosciences. 32, 160-169 (2009).</li><li>Seifert, G., Schilling, K., Steinhauser, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocyte+dysfunction+in+neurological+disorders:+a+molecular+perspective.">Astrocyte dysfunction in neurological disorders: a molecular perspective.</a> Nature reviews. Neuroscience. 7, 194-206 (2006).</li><li>Ballabh, P., Braun, A., Nedergaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+blood-brain+barrier:+an+overview:+structure,+regulation,+and+clinical+implications.">The blood-brain barrier: an overview: structure, regulation, and clinical implications.</a> Neurobiology of disease. 16, 1-13 (2004).</li><li>Araque, A., Parpura, V., Sanzgiri, R. P., Haydon, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tripartite+synapses:+glia,+the+unacknowledged+partner.">Tripartite synapses: glia, the unacknowledged partner.</a> Trends in neurosciences. 22, 208-215 (1999).</li><li>Anderson, M. A., Ao, Y., Sofroniew, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+reactive+astrocytes.">Heterogeneity of reactive astrocytes.</a> Neuroscience letters. 565, 23-29 (2014).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Na+/H++exchanger+isoform+1+is+neuroprotective+in+neonatal+hypoxic+ischemic+brain+injury.">Inhibition of Na+/H+ exchanger isoform 1 is neuroprotective in neonatal hypoxic ischemic brain injury.</a> Antioxidants &amp; redox signaling. 14, 1803-1813 (2011).</li><li>Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+brain+injury.">Neonatal brain injury.</a> The New England journal of medicine. 351, 1985-1995 (2004).</li><li>Hill, C. A., Fitch, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+differences+in+mechanisms+and+outcome+of+neonatal+hypoxia-ischemia+in+rodent+models:+implications+for+sex-specific+neuroprotection+in+clinical+neonatal+practice.">Sex differences in mechanisms and outcome of neonatal hypoxia-ischemia in rodent models: implications for sex-specific neuroprotection in clinical neonatal practice.</a> Neurol Res Int. , 1-9 (2012).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERalpha+Signaling+Is+Required+for+TrkB-Mediated+Hippocampal+Neuroprotection+in+Female+Neonatal+Mice+after+Hypoxic+Ischemic+Encephalopathy(1,2,3).">ERalpha Signaling Is Required for TrkB-Mediated Hippocampal Neuroprotection in Female Neonatal Mice after Hypoxic Ischemic Encephalopathy(1,2,3).</a> eNeuro. 3, (2016).</li><li>Uluc, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TrkB+receptor+agonist+7,+8+dihydroxyflavone+triggers+profound+gender-+dependent+neuroprotection+in+mice+after+perinatal+hypoxia+and+ischemia.">TrkB receptor agonist 7, 8 dihydroxyflavone triggers profound gender- dependent neuroprotection in mice after perinatal hypoxia and ischemia.</a> CNS Neurol Disord Drug Targets. 12, 360-370 (2013).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+microglia+activation+after+hypoxia-ischemia+results+in+age-dependent+improvements+in+neurologic+injury.">Suppression of microglia activation after hypoxia-ischemia results in age-dependent improvements in neurologic injury.</a> J Neuroimmunol. 291, 18-27 (2016).</li><li>McQuillen, P. S., Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+vulnerability+in+the+developing+central+nervous+system.">Selective vulnerability in the developing central nervous system.</a> Pediatr Neurol. 30, 227-235 (2004).</li><li>Morken, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+astrocyte-neuronal+interactions+after+hypoxia-ischemia+in+the+neonatal+brain+in+female+and+male+rats.">Altered astrocyte-neuronal interactions after hypoxia-ischemia in the neonatal brain in female and male rats.</a> Stroke; a journal of cerebral circulation. 45, 2777-2785 (2014).</li><li>Chisholm, N. C., Sohrabji, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytic+response+to+cerebral+ischemia+is+influenced+by+sex+differences+and+impaired+by+aging.">Astrocytic response to cerebral ischemia is influenced by sex differences and impaired by aging.</a> Neurobiology of disease. 85, 245-253 (2016).</li><li>Liu, M., Oyarzabal, E. A., Yang, R., Murphy, S. J., Hurn, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+assessing+sex-specific+and+genotype-specific+response+to+injury+in+astrocyte+culture.">A novel method for assessing sex-specific and genotype-specific response to injury in astrocyte culture.</a> Journal of neuroscience methods. 171, 214-217 (2008).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+biological+contributions+to+human+health:+does+sex+matter?.">Exploring the biological contributions to human health: does sex matter?.</a> Journal of women's health &amp; gender-based. 10, 433-439 (2001).</li><li>Collins, F. S., Tabak, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Policy:+NIH+plans+to+enhance+reproducibility.">Policy: NIH plans to enhance reproducibility.</a> Nature. 505, 612-613 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78, 785-798 (2013).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+Na+/H++exchanger+activation+promotes+gliotransmitter+release+from+reactive+hippocampal+astrocytes+following+oxygen-glucose+deprivation.">Sustained Na+/H+ exchanger activation promotes gliotransmitter release from reactive hippocampal astrocytes following oxygen-glucose deprivation.</a> PloS one. 9, e84294 (2014).</li><li>Landis, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+call+for+transparent+reporting+to+optimize+the+predictive+value+of+preclinical+research.">A call for transparent reporting to optimize the predictive value of preclinical research.</a> Nature. 490, 187-191 (2012).</li><li>Hamby, M. E., Uliasz, T. F., Hewett, S. J., Hewett, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+an+improved+procedure+for+the+removal+of+microglia+from+confluent+monolayers+of+primary+astrocytes.">Characterization of an improved procedure for the removal of microglia from confluent monolayers of primary astrocytes.</a> J Neurosci Methods. 150, 128-137 (2006).</li><li>McClive, P. J., Sinclair, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+DNA+extraction+and+PCR-sexing+of+mouse+embryos.">Rapid DNA extraction and PCR-sexing of mouse embryos.</a> Molecular reproduction and development. 60, 225-226 (2001).</li><li>Wolterink-Donselaar, I. G., Meerding, J. M., Fernandes, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gender+determination+in+newborn+dark+pigmented+mice.">A method for gender determination in newborn dark pigmented mice.</a> Lab Anim (NY). 38, 35-38 (2009).</li><li>Uliasz, T. F., Hamby, M. E., Jackman, N. A., Hewett, J. A., Hewett, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+primary+astrocyte+cultures+devoid+of+contaminating+microglia.">Generation of primary astrocyte cultures devoid of contaminating microglia.</a> Methods Mol Biol. 814, 61-79 (2012).</li><li>Raponi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=S100B+expression+defines+a+state+in+which+GFAP-expressing+cells+lose+their+neural+stem+cell+potential+and+acquire+a+more+mature+developmental+stage.">S100B expression defines a state in which GFAP-expressing cells lose their neural stem cell potential and acquire a more mature developmental stage.</a> Glia. 55, 165-177 (2007).</li><li>Souza, D. G., Bellaver, B., Souza, D. O., Quincozes-Santos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+adult+rat+astrocyte+cultures.">Characterization of adult rat astrocyte cultures.</a> PloS one. 8, e60282 (2013).</li><li>Puschmann, T. B., Dixon, K. J., Turnley, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+reactivity+of+mouse+and+rat+astrocytes+in+vitro.">Species differences in reactivity of mouse and rat astrocytes in vitro.</a> Neuro-Signals. 18, 152-163 (2010).</li><li>Schildge, S., Bohrer, C., Beck, K., Schachtrup, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+mouse+cortical+astrocytes.">Isolation and culture of mouse cortical astrocytes.</a> Journal of visualized experiments : JoVE. , (2013).</li><li>Saura, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglial+cells+in+astroglial+cultures:+a+cautionary+note.">Microglial cells in astroglial cultures: a cautionary note.</a> J Neuroinflammation. 4 (26), (2007).</li></ol>

Nessuno degli autori sono in competizione o interessi in conflitto.

Al fine di studiare le differenze di sesso nelle proprietà e la funzione degli astrociti in condizioni fisiologiche e patologiche, la preparazione degli astrociti primari sessuati in coltura cellulare è uno strumento importante da utilizzare. Nel presente studio riportiamo un altamente efficiente e un metodo riproducibile per la cultura di una popolazione omogenea altamente arricchito di astrociti dell&#39;ippocampo sessuati da neonato (P0-P2) C57Bl / 6 (wild type) o K19F (GFAP null) cuccioli di topo in vitro.</em...

Gli astrociti sono uno dei più importanti attori chiave del sistema nervoso centrale (SNC). crescente corpo di evidenze indicano che i ruoli di astrociti sono più di sostegno neuronale. Infatti, i ruoli di astrociti in condizioni fisiologiche possono essere molto complessa, come guidare la migrazione degli assoni sviluppo 1, regolazione del flusso sanguigno CNS 2, mantenendo l&#39;omeostasi pH della sinaptica liquido interstiziale 3, e partecipando la barriera ematoencefalica 4 e 5 la trasmissione sinaptica. In condizioni patologiche, astrociti rispondono al danno con un processo chiamato astrogliosis reattiva in cui la morfologia, numero, la posizione, la topografia (rispetto alla distanza da insulto) e funzione delle astrociti possono cambiare in modo eterogeneo 6,7. Astrogliosis visto seguente neonatale encefalopatia ischemica ipossica forse contribuire alla morbilità e la mortalità dei neonati <sup&gt; 8. studi clinici e sperimentali recenti indicano che la gravità del danno cerebrale sembra essere il sesso-dipendente e che i neonati maschi sono più sensibili agli effetti di ipossia / ischemia (HI) lesione cerebrale -related, con conseguente esiti neurologici più gravi rispetto a femmine con lesioni cerebrali paragonabili 9-11. Sebbene la localizzazione della lesione dipende dall&#39;età gestazionale e la durata e la gravità dell&#39;insulto, ippocampo è una delle regioni più comunemente effettuata nel SNC dopo termine neonatale HI, e aumentato astrogliosis ippocampo è stato confermato da up-regolazione Protein fibrillare gliale acida (GFAP) 3 d dopo la HI neonatale 7,10,12,13. Differenze di genere nella funzione degli astrociti sono stati mostrati in entrambi i neonati e nei roditori adulti dopo ischemia cerebrale 14,15. Inoltre, maschio suscettibilità astrociti di ischemia in vitro è stato dimostrato da un aumento cell morte rispetto ai astrociti corticali femminili nella cultura 16. Differenze di sesso iniziano in utero e continuare fino alla morte 17. Negli ultimi dieci anni, l&#39;importanza di includere i sessi in condizioni sperimentali in coltura cellulare e in vivo studi sono stati l&#39;enfasi dell &#39;Istituto di Medicina e NIH di cercare la conoscenza fondamentale nelle differenze di sesso visto in condizioni fisiologiche e patologiche 17,18 . Sviluppo di metodi affidabili di isolare e mantenere popolazioni di sessuato astrociti dell&#39;ippocampo è essenziale per comprendere le basi cellulare di differenze di sesso e le conseguenze patologiche di HI neonatale. Il presente studio è stato progettato per fornire le tecniche per preparare culture dell&#39;ippocampo astrociti sesso-specifici arricchito da topi appena nati al fine di valutare il ruolo degli astrociti GFAP-immunoreattive seguenti ossigeno / glucosio Deprivation (OGD) e riossigenazione (Reox), inducendoHI in ambiente di coltura cellulare. Questa tecnica può essere utilizzata per testare qualsiasi ipotesi di pertinenza astrociti dell&#39;ippocampo nei maschi e nelle femmine neonatali in condizioni normossiche e ischemiche.

<table><tbody><tr><td>&lt;strong&gt;&lt;em&gt;Astrocyte culture media&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DMEM, high glucose</td><td>cellgro</td><td>10-013-CV</td><td></td></tr><tr><td>Horse Serum</td><td>Gibco</td><td>26050-070</td><td>Final Concentration: 10%</td></tr><tr><td>Penicillin-Streptomycin</td><td>Cellgro&amp;nbsp;</td><td>30-002-CI</td><td>Final Concentration: 1%</td></tr><tr><td>L-Leucine methyl ester hydrochloride</td><td>Aldrich</td><td>L1002-25G</td><td>Final Concentration: 5 mM</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Solution for brain tissue digestion&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HBSS</td><td>Life Technologies</td><td>14170-088</td><td></td></tr><tr><td>Trypsin</td><td>cellgro</td><td>25-050-CI</td><td>Final Concentration: 0.25%</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Other&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>70% (vol/vol) ethanol</td><td>Roth</td><td>9065.2</td><td></td></tr><tr><td>Poly-D-Lysine (PDL) 12 mm round coverslips&amp;nbsp;</td><td>Corning</td><td>354087</td><td></td></tr><tr><td>Water</td><td>Sigma</td><td>W3500</td><td>Cell-culture grade</td></tr><tr><td>PBS</td><td>cellgro</td><td>21-040-CV</td><td>Cell-culture grade</td></tr><tr><td>0.05% Trypsin-EDTA&amp;nbsp;</td><td>Life Technologies</td><td>25300-062</td><td></td></tr><tr><td>70 &amp;mu;m Sterile cell strainer&amp;nbsp;</td><td>Fisher scientific</td><td>22363548</td><td></td></tr><tr><td>3.5 cm Petri dish</td><td>BD Falcon</td><td>353001</td><td></td></tr><tr><td>15 mL Falcon tube</td><td>BD Falcon</td><td>352096</td><td></td></tr><tr><td>50 mL Falcon tube</td><td>BD Falcon</td><td>352070</td><td></td></tr><tr><td>Forceps, fine&amp;nbsp;</td><td>Dumont</td><td>2-1032; 2-1033</td><td># 3c; # 5</td></tr><tr><td>Forceps, flat tip</td><td>KLS Martin</td><td>12-120-11</td><td></td></tr><tr><td>13 cm surgical scissors</td><td>Aesculap</td><td>BC-140-R</td><td></td></tr><tr><td>Confocal Microscope</td><td>Nikon</td><td>A1RSi&amp;nbsp;</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5805000.017</td><td>5804R</td></tr><tr><td>Orbital Shaker</td><td>Thermo Scientific</td><td>SHKE 4450-1CE</td><td>MaxQ 4450&amp;nbsp;</td></tr><tr><td>Anti-IBA1</td><td>Wako</td><td>019-19741</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-MAP2</td><td>Sigma</td><td>M2320</td><td>Mouse monoclonal</td></tr><tr><td>Anti-HIF1alpha</td><td>abcam</td><td>ab179483</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-S100B</td><td>Sigma</td><td>HPA015768</td><td>Rabbit polyclonal</td></tr><tr><td>Anti-GFAP (cocktail)</td><td>Biolegend</td><td>837602</td><td></td></tr><tr><td>VECTASTAIN Elite ABC Kit (Rabbit IgG)</td><td>Vector Labs</td><td>PK-6101</td><td>Contains 4 Reagents&amp;nbsp;</td></tr><tr><td>Goat Anti Rabbit Alexa-Fluor 488</td><td>Invitrogen</td><td>A11070</td><td></td></tr><tr><td>Goat Anti Mouse Alexa-Fluor 568</td><td>Invitrogen</td><td>A11004</td><td></td></tr></tbody></table>

sex differences in mouse hippocampal astrocytes after in-vitro ischemia

Astrogliosis seguente ipossia / ischemia (HI) lesione cerebrale -related svolge un ruolo in un aumento della morbilità e mortalità nei neonati. Recenti studi clinici indicano che la gravità della lesione cerebrale sembrano essere il sesso dipendente, e che i neonati maschi sono più sensibili agli effetti di lesioni cerebrali HI-correlati, con conseguente esiti neurologici più gravi rispetto alle femmine con lesioni cerebrali simili. Lo sviluppo di metodi affidabili per isolare e mantenere le popolazioni altamente arricchito di sessuato astrociti dell&#39;ippocampo è essenziale per comprendere la base cellulare di differenze di sesso e le conseguenze patologiche di HI neonatale. In questo studio, si descrive un metodo per la creazione di specifiche culture astrociti dell&#39;ippocampo di sesso che sono sottoposti a un modello di ischemia in vitro, deprivazione di ossigeno e glucosio, seguito da riossigenazione. Successivamente astrogliosi reattiva è stata esaminata dal immunostaining per la proteina acida fibrillare gliale (GFAP) e S100B. Questo metodo fornisce un utile strumento per studiare il ruolo del maschio e astrociti dell&#39;ippocampo femminili seguente neonatale HI, separatamente.

La comprensione dei ruoli delle funzioni astrociti sessuati in condizioni fisiologiche o fisiopatologiche sono stati immensamente chiarito coltivando queste cellule in condizioni in vitro. L&#39;aspetto importante di eseguire coltura sessuato è quello di determinare il sesso del cucciolo del mouse prima del suo utilizzo. Abbiamo determinato il sesso del topo geneticamente mediante PCR e dalla valutazione visiva (Figura 2) 16. La metodologia di determ...

Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Gli astrociti sono uno dei più importanti attori chiave del sistema nervoso centrale (SNC). Qui, stiamo riportando un metodo pratico di sessuato dell&#39;ippocampo protocollo cultura astrociti al fine di studiare i meccanismi alla base della funzione degli astrociti in cuccioli di neonato maschio e femmina dopo ischemia in vitro.

Le differenze di sesso in ippocampali di topo astrociti dopo<em&gt; In-Vitro</em&gt; Ischemia

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies ...

sex-differences-mouse-hippocampal-astrocytes-after-vitro

Research

JoVE Journal

Neuroscience

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

13.3K Views.  University of Wisconsin.  Gli astrociti sono uno dei più importanti attori chiave del sistema nervoso centrale (SNC). Qui, stiamo riportando un metodo pratico di sessuato dell'ippocampo protocollo cultura astrociti al fine di studiare i meccanismi alla base della funzione degli astrociti in cuccioli di neonato maschio e femmina dopo ischemia in vitro. 

Video: Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Isolamento e la coltura di astrociti corticali mouse

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Ricerca

Neuroscienze

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms responsible for those differences remain unclear. Primary disassociated embryonic neuronal culture provides a simplified experimental model with which to investigate the neuronal cell signaling involved in cell death as a result of ischemia or disease; however, most neuronal cultures used in research today are mixed sex. Researchers can and do test the effects of sex steroid treatment in mixed sex neuronal cultures in models of neuronal injury and disease, but accumulating evidence suggests that the female brain responds to androgens, estrogens, and progesterone differently than the male brain. Furthermore, neonate male and female rodents respond differently to ischemic injury, with males experiencing greater injury following cerebral ischemia than females. Thus, mixed sex neuronal cultures might obscure and confound the experimental results; important information might be missed. For this reason, the Herson Lab at the University of Colorado School of Medicine routinely prepares sex-stratified primary disassociated embryonic neuronal cultures from both hippocampus and cortex. Embryos are sexed before harvesting of brain tissue and male and female tissue are disassociated separately, plated separately, and maintained separately. Using this method, the Herson Lab has demonstrated a male-specific role for the ion channel TRPM2 in ischemic cell death. In this manuscript, we share and discuss our protocol for sexing embryonic mice and preparing sex-stratified hippocampal primary disassociated neuron cultures. This method can be adapted to prepare sex-stratified cortical cultures and the method for embryo sexing can be used in conjunction with other protocols for any study in which sex is thought to be an important determinant of outcome.

Primary disassociated embryonic hippocampal neuronal cultures are useful for investigating the signaling mechanisms involved in neuron death. Sexing the embryos before the isolation and dissociation of the hippocampus allows the preparation of separate male and female cultures, which enables the researcher to identify and investigate sex-specific cell signaling.

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms ...

Assessment of Dendritic Arborization in the Dentate Gyrus of the Hippocampal Region in Mice

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity and extent of dendritic arborization correlates well with the synaptic plasticity in these cells. A reliable method for assessment of dendritic arborization is needed to characterize the deleterious effects of neurological disorders on these structures and to determine the effects of therapeutic interventions. However, quantification of these structures has proven to be a formidable task given their complex and dynamic nature. Fortunately, sophisticated imaging techniques can be paired with conventional staining methods to assess the state of dendritic arborization, providing a more reliable and expeditious means of assessment. Below is an example of how these imaging techniques were paired with staining methods to characterize the dendritic arborization in wild type mice. These complementary imaging methods can be used to qualitatively and quantitatively assess dendritic arborization that span a rather wide area within the hippocampal region.

We describe two methods for visualization and quantification of dendritic arborization in the hippocampus of mouse models: real-time and extended depth of field imaging. While the former method allows sophisticated topographical tracing and quantification of the extent of branching, the latter allows speedy visualization of the dendritic tree.

Valutazione della dendritiche arborizzazione nel giro dentato della Regione ippocampale nei topi

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity ...

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of oxygen and glucose, which causes energy failure and neuronal death. After an ischemic stroke insult, astrocytes become reactive and proliferate around the injury site as it develops. Under this scenario, it is difficult to study the specific contribution of astrocytes to the brain region exposed to ischemia. Therefore, this article introduces a methodology to study primary astrocyte reactivity and proliferation under an in vitro model of an ischemia-like environment, called oxygen glucose deprivation (OGD). Astrocytes were isolated from 1-4 day-old neonatal rats and the number of non-specific astrocytic cells was assessed using astrocyte selective marker Glial Fibrillary Acidic Protein (GFAP) and nuclear staining. The period in which astrocytes are subjected to the OGD condition can be customized, as well as the percentage of oxygen they are exposed to. This flexibility allows scientists to characterize the duration of the ischemic-like condition in different groups of cells in vitro. This article discusses the timeframes of OGD that induce astrocyte reactivity, hypertrophic morphology, and proliferation as measured by immunofluorescence using Proliferating Cell Nuclear Antigen (PCNA). Besides proliferation, astrocytes undergo energy and oxidative stress, and respond to OGD by releasing soluble factors into the cell medium. This medium can be collected and used to analyze the effects of molecules released by astrocytes in primary neuronal cultures without cell-to-cell interaction. In summary, this primary cell culture model can be efficiently used to understand the role of isolated astrocytes upon injury.

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex event in which the specific contribution of astrocytes to the affected brain region exposed to oxygen glucose deprivation (OGD) is difficult to study. This article introduces a methodology to obtain isolated astrocytes and study their reactivity and proliferation under OGD conditions.

Monitoraggio del Astrocyte reattività e proliferazione in Vitro in condizioni ischemiche-come

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of ...

Neurobehavioral Assessments in a Mouse Model of Neonatal Hypoxic-ischemic Brain Injury

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI brain injury by studying neurobehavioral functions in these mice compared to non-operated (i.e., normal) mice. During the study, Rice-Vannucci&#39;s method was used to induce neonatal HI brain damage in postnatal day 7-10 (P7-10) mice. The HI operation was performed on the pups by unilateral carotid artery ligation and exposure to hypoxia (8% O2 and 92% N2 for 90 min). One week after the operation, the damaged brains were evaluated with the naked eye through the semi-transparent skull and were categorized into subgroups based on the absence (&#34;no cortical injury&#34; group) or presence (&#34;cortical injury&#34; group) of cortical injury, such as a lesion in the right hemisphere. On week 6, the following neurobehavioral tests were performed to evaluate the cognitive and motor functions: passive avoidance task (PAT), ladder walking test, and grip strength test. These behavioral tests are helpful in determining the effects of neonatal HI brain injury and are used in other mouse models of neurodegenerative diseases. In this study, neonatal HI brain injury mice showed motor deficits that corresponded to right hemisphere damage. The behavioral test results are relevant to the deficits observed in human neonatal HI patients, such as cerebral palsy or neonatal stroke patients. In this study, a mouse model of neonatal HI brain injury was established and showed different degrees of motor deficits and cognitive impairment compared to non-operated mice. This work provides basic information on the HI mouse model. MRI images demonstrate the different phenotypes, separated according to the severity of brain damage by motor and cognitive tests.

We performed unilateral carotid artery occlusion on postnatal day 7-10 CD-1 mouse pups to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of HI brain injury. We studied neurobehavioral functions in these mice compared to non-operated normal mice.

Valutazioni di neurobehavioral in un modello murino di ferita di cervello Hypoxic-ischemica neonatale

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI ...

Ex Vivo Pressurized Hippocampal Capillary-Parenchymal Arteriole Preparation for Functional Study

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and cardiac arrest are remarkably sexually dimorphic diseases, and both induce cerebral ischemia. However, progress in understanding the vascular cognitive impairment, and then developing sex-specific treatments, has been partly limited by challenges in investigating the brain microcirculation from mouse models in functional studies. Here, we present an approach to examine the capillary-to-arteriole signaling in an ex vivo hippocampal capillary-parenchymal arteriole (HiCaPA) preparation from mouse brain. We describe how to isolate, cannulate, and pressurize the microcirculation to measure arteriolar diameter in response to capillary stimulation. We show which appropriate functional controls can be used to validate the HiCaPA preparation integrity and display typical results, including testing potassium as a neurovascular coupling agent and the effect of the recently characterized inhibitor of the Kir2 inward rectifying potassium channel family, ML133. Further, we compare the responses in preparations obtained from male and female mice. While these data reflect functional investigations, our approach can also be used in molecular biology, immunochemistry, and electrophysiology studies.

The present manuscript details how to isolate hippocampal arterioles and capillaries from the mouse brain and how to pressurize them for pressure myography, immunofluorescence, biochemistry, and molecular studies.

Ex Vivo Pressurizzato Ippocampo Capillary-Parenchymal Arteriole Preparazione per lo Studio Funzionale

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and ...

A Cell Culture Model for Studying the Role of Neuron-Glia Interactions in Ischemia

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent neuronal loss. Numerous evidence suggests that the interaction between glial and neuronal cells exert beneficial effects after an ischemic event. Therefore, to explore potential protective mechanisms, it is important to develop models that allow studying neuron-glia interactions in an ischemic environment. Herein we present a simple approach to isolate astrocytes and neurons from the rat embryonic cortex, and that by using specific culture media, allows the establishment of neuron- or astrocyte-enriched cultures or neuron-glia cultures with high yield and reproducibility.
To study the crosstalk between astrocytes and neurons, we propose an approach based on a co-culture system in which neurons cultured in coverslips are maintained in contact with a monolayer of astrocytes plated in multiwell plates. The two cultures are maintained apart by small paraffin spheres. This approach allows the independent manipulation and the application of specific treatments to each cell type, which represents an advantage in many studies.
To simulate what occurs during an ischemic stroke, the cultures are subjected to an oxygen and glucose deprivation protocol. This protocol represents a useful tool to study the role of neuron-glia interactions in ischemic stroke.

Here, we present a simple approach using specific culture media that allows the establishment of neuron- and astrocyte-enriched cultures, or neuron-glia cultures from the embryonic cortex, with high yield and reproducibility.

Un modello di coltura cellulare per studiare il ruolo delle interazioni Neuron-Glia in Ischemia

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent ...

Analysis of Astrocyte Territory Volume and Tiling in Thick Free-Floating Tissue Sections

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the brain. Through these interactions, astrocytes actively regulate many critical brain functions, including synapse formation, neurotransmission, and ion homeostasis. In the rodent brain, astrocytes grow in size and complexity during the first three postnatal weeks and establish distinct, non-overlapping territories to tile the brain. This protocol provides an established method for analyzing astrocyte territory volume and astrocyte tiling using free-floating tissue sections from the mouse brain. First, this protocol describes the steps for tissue collection, cryosectioning, and immunostaining of free-floating tissue sections. Second, this protocol describes image acquisition and analysis of astrocyte territory volume and territory overlap volume, using commercially available image analysis software. Lastly, this manuscript discusses the advantages, important considerations, common pitfalls, and limitations of these methods. This protocol requires brain tissue with sparse or mosaic fluorescent labeling of astrocytes, and is designed to be used with common lab equipment, confocal microscopy, and commercially available image analysis software.

This protocol describes methods for sectioning, staining, and imaging free-floating tissue sections of the mouse brain, followed by a detailed description of the analysis of astrocyte territory volume and astrocyte territory overlap or tiling.

Analisi del volume e della piastrellatura del territorio degli astrociti in sezioni di tessuto fluttuanti spesse

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the ...

Occlusione dell'arteria media distale per sviluppare un modello murino di ictus ischemico

Induction of Acute Ischemic Stroke in Mice Using the Distal Middle Artery Occlusion Technique

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic stroke patients are eligible to receive intravascular thrombolysis or mechanical thrombectomy therapy within the optimal time window. Among those stroke survivors, around two-thirds suffer neurological dysfunctions over an extended period. Establishing a stable and repeatable experimental ischemic stroke model is extremely significant for further investigating the pathophysiological mechanisms and developing effective therapeutic strategies for ischemic stroke. The middle cerebral artery (MCA) represents the predominant location of ischemic stroke in humans, with the MCA occlusion serving as the frequently employed model of focal cerebral ischemia. In this protocol, we describe the methodology of establishing the distal MCA occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6 mice. Since the occlusion site is located at the cortical branch of MCA, this model generates a moderate infarcted lesion restricted to the cortex. Neurological behavioral and histopathological characterization have demonstrated visible motor dysfunction, neuron degeneration, and pronounced activation of microglia and astrocytes in this model. Thus, this dMCAO mouse model provides a valuable tool for investigating the ischemiastroke and worth of popularization.

Autore in primo piano: Stabilire un modello di occlusione MCA distale affidabile nei topi per la ricerca sull'ictus

Here, we present a protocol to establish a distal middle cerebral artery occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6J mice and evaluate the subsequent neurological behavior and histopathological features.

Induzione di ictus ischemico acuto nei topi utilizzando la tecnica di occlusione dell'arteria media distale

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic ...

Le differenze di sesso in ippocampali di topo astrociti dopo

Riepilogo

Esplora Altri Video

Capitoli in questo video

Isolamento e la coltura di astrociti corticali mouse

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Valutazione della dendritiche arborizzazione nel giro dentato della Regione ippocampale nei topi

Monitoraggio del Astrocyte reattività e proliferazione in Vitro in condizioni ischemiche-come

Valutazioni di neurobehavioral in un modello murino di ferita di cervello Hypoxic-ischemica neonatale

Ex Vivo Pressurizzato Ippocampo Capillary-Parenchymal Arteriole Preparazione per lo Studio Funzionale

Un modello di coltura cellulare per studiare il ruolo delle interazioni Neuron-Glia in Ischemia

Analisi del volume e della piastrellatura del territorio degli astrociti in sezioni di tessuto fluttuanti spesse

Induzione di ictus ischemico acuto nei topi utilizzando la tecnica di occlusione dell'arteria media distale

Induzione di ictus ischemico acuto nei topi utilizzando la tecnica di occlusione dell'arteria media distale